DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Effective Filing Date
The present application, filed on April 25, 2022 is a 371 of PCT/EP2020/079344, filed on October 19, 2020 and claims foreign priority to EPO 19205451.8, filed on October 25, 2019. A certified copy of the English language foreign priority document was filed on April 25, 2022. Therefore, the effective filing date of the present application is determined to be October 25, 2019.
Claim Status and Action Summary
This action is in response to the papers filed on November 21, 2025.
Claim 9 was canceled and claims 16-20 were added in the amendment dated November 21, 2025.
Claims 1-8 and 10-20 are pending in the present application.
Claims 1-8 and 10-20 are under examination.
Any objections and rejections not reiterated below are hereby withdrawn.
The objections of record to the drawings has been withdrawn in view of the replacement drawings dated November 21, 2025.
The objections of record to the specification have been withdrawn in view of the substitute specification dated November 21, 2025.
The 112(b) indefiniteness rejections of record in the previous office action have been withdrawn in view of the amendments to the claims.
The 102(a)(1) and 103 rejections of record have been withdrawn in view of the amendments to the claims narrowing the scope of the claims to embodiments requiring one of the previously listed alternative nucleic acid sequences (SEQ ID NO: 7) and a corresponding amino acid sequence (SEQ ID NO: 2) encoded by an open reading frame within SEQ ID NO: 7.
The provisional double patenting rejection over 17/625,063 has been withdrawn in view of the amendments limiting the claim scope to nucleic acid molecules and proteins or peptides corresponding to HLA-J.
Drawings
The drawings filed on November 21, 2025 are acceptable.
Claim Objections
Claims 2, 8 and 13-16 are objected to because of the following informalities:
Claim 2 recites: “as defined claim 1” in lines 4, 6, 8, and 10. This appears to be a typographical error for “as defined in claim 1” or “as defined by claim 1”.
Claim 8 recites: “The method claim 6”, recited in step B, line 1. This appears to be a typographical error omitting “of” between “method” and “claim”.
Claims 13, 14, and 15 recite: “The diagnostic agent for use of claim…”
Claim 16 recites “The method of claim 10, , wherein”. It appears that the extra space and comma are typographical errors.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(a)- Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Claims 1-8 and 10-20 are rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, at the time the application was filed, had possession of the claimed invention.
This rejection has been updated as necessitated by the amendments to the claims.
Relevant to the lack of particular structural limitations in the rejected claims drawn to methods for: “producing a medicament for the treatment or prevention of a tumor in a subject or a diagnostic agent for the detection of a tumor in a subject comprising… producing a medicament capable of inhibiting the expression of the at least [one] nucleic acid molecule and/or at least one protein or peptide in the subject… and/or producing a diagnostic agent capable of detecting in vivo the sites of expression of the at least one nucleic acid molecule and/or the at least one protein or peptide in the subject…”, “A medicament produced by the method of claim 1”, and “A diagnostic agent produced by the method of claim 1”, MPEP 2163 states:
“… describing a composition by its function alone typically will not suffice to sufficiently describe the composition. See Eli Lilly, 119 F.3 at 1568, 43 USPQ2d at 1406 (Holding that description of a gene’s function will not enable claims to the gene “because it is only an indication of what the gene does, rather than what it is.”); see also Fiers, 984 F.2d at 1169-71, 25 USPQ2d at 1605-06 (discussing Amgen Inc. v. Chugai Pharm. Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991)). An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See, e.g., Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004) (The patent at issue claimed a method of selectively inhibiting PGHS-2 activity by administering a non-steroidal compound that selectively inhibits activity of the PGHS-2 gene product, however, the patent did not disclose any compounds that can be used in the claimed methods. While there was a description of assays for screening compounds to identify those that inhibit the expression or activity of the PGHS-2 gene product, there was no disclosure of which peptides, polynucleotides, and small organic molecules selectively inhibit PGHS-2. The court held that “[w]ithout such disclosure, the claimed methods cannot be said to have been described.”).
The claims are broadly drawn to methods for: “producing a medicament for the treatment or prevention of a tumor in a subject or a diagnostic agent for the detection of a tumor in a subject comprising… producing a medicament capable of inhibiting the expression of the at least [one] nucleic acid molecule and/or at least one protein or peptide in the subject… and/or producing a diagnostic agent capable of detecting in vivo the sites of expression of the at least one nucleic acid molecule and/or the at least one protein or peptide in the subject…”, and products by process: “A medicament produced by the method of claim 1”, and “A diagnostic agent produced by the method of claim 1”.
In the case of the instant claims, the functionality of “inhibiting the expression of the at least one nucleic acid molecule and/or the at least one protein or peptide in the subject” and “detecting in vivo the sites of expression of the at least one nucleic acid molecule and/or the at least one protein or peptide in the subject” are critical features of the claimed methods and products.
The specification teaches that “the nature of the medicament is not particularly limited as long as it is capable of inhibiting the expression…” (i.e. performing the function) (page 3, lines 13-15) and “the nature of the diagnostic agent is not particularly limited as long as it is capable of detecting in vivo the sites of expression…” (page 3, lines 16-17). The specification teaches that “a subject… refers to a mammal” (page 3, line 35), and “a tumor is an abnormal benign or malignant new growth of tissue that possesses no physiological function and arises from uncontrolled usually rapid cellular proliferation.” (page 4, lines 1-2). With respect to the genera of diagnostic agents and medicaments, the specification teaches the sequences of a set of primers and probes for a genus of nucleic acid sequences (targets: SEQ ID NOs 6 to 10) (pages 32-33, Table 1). The primers and probes were used to detect the target nucleic acid molecules in “powdered and homogenized” samples by real time PCR (page 32, lines 5-17). “Alternatives to qPCR” taught by the specification are electrophoretic techniques (Northern blot and ribonuclease protection assay), next generation sequencing, and DNA microarrays (page 8). Finally, the specification teaches “the peptide sequence for the generation of the unique HLA-J antibody… named JULY Antibody” (page 26, line 39-40, figure 1, and page 27, lines 31-38) and that “various techniques for the production of antibodies are well known in the art (page 17, line 31).
However, the specification does not teach any particular peptide, polynucleotide, small organic molecule, etc. that is shown to be “capable of detecting in vivo the sites of expression of at least one [of the target genes]”, much less “capable of inhibiting the expression of at least one [of the target genes]” in the subject. While the specification teaches that methods for the production of antibodies are well known in the art and refers to publications containing detailed instructions a skilled artisan could follow to produce an antibody against the antigen disclosed in figure 1, there is no disclosure of any particular structure that is capable of performing the claimed functions.
While the skilled artisan may be capable of making an antibody with the claimed functionality of “inhibiting the expression” or “detecting in vivo the sites” of HLA-J, possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features. See University of Rochester, 358 F.3d at 927, 69 USPQ2d at 1895.
The claims encompass an extremely broad genus of structurally undefined “medicaments” and “diagnostic agents” comprising: “a small molecule, an aptamer, a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas9-based construct, a CRISPR-Cpf1-based construct, a meganuclease, a zinc finger nuclease, or a transcription activator-like (TAL) effector (TALE) nuclease, an antibody mimetic, an affibody, an adnectin, an anticalin, a DARPin, an avimer, a nanofitin, an affilin, a Kunitz domain peptide, or a Fynomer capable of [performing the claimed function]. ” The claims are so broad, given the definitions in the specification, as to encompass essentially any agent capable of binding to any amino acid sequence with at least 95% identity to SEQ ID NO:2 (i.e. “HLA-J”) or to any nucleic acid sequence comprising a nucleic acid sequence that encodes a polypeptide that is at least 95% identical to SEQ ID NO:2 in any tumor in any mammal.
For claims drawn to a genus, the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species. A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”). The disclosure of only one species encompassed within a genus adequately describes a claim directed to that genus only if the disclosure “indicates that the patentee has invented species sufficient to constitute the gen[us].” See Enzo Biochem, 323 F.3d at 966, 63 USPQ2d at 1615. Further, University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 held that: “To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that “the inventor invented the claimed invention.” Lockwood v. American Airlines, Inc. 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (1997); In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (“[T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed.”). Thus, an applicant complies with the written description requirement “by describing the invention, with all its claimed limitations, not that which makes it obvious,” and by using “such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention.” Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966.”
In the instant case, only a single species of the claimed invention is disclosed (the “JULY” antibody which is capable of binding to and detecting human HLA-J in the context of a western blot of homogenized tumor tissues AND placenta (i.e. not a tumor)). However, the “JULY” antibody is only described by the antigen against which it was raised, by reference to exemplary “well known” procedures that a skilled artisan could follow to produce another (not necessarily the same) antibody that would be unlikely to have exactly the same properties (amino acid sequence, binding properties, etc.), and by a western blot demonstrating that the JULY antibody detects some protein (presumably HLA-J) in extracts from homogenized tissue samples from ovarian cancer, breast cancer, bladder cancer, and placental tissue (i.e. not detecting the sites of expression in vivo in a subject and not inhibiting the expression of HLA-J in a subject). Additionally, there is no disclosure of the structure of the “JULY” antibody (i.e. amino acid sequence). As there is no disclosure of which antibod(ies) raised against the disclosed antigen (the HLA-J fragment), much less any other peptides, polynucleotides, and small organic molecules detect or inhibit the expression of HLA-J, the claimed method requiring the use of the “JULY” antibody cannot be said to have been described.
Furthermore, the broader claimed genera comprising medicaments or diagnostic agents capable of inhibiting the expression of, or detecting in vivo the sites of expression of, the broad genus of nucleic acid molecules or polypeptides encoded by said nucleic acid molecules in any tumor in any mammalian subject cannot be said to have been described by the disclosure of a single species. Even more, as discussed above, the disclosure of the single species, single “JULY” antibody described only by its function (ability to bind to a protein of the same size as HLA-J in extracts from human cancer samples and human placenta samples) and by methods by which similar antibodies may be produced cannot be said to have been described by the present disclosure.
Thus, considering the breadth of the compounds required by the claimed methods, their specific required functionalities, and the teachings of the instant specification, it is the conclusion that the specification does not provide an adequate written description of the broadly claimed subject matter.
Response to arguments
The response argues:
A) That the claim amendments narrowing the scope of the independent claims to embodiments that require polypeptide or nucleic acid sequences that comprise or consist of sequences that are at least 95% identical to HLA-J resolves the 112(a) written description rejection of record.
B) “The present application indeed discloses the precise HLA-J sequences (SEQ ID NOs: 2 and 7), their use in detecting and modulating HLA-J expression, and closely related variants.
C) “regard[ing]… binding and/or inhibiting molecules… are not generic aspirations but established structural classes whose design is routing once a target sequence is known… the art provides well-defined frameworks and widely used design rules that take as input the disclosed HLA-J nucleic acid sequence (SEQ ID NO: 7) to produce sequence-specific binding polypeptides or inhibitors using conventional parameters.
D) “for protein-based agents, the specification describes antibodies to HLA-J and provides a concrete working example (i.e., the anti-HLA-J JULY antibody), confirming that the inventors were in possession of antibodies directed to the disclosed HLA-J polypeptide (SEQ ID NO: 2). Antibody generation against a known protein sequence is routine…”
E) “antibody mimetics… can be designed to incorporate novel binding sites through common protein engineering strategies… [which] is a routine approach used for numerous scaffold families and antibody mimetics known in the art.”
These arguments have been thoroughly reviewed and are not persuasive.
While the claim amendments do substantially limit the scope of the claim relative to the previously recited genera, the “method for producing a medicament for the treatment or prevention of a tumor in a subject”, “[method for producing] a diagnostic agent for the detection of a tumor in a subject”, and “A medicament [or diagnostic agent] produced by the method of claim 1” still cannot be said to have been described by the disclosure as originally filed for the reasons identified in the 112(a) rejections above.
In response to arguments (a) and (b), the scope of the claims and the disclosure of the amino acid sequence SEQ ID NO: 2 and the nucleic acid sequence SEQ ID NO: 7 comprising an open reading frame encoding SEQ ID NO: 2 corresponding to HLA-J (i.e. the naturally occurring target sequence) is not in dispute regarding the 112(a) written description rejection.
Regarding arguments (c-e), the argument that nucleic acids, antibodies, antibody mimetics, and other genera of molecules having the claimed functions: (i) binding to the target nucleic acid or protein, (ii) inhibiting the expression of the target nucleic acid, (iii) inhibiting the function of the target protein, and/or (iv) detecting in vivo the sites of expression of the target nucleic acid or protein can be derived by routine and conventional procedures known to a skilled artisan given only a target nucleic acid comprising the open reading frame encoding the target polypeptide sequence, or said target polypeptide sequence, is not persuasive.
As discussed above, the instant claims, given their broadest reasonable interpretation, encompass an exceedingly large and diverse genus of biomolecules comprising any of the following categories, limited only in that they bind to the target nucleic acid or protein sequence (i.e. HLA-J): primer, siRNA, shRNA, ribozyme, antisense nucleic acid molecule, CRISPR-Cas9-based construct, CRISPR-Cpf1-based construct, meganuclease, zinc finger nuclease, TALEN, antibody, antibody mimetic, a binding polypeptide derived from the Z-domain of staphylococcal protein A, a molecule based on the 10th extracellular domain of human fibronectin III, an engineered protein derived from a lipocalin, a designed ankyrin repeat domain, an antibody mimetic consisting of two or more 30 to 35 aa peptides derived from A-domains of membrane receptors linked by linker peptides, a protein derived from the DNA-binding protein Sac7d of Sulfolobus acidocaldarius, an antibody mimetic developed using gamma-B crystalline or ubiquitin as a scaffold, a Kunitz-domain peptide, or a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain.
As was described in the 112(a) rejection of record, the legal requirements necessary to fulfill the written description requirement and applicable case law are reviewed in MPEP 2163 (reproduced here for convenience):
“… describing a composition by its function alone typically will not suffice to sufficiently describe the composition. See Eli Lilly, 119 F.3 at 1568, 43 USPQ2d at 1406 (Holding that description of a gene’s function will not enable claims to the gene “because it is only an indication of what the gene does, rather than what it is.”); see also Fiers, 984 F.2d at 1169-71, 25 USPQ2d at 1605-06 (discussing Amgen Inc. v. Chugai Pharm. Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991)). An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See, e.g., Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004) (The patent at issue claimed a method of selectively inhibiting PGHS-2 activity by administering a non-steroidal compound that selectively inhibits activity of the PGHS-2 gene product, however, the patent did not disclose any compounds that can be used in the claimed methods. While there was a description of assays for screening compounds to identify those that inhibit the expression or activity of the PGHS-2 gene product, there was no disclosure of which peptides, polynucleotides, and small organic molecules selectively inhibit PGHS-2. The court held that “[w]ithout such disclosure, the claimed methods cannot be said to have been described.”).
Furthermore, for claims drawn to a genus, the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species. A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”). The disclosure of only one species encompassed within a genus adequately describes a claim directed to that genus only if the disclosure “indicates that the patentee has invented species sufficient to constitute the gen[us].” See Enzo Biochem, 323 F.3d at 966, 63 USPQ2d at 1615. Further, University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 held that: “To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that “the inventor invented the claimed invention.” Lockwood v. American Airlines, Inc. 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (1997); In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (“[T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed.”). Thus, an applicant complies with the written description requirement “by describing the invention, with all its claimed limitations, not that which makes it obvious,” and by using “such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention.” Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966.”
In the instant case, the argument that the ordinary artisan can derive some molecule(s) that bind(s) to the target sequence only given the identity of the target sequence and “well-known” guidelines and protocols is, at best, an assertion of a plan for obtaining the claimed chemical invention. The present claims only define the claimed products or methods of producing said products by the function of the genus of desired products. As described above, the specification provides no structures, formulae, chemical names, or physical properties that precisely define a representative number of the structurally diverse genera of claimed medicaments or diagnostic agents. The instant specification provides only data purporting to show binding of an antibody “JULY” to a protein (or proteins) in several tumor samples and non-tumor samples (placenta), however, no structure, or even primary nucleotide or amino acid sequence of this antibody has been provided.
It is the position of the examiner that even this single species “JULY” within the vast and structurally diverse genus of claimed molecules identified above (and methods for producing said molecules) cannot be said to have been described because it is only identified by its function (binding to HLA-J), no structures or amino acid sequences of the antibody or genes encoding said antibody have been described, and the description and arguments merely suggest that the ordinary artisan could arrive at antibodies having the shared property of HLA-J binding (i.e. not an identical antibody) by following protocols asserted to be known in the art without teaching any structures of any molecules having the claimed functions. Without the disclosure of sufficient chemical properties (i.e. amino acid or nucleotide sequence) necessary to structurally define the “JULY” antibody from any other HLA-J binding antibody, it is impossible for one skilled in the art to clearly conclude that “the inventor invented the claimed invention.” Indeed, given the lack of structurally identifying information, it is not possible from the presented disclosure for one skilled in the art to even replicate the presented data for the “JULY” antibody.
Claim Rejections - 35 USC § 112(b)-Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 10 and 14-19 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
This is a new grounds of rejection necessitated by the amendments to the claims.
Claim 10 recites the terms “the small molecule” and “the protein drug” in lines 2 and 5. Claim 1, as presently amended, does not recite “a small molecule” or “a protein drug”. Therefore, there is insufficient antecedent basis for these terms in the claims.
Claim 14 recites the terms “the radiation dose uptake” and “the radioisotope”. Similarly claim 15, which depends upon claim 14, recites “the measured radiation dose uptake. As presently amended, claims 1 and 12, upon which claim 14 depends, do not recite “a radiation dose uptake”, “a radiation dose”, or “a radioisotope”. Therefore, there is insufficient antecedent basis for these terms in the claims.
Claims 16-19 depend from claim 10 and thus include the indefinite limitations of claim 10.
Claim Interpretation
It is noted that all of the different “diagnostic agents” and “medicaments” are recited as alternatives (i.e. linked by “and/or”). Therefore, the broadest reasonable interpretation of the claim only requires step: (A) determining the expression of (a nucleic acid molecule OR a protein)…, AND at least one of steps: (B) producing a medicament capable of inhibiting the expression of the biomolecule measured in (A), OR (B’) producing a diagnostic agent capable of detecting… the biomolecule measured in (A). Therefore, for example, the broadest reasonable interpretation of claim 1 encompasses embodiments wherein: (A) HLA-J mRNA expression is measured in a sample from a subject AND (B’) a diagnostic agent is produced for detecting HLA-J. Claim 1 as presently amended explicitly defines that a diagnostic is or comprises (among multiple alternatives) a primer… capable of binding to the HLA-J mRNA. Therefore, in this embodiment, the claim only requires measuring HLA-J mRNA expression and producing a primer capable of binding to said mRNA.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-8 and 12 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter.
This is a new grounds of rejection necessitated by the amendments to the claims.
35 USC §101 requires that to be patent-eligible, an invention (1) must be directed to one of the four statutory categories, and (2) must not be wholly directed to subject matter encompassing a judicially recognized exception. M.P.E.P §2106. Regarding judicial exceptions, “[p]henomena of nature, though just discovered, mental processes, and abstract intellectual concepts are not patentable, as they are the basic tools of scientific and technological work.” Gottschalk v. Benson, 409 U.S. 63, 67 (1972); see also M.P.E.P. §2106, part II.
Based upon consideration of the claims as a whole, as well as consideration of elements/steps recited in addition to the judicial exception, the present claims fail to meet the elements required for patent eligibility.
Step 1
The claimed invention is directed to “a method for producing… a diagnostic agent for the detection of a tumor in a subject” (Claims 1-8; methods of producing a product) and “A diagnostic agent produced by the method of claim 1…” (Claim 12; a product produced by a process).
Step 2A Prong I
The claims are taken to be directed to natural phenomena.
Claims 1-8, given their broadest reasonable interpretations (see above) are directed to methods of producing a diagnostic agent that is or comprises a primer capable of binding to an expressed nucleic acid molecule that is at least 95% identical to a nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 7.
Claim 12 is directed to a diagnostic agent (i.e. a product) produced by the method of claim 1. Given their broadest reasonable interpretation, claims 1-8 only require that the diagnostic agent is or comprises a primer that can bind to the naturally occurring nucleic acid sequence of the human gene HLA-J (i.e. SEQ ID NO: 7).
Therefore, claims 1-8 and 12 are directed to methods of producing a naturally occurring nucleic acid sequence (i.e. the primer that can bind to naturally occurring SEQ ID NO: 7), and the primer produced by said method (i.e. the judicial exception of natural phenomena/products of nature).
The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception for the reasons which follow.
The courts have identified the following concepts and products as examples of laws of nature or natural phenomena:
Isolated DNA, Ass’n for Molecular Pathology v. Myriad Genetics, Inc., 569 U.S. 576, 589-91, 106 USPQ2d 1972, 1978-79 (2013);
Single-stranded DNA fragments known as “primers”, University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 761, 113 USPQ2d 1241, 1244 (Fed. Cir. 2014)
The claims encompass products that are not markedly different from products of nature for the following reasons:
Regarding claims 1-8 and 12, the claimed nucleic acid primer sequences are defined only in that they can bind to (i.e. are complementary to) SEQ ID NO: 7, which is 100% identical to a naturally occurring sequence in the human genome (i.e. HLA-J). Because the naturally occurring counterpart of the claimed sequence and complementary nucleic acid sequences thereof is a segment of a chromosome, and the claims do not recite any additional structural elements that differentiate the claimed products from their natural counterparts, the claimed nucleotide sequence is not markedly different from the naturally occurring DNA sequences found in the human genome. An alignment of the claimed SEQ ID NO: 7 to its naturally occurring counterpart follows below:
A sequence that is 99.94% identical to SEQ ID NO: 7 and comprises the identical open reading frame encoding SEQ ID NO: 2 (nucleotide position 335-994): Genbank ID: NR_024240.1:
PNG
media_image1.png
930
834
media_image1.png
Greyscale
PNG
media_image2.png
786
687
media_image2.png
Greyscale
Regarding claims 1-8 and 12, the claimed primer sequences that can bind to a sequence having at least 95% sequence identity to SEQ ID NO: 7 clearly encompasses naturally occurring nucleic acid sequences.
Step 2A Prong II:
The claimed subject matter is not integrated into a practical application of the exception. The claims do not recite any additional elements that integrate the exception into a practical application of the exception.
Claims 1-8 recite various “determining the expression of” the claimed nucleic acid sequence in addition to other genes (at least one HLA class Ib gene (claim 3), or at least one HLA class I gene (claim 4), or at least one HLA class II gene (claim 5), or at least one growth factor or tumor marker or protein expressed in early pregnancy and carcinoembryonic regression (claims 6-8). These additional “determining the expression” steps recited by claims 2-8 do not integrate the exception of the naturally occurring nucleic acid molecules encompassed by claim 1 into a practical application because these steps do not appear to be related to the goal of “producing a diagnostic agent” recited by claim 1. At most, these steps constitute data-gathering steps that are not related to the goal of claim 1 (i.e. extra-solution activity).
Step 2B:
Having established that the claims include a naturally occurring product that is a judicial exception, it must now be determined whether or not the claims recite an element or combination of elements that amount to significantly more than that exception, and whether those additional elements also amount to significantly more for the other claimed exception(s), which ensures that the claim does not have a preemptive effect with respect to any of the recited exceptions. To determine whether a claim that includes a nature-based product limitation recites a “product of nature” exception, an analysis is performed in which it is first determined if a claim includes a nature-based product that has markedly different characteristics from the corresponding naturally occurring product, and if it does not, then it is determined whether or not other elements of the claim are sufficient to ensure that the claim as a whole amounts to significantly more than the exception itself. In order to be markedly different, the claimed product must possess at least one characteristic that is different from the counterpart.
In the instant case, none of these claims provide any additional elements in addition to the judicial exceptions already claimed that would prevent the claims from having a pre-emptive effect on the use of the judicial exception. The fact that the expression of the gene in question, and/or other genes is/are measured in addition to “producing a diagnostic agent” adds nothing to the judicial exception (i.e. the primers) that would distinguish them from the naturally occurring material.
As is described in MPEP 2106.04(c), under their broadest reasonable interpretation, process claims reciting no active steps material to the process of providing a naturally occurring product in addition to the providing step (i.e. “producing a diagnostic agent… that is or comprises a primer [having a naturally occurring sequence complementary to SEQ ID NO: 7]) are drafted in such a way that there is no difference in substance from a product claim.
For example, claims to detecting naturally occurring cell-free fetal DNA (cffDNA) in maternal blood were held to be directed to the cffDNA, because the "existence and location of cffDNA is a natural phenomenon [and thus] identifying its presence was merely claiming the natural phenomena itself." Rapid Litig. Mgmt., 827 F.3d at 1048, 119 USPQ2d at 1374, (explaining the holding in Ariosa Diagnostics, Inc. v. Sequenom, 788 F.3d 1371, 115 USPQ2d 1152 (Fed. Cir. 2015)).
Therefore, the claims are rejected under 35 U.S.C 101 as being drawn to patent-ineligible subject matter.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-2, 6, 8, and 12 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Emi et al., US 2008/0026950 A1, cited as US patent application publication reference number 1 on the IDS filed on September 19, 2025 after the nonfinal office action of record dated June 26, 2025.
This is a new grounds of rejection necessitated by the amendments to the claims.
Regarding claim 1, Emi et al. teach methods for producing a diagnostic agent for breast cancers comprising measuring expression levels of “MHC Class I HLA-J”, alternately referred to as M80469 in tables (Emi et al., figure 5 and Table 7, page 15) using RT-PCR (i.e. comprising primers specific for HLA-J expression; primers capable of binding to a nucleic acid comprising or consisting of SEQ ID NO: 7) (Emi et al., paragraph 0266).
Also see UCSC genome browser alignment below (note, M80469_rev primer contains one G>C SNP relative to the HG38 assembly); Seq ID NO: 7 also comprises SNPs relative to HG38.
>M80469_REV_rc
CTGTTCAAGGTGTGACCCCT
>M80469_rev contains SNP relative to hg38 (this is the HG38 sequence with the SNP underlined)
CTGTTGAAGGTGTGACCCCT
PNG
media_image3.png
249
910
media_image3.png
Greyscale
Regarding claim 2, Emi et al. teach measuring the expression of nucleic acid molecules derived from SEQ ID NO: 7 (i.e. HLA-J) (Emi et al., figure 5).
Regarding claims 6 and 8, Emi et al. teach further measuring the expression of tumor markers (i.e. genes highly expressed in cancer) comprising somatostatin receptor isoform 2 (SSTR2) gene (Emi et al., page 18, table 11).
Regarding claim 12, Emi et al. teach a diagnostic agent produced by the method of claim 1 (i.e. RT-PCR primers specific for HLA-J) (Emi et al., Figure 5).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 6, 8, 10-12, and 16-19 are rejected under 35 U.S.C. 103 as being unpatentable over Emi et al., US 2008/0026950 A1 in view of Fang et al., US 8,168,586 B1 (Issued May 1, 2012) and Wang et al., US 20070111213 A1, published May 17, 2007.
This is a new grounds of rejection necessitated by the amendments to the claims.
Regarding claim 1, Emi et al. teach methods for producing a diagnostic agent for breast cancers comprising measuring expression levels of “MHC Class I HLA-J” (Emi et al., figure 5 and Table 7, page 15) using RT-PCR (i.e. comprising primers specific for HLA-J expression; primers capable of binding to a nucleic acid comprising or consisting of SEQ ID NO: 7) (Emi et al., paragraph 0266).
Emi et al. do not teach diagnostic agents or medicaments comprising antibodies capable of binding to HLA-J.
However, Fang et al. teach producing antibodies (i.e. producing diagnostic agents or medicaments) that selectively bind to Cancer-associated target “CAT” proteins (Fang et al., column 15, lines 3-26). Fang et al. teach that CAT proteins are those proteins that are differentially expressed in cancer samples in comparison with normal samples and can be interchangeably referred to as ““CAT proteins”, “targets”, “markers” or “biomarkers” [for cancers]” (Fang et al., column 7, lines 32-46). Fang et al. further teach that said antibodies can be coupled to a therapeutic agent such as cytotoxic agents, small molecule drugs, and radiotherapeutic agents (Fang et al., column 21, lines 8- column 22, line 50). Finally, Fang et al. teach that these antibodies are useful for analyzing patterns of target expression in vivo for diagnosis (i.e. as a diagnostic agent for detecting a tumor by determining the expression of a CAT protein) (Fang et al., column 32, lines 27-52).
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the methods taught by Emi et al. comprising measuring the expression of HLA-J in breast cancer diagnostics comprising HLA-J specific RT-PCR primers with the teachings of Fang et al. that cancer associated target genes (i.e. genes that are expressed in cancers) can be measured in vivo using antibodies that bind to said cancer associated target genes because Emi et al. teach that HLA-J is a gene that is differentially expressed in particular breast cancers compared to non-cancerous controls and is associated with prognostic outcome of said breast cancers. The ordinary artisan would have been motivated to modify the teachings of Emi et al., identifying HLA-J as a cancer-associated target gene (i.e. a CAT) that may be measured by RT-PCR, with the teachings of Fang et al. that CAT proteins can be detected using labeled antibodies directed against said CAT proteins, or utilized to target chemotherapeutic- or radiotherapeutic- agents to the sites of tumors that express said CAT proteins ( Fang et al., column 15, lines 3-26 [diagnostic agents] and column 21, lines 8- column 22, line 50 [medicaments]) because of the teachings of Fang et al. that antibodies directed against CAT proteins are useful for analyzing patterns of target expression in vivo for diagnosis (i.e. as a diagnostic agent for detecting a tumor by determining the expression of a CAT protein) (Fang et al., column 32, lines 27-52).
Regarding claim 2, Emi et al. teach measuring the expression of nucleic acid molecules derived from SEQ ID NO: 7 (i.e. HLA-J) (Emi et al., figure 5).
Regarding claim 6, Fang et al. teaches determining the expression of CEACAM6 (Fang et al., figure 3 and paragraph 0075). CEACAM6 is a protein being expressed during early pregnancy and in carcinoembryonic regression as defined by the instant specification (Specification, page 15, lines 15-20).
Regarding claims 6 and 8, Emi et al. teach further measuring the expression of tumor markers (i.e. genes highly expressed in cancer) comprising somatostatin receptor isoform 2 (SSTR2) gene (Emi et al., page 18, table 11).
Regarding claims 10 and 16-19, Fang et al. teaches the antibody medicament or diagnostic agent is fused to a cytotoxic agent, that may specifically be a therapeutic radioisotope, including 90Y, or 131I (Fang et al., column 21, lines 8- column 22, line 50). Fang et al. further teaches that the antibodies can be labeled with a detectable moiety such as a positron-emitting radionuclide (namely 131I) for the purposes of diagnostic applications using computed tomography and positron emission tomography (i.e. CT and PET scanning) (Fang et al., column 33, line 49-column 34, line 8).
Regarding claims 11-12, Fang et al. teaches methods for producing medicaments and diagnostic agents for the treatment, prevention, or in vivo detection of tumors in a subject (see rejection of claim 1 above).
Regarding claim 12, Emi et al. teach a diagnostic agent produced by the method of claim 1 (i.e. RT-PCR primers specific for HLA-J) (Emi et al., Figure 5).
Claims 1 and 3-5 are rejected under 35 U.S.C. 103 as being unpatentable over Emi et al., US 2008/0026950 A1 and Fang et al., US 8,168,586 B1 (Issued May 1, 2012) as applied to claims 1-2, 6, 8, 10-12, and 16-19 above, and further in view of Wang et al., US 20070111213 A1, published May 17, 2007.
This is a new grounds of rejection necessitated by the amendments to the claims.
Regarding claims 3-5, Emi et al. and Fang et al. do not teach further measuring the expression of other MHC genes comprising: (i) at least one of the MHC class Ib genes HLA-E, HLA-F, or HLA-G (claim 3), (ii) at least one of the MHC class I genes HLA-A, HLA-B, or HLA-C (claim 4), or (iii) at least one of the MHC class II genes HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, or HLA-DRB1 (claim 5).
However, regarding claim 3, Wang et al. teach methods and primers for simultaneously identifying multiple HLA alleles of one or more HLA loci in a given sample including the nonclassical MHC class I gene HLA-J (Wang et al., paragraphs 004-006). Wang et al. further teach their primers and methods may be used in the amplification of other HLA loci including the HLA-E, HLA-F, and HLA-G loci (Wang et al., paragraph 0018).
Regarding claim 4, Wang et al. teaches their primers and methods may be used in the amplification of other HLA loci including the HLA-A, HLA-B, and HLA-C loci (Wang et al., paragraph 0018).
Regarding claim 5, Wang et al. teaches their primers and methods may be used in the amplification of other HLA loci including the HLA class II genes, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1 (Wang et al., paragraph 0018).
Wang et al. teach that simultaneous detection of multiple HLA alleles is advantageous in terms of time and efficiency when performing tissue typing and disease association studies involving HLA genes (Wang et al., paragraphs 0003 and 0030-0032).
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have combined the methods taught by Emi et al. in view of Fang et al. comprising measuring HLA-J expression and producing reagents for measuring said expression or medicaments targeting tumors expressing HLA-J with the teachings of Wang et al. comprising materials and methods for measuring multiple HLA alleles (including HLA-J) simultaneously because of the teaching of Wang et al. that determination of the HLA haplotype is important for tissue typing and disease association studies.
Claims 1 and 6-8 are rejected under 35 U.S.C. 103 as being unpatentable over Emi et al., US 2008/0026950 A1 and Fang et al., US 8,168,586 B1 (Issued May 1, 2012) as applied to claims 1-2, 6, 8, 10-12, and 16-19 above, and further in view of Regev et al., WO 2018/183921 A1, published October 4, 2018.
This is a new grounds of rejection necessitated by the amendments to the claims.
Regarding claims 6-8, Emi et al. in view of Fang et al. does not teach further determining the expression of at least one growth factor or tumor marker selected from the groups recited in claim 7 or claim 8. However, Regev et al. teach methods of detecting immunotherapy resistance gene signatures in cancer and administering immunotherapies capable of reducing the expression or activity of said resistance genes (Regev et al., paragraphs 0008-0010 and 0025). Regev et al. teach that immunotherapy resistance gene signatures comprise HLA-H and HLA-J (Regev et al., paragraph 0010 and table 10) and TGFB (i.e. at least one growth factor; a transforming growth factor) (Regev et al., paragraph 0454). Regev et al. further teach tumor antigens (i.e. tumor markers) to be targeted in immunotherapy comprise PSMA and TSH receptor TSHR (Regev et al., paragraph 0178).
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the method of producing diagnostic agents or medicaments capable of detecting or reducing the expression of the genes or gene products recited by claim 1, as taught by Emi et al. in view of Fang et al, to further comprise determining the expression of TGFB, PSMA, or TSHR in addition to HLA-J. The ordinary artisan would have been motivated to further measure the expression TGFB, PSMA, and/or TSHR in addition to HLA-J because of the teaching of Regev that HLA-H, TGFB, PSMA, and TSHR are constituents of molecular signatures of immune checkpoint inhibitor resistance and direct evasion from immunity that predicts clinical responses to immunotherapy (Regev et al., paragraph 0007-0009). The ordinary artisan would have been reasonably confident that measuring the expression of immunotherapy resistance genes prior to producing (or administering) an immunotherapy (i.e. a medicament capable of reducing the expression of…) would have allowed for more accurate selection of subjects for which the therapy would be more likely to be effective.
Claims 1, 12-15, and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Emi et al., US 2008/0026950 A1 and Fang et al., US 8,168,586 B1 (Issued May 1, 2012) as applied to claims 1-2, 6, 8, 10-12, and 16-19 above, and further in view of Carmon et al., “Application of Immuno-PET in Antibody-Drug Conjugate Development”, Molecular Imaging Volume 17:1-10, 2018.
This is a new grounds of rejection necessitated by the amendments to the claims.
Regarding claims 1 and 12, Emi et al. in view of Fang et al. teach methods for producing a diagnostic agent for breast cancers comprising measuring expression levels of “MHC Class I HLA-J” (Emi et al., figure 5 and Table 7, page 15) using RT-PCR (i.e. comprising primers specific for HLA-J expression; primers capable of binding to a nucleic acid comprising or consisting of SEQ ID NO: 7) (Emi et al., paragraph 0266).
Furthermore, Fang et al. teach producing antibodies (i.e. producing diagnostic agents or medicaments) that selectively bind to Cancer-associated target “CAT” proteins (Fang et al., column 15, lines 3-26). Fang et al. teach that CAT proteins are those proteins that are differentially expressed in cancer samples in comparison with normal samples and can be interchangeably referred to as ““CAT proteins”, “targets”, “markers” or “biomarkers” [for cancers]” (Fang et al., column 7, lines 32-46). Fang et al. further teach that said antibodies can be coupled to a therapeutic agent such as cytotoxic agents, small molecule drugs, and radiotherapeutic agents (Fang et al., column 21, lines 8- column 22, line 50). Finally, Fang et al. teach that these antibodies are useful for analyzing patterns of target expression in vivo for diagnosis (i.e. as a diagnostic agent for detecting a tumor by determining the expression of a CAT protein) (Fang et al., column 32, lines 27-52).
Regarding claims 13 and 20, Fang et al. teaches the antibody medicament or diagnostic agent is fused to a cytotoxic agent, that may specifically be a therapeutic radioisotope, including 90Y, or 131I (Fang et al., column 21, lines 8- column 22, line 50). Fang et al. further teaches that the antibodies can be labeled with a detectable moiety such as a positron-emitting radionuclide (namely 131I) for the purposes of diagnostic applications using computed tomography and positron emission tomography (i.e. CT and PET scanning) (Fang et al., column 33, line 49-column 34, line 8).
Emi et al. in view of Fang et al. does not teach that the CT or PET scanning comprises scanning the entire body of the subject.
However, Carmon et al. teach methods for predicting toxicity and efficacy of antibody-drug conjugate immunotherapies to guide individualized treatment comprising administering radiolabeled antibodies to a subject and determining the whole-body biodistribution of the antibodies in a subject using positron emission tomography (PET) scanning (Carmon et al., abstract). Carmon et al. teach that detecting the distribution of radiolabeled antibodies using a whole-body PET scan is useful for predicting response to therapy, determining dosing, predicting toxicity, and eliminating unnecessary drug costs by determining how individual subjects would likely respond to the antibody-drug conjugate without subjecting them to ineffective treatment and toxicity (Carmon et al., page 8, column 1, lines 11-22).
Therefore, it would have been prima facie obvious prior to the effective filing date for one of ordinary skill in the art to have modified the method of producing diagnostic agents or medicaments (comprising radiolabeled antibodies), specifically taught as being detectable by PET-scanning for diagnostic purposes, taught by Emi et al. in view of Fang et al, to further comprise whole-body PET-scanning for diagnostic, dosing, and prediction of therapeutic efficacy and toxicity, as taught by Carmon et al. The ordinary artisan would have been motivated to have determined the whole-body distribution of the radiolabeled antibodies by PET scanning by the teaching of Carmon et al. that detecting the distribution of radiolabeled antibodies using a whole-body PET scan is useful for predicting response to therapy, determining dosing, predicting toxicity, and eliminating unnecessary drug costs by determining how individual subjects would likely respond to the antibody-drug conjugate without subjecting them to ineffective treatment and toxicity (Carmon et al., page 8, column 1, lines 11-22). The ordinary artisan would have been reasonably confident that the positron-emitting radiolabeled antibodies taught by Emi et al. in view of Fang et al., (i.e. diagnostic agents or medicaments…) would have been readily detectable by the whole-body PET scanning methodology and would have provided for the beneficial drug-dosing and prediction of individual responsiveness taught by Carmon et al.
Regarding claim 14, Carmon et al. teaches that imaging of radiolabeled antibodies by PET scanning is useful for noninvasive quantification of antibody uptake in normal and tumor tissues (i.e. measuring the radiation dose uptake into the tumor sites…) for drug development, including antibody-drug conjugate development (Carmon et al., page 3, column 1, paragraph 1).
Regarding claim 15, Emi et al. in view of Fang et al. teach producing antibodies (i.e. producing diagnostic agents or medicaments) that selectively bind to a CAT protein (Fang et al., column 15, lines 3-26), such as HLA-J. Emi et al. in view of Fang et al. further teach that said antibodies can be coupled to a therapeutic agent such as cytotoxic agents, small molecule drugs, and radiotherapeutic agents (Fang et al., column 21, lines 8- column 22, line 50). Finally, Emi et al. in view of Fang et al. teaches that these antibodies are useful for analyzing patterns of target expression in vivo for diagnosis (i.e. as a diagnostic agent for detecting a tumor by determining the expression of a CAT protein) (Fang et al., column 32, lines 27-52).
Emi et al. in view of Fang et al. does not teach measuring the radiation dose uptake using a whole-body PET scan to determine a therapeutically effective dose of a medicament.
However, Carmon et al. teaches methods for predicting toxicity and efficacy of antibody-drug conjugate immunotherapies to guide individualized treatment comprising administering radiolabeled antibodies to a subject and determining the whole-body biodistribution of the antibodies in a subject using positron emission tomography (PET) scanning (Carmon et al., abstract). Carmon et al. teach that detecting the distribution of radiolabeled antibodies using a whole-body PET scan is useful for predicting response to therapy, determining dosing, predicting toxicity, and eliminating unnecessary drug costs by determining how individual subjects would likely respond to the antibody-drug conjugate without subjecting them to ineffective treatment and toxicity (Carmon et al., page 8, column 1, lines 11-22).
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have combined the methods and radiolabeled-therapeutic/diagnostic agents specific to the CAT proteins (including HLA-J), taught by Emi et al. in view of Fang et al., with the methods of whole-body PET scanning taught by Carmon et al. to determine an effective dose of said radiolabeled therapeutic agents.
The ordinary artisan would have been motivated to combine the methods of producing diagnostic/therapeutic agents against CAT proteins taught by Emi et al. in view of Fang et al. with the methods of determining an effective dose of a therapeutic agent, taught by Carmon et al. because of the teaching of Carmon et al. that detecting the distribution of radiolabeled antibodies using a whole-body PET scan is useful for predicting response to therapy, determining dosing, predicting toxicity, and eliminating unnecessary drug costs by determining how individual subjects would likely respond to the antibody-drug conjugate without subjecting them to ineffective treatment and toxicity (Carmon et al., page 8, column 1, lines 11-22).
The ordinary artisan would have been reasonably confident that that the positron-emitting radiolabeled antibodies taught by Emi et al. in view of Fang et al., (i.e. diagnostic agents or medicaments…) would have been readily detectable by the whole-body PET scanning methodology and would have provided for the beneficial drug-dosing and prediction of individual responsiveness taught by Carmon et al.
Response to Arguments
The amended claims, now limited to embodiments of the previous claim set requiring determining the expression of HLA-J or a protein encoded by HLA-J and producing a medicament or diagnostic agent capable of binding to HLA-J or a protein encoded by HLA-J are addressed in the new grounds of rejection necessitated by the amendments to the claims under U.S.C. 102 and U.S.C. 103 as detailed above.
In the arguments regarding the previous 102 and 103 rejections of record, now withdrawn, the response asserts that the previously cited art does not “address the central technical hurdle: absence of a[n]… HLA-J coding sequence and a documented link to tumor expression”.
As is described in the new rejections above, Emi et al. teach that differential expression of HLA-J is associated with breast cancer tumors (i.e. HLA-J is a cancer associated target fitting the definition set forth by Fang et al., see details above) and demonstrate working RT-PCR assays for measuring the expression of HLA-J based upon known HLA-J sequences.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim 1 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No. 18/364,409 (herein referred to as ‘409). Although the claims at issue are not identical, they are not patentably distinct from each other.
This rejection has been updated as necessitated by the claim amendments.
Claim 1 of the present application requires determining the expression of at least one of the nucleic acid or polypeptide molecules corresponding to HLA-J (SEQ ID NO: 2 or 7) in a subject and producing a medicament or diagnostic agent specific for said at least one nucleic acid or polypeptide molecule.
Claim 1 of ‘409 requires detecting the presence of (i.e. measuring the expression of) a nucleic acid molecule or a polypeptide in a sample obtained from a subject, wherein the sequence is “most preferably” at least 95% identical to (‘409 SEQ ID NO: 2) (i.e. HLA-J).
SEQ ID NO: 2 of the present invention is greater than 99% identical to SEQ ID NO: 1 of ‘409 (see alignment below).
PNG
media_image4.png
343
592
media_image4.png
Greyscale
The present claims directed to methods of detecting the expression of at least the sequence in question and producing at least a diagnostic agent for detecting the sites of expression of the sequence in question would have been obvious over claim 1 of ‘409. Claim 1 of ‘409, directed to a method of diagnosing a tumor comprising detecting the presence of (i.e. detecting the expression of) SEQ ID NO 2 of the present invention or SEQ ID NO 1 of ‘409 is coextensive in scope with the present claims.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1 and 4 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 19 of copending Application No. 17624791 (herein referred to as ‘791). Although the claims at issue are not identical, they are not patentably distinct from each other.
This rejection has been updated as necessitated by the amendments to the claims.
Claims 1 and 4 of the present application are directed to a method of producing a medicament for reducing the expression of SEQ ID NO: 2 or SEQ ID NO: 7 (polypeptide or nucleic acid sequences encoding HLA-J) comprising determining the expression of at least one of the polypeptide or nucleic acid sequences and producing the medicament. Claim 4 of the present application further requires measuring the expression of at least one of the HLA class I genes HLA-A, HLA-B, and HLA-C.
Claim 19 of ‘791 is directed to a method of producing a therapeutic agent (i.e. a medicament…) based on determining individual HLA patterns of a tumor comprising determining the expression of an RNA transcript encoding a classical HLA gene (i.e. HLA-A, HLA-B, or HLA-C) and the second HLA gene encoding a non-classical HLA gene (i.e. HLA-H, HLA-J, HLA-L, HLA-V, and HLA-Y) and producing a therapeutic agent comprising proteins for binding specifically to the determined HLA pattern. Furthermore, withdrawn claims 30-31 and 34 specifically claim that the classical HLA gene is HLA-A (‘791, claim 30) or HLA-B (‘791, claim 31) and the non-classical HLA gene is HLA-J (claim 34).
Therefore, the claims of ‘791 are coextensive in scope to claims 1 and 4 of the present application.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to arguments
The response requests that the double patenting rejections be held in abeyance until allowable subject matter has been identified in the present application.
This request has been noted and is denied.
See MPEP 804(I)(b)(1) and 37 C.F.R. 1.111(b), which allows that some objections may be held in abeyance, but includes no provision for holding rejections in abeyance. Thus, for the reasons noted above and those already of record, the rejection is maintained.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ZACHARY MARK TURPIN whose telephone number is (703)756-5917. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Z.M.T./Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682