Prosecution Insights
Last updated: July 17, 2026
Application No. 17/772,450

FORMULATION FOR DELIVERY OF LUBRICIN GENE

Final Rejection §103§112
Filed
Apr 27, 2022
Priority
Oct 28, 2019 — provisional 62/926,872 +1 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF IOWA RESEARCH FOUNDATION
OA Round
2 (Final)
38%
Grant Probability
At Risk
3-4
OA Rounds
0m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
282 granted / 741 resolved
-21.9% vs TC avg
Strong +53% interview lift
Without
With
+52.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
55 currently pending
Career history
807
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
57.8%
+17.8% vs TC avg
§102
6.6%
-33.4% vs TC avg
§112
10.0%
-30.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 741 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment filed on 03/26/2026 has been entered. Amended claims 1-2, 10, 16-19, 24, 26, 29-33 and 38 are pending in the present application. Applicant elected previously without traverse of Group I, which is drawn to a composition comprising nanoparticles comprising nanoplexes comprising a nucleic acid encoding a mammalian lubricin protein and a cationic polymer comprising PEI or PAMAM. Applicant also elected previously the following species: (i) SEQ ID NO: 1; (ii) a cationic branched synthetic polymer; (iii) a combination of lactic acid and glycolic acid; (iv) about 45 nm to about 700 nm; (v) a polysaccharide coating; and (vi) adeno-associated virus. Claims 29-33 and 38 were withdrawn previously from further consideration because they are directed to non-elected inventions. Additionally, claim 17 was also withdrawn previously from further consideration because it is directed to a non-elected species. Accordingly, amended claims 1-2, 10, 16, 18-19, 24 and 26 are examined on the merits herein with the above elected species. Response to Amendment The rejection under 35 U.S.C. 103 as being unpatentable over Sharma et al (WO 2018/067545; IDS) in view of Emans et al (US 2013/0123314; IDS), Ruan et al (WO 2014/115022) and D’Mello et al (The AAPS Journal 19:43-53; 2017) as applied to claims 1-2, 4-5, 9-10, 18, 24 and 26 above, and further in view of Dias Figueiredo et al (US 11,905,531) was withdrawn at least in light of currently amended claim 24. Claim Objections Claim 1 is objected to because of the terms “nucleic acid” and “a nanoplexes”. This is because there is a lack of an article - - a - - in front of the term “nucleic acid” and the term “a nanoplexes” is grammatically incorrect. Claim Rejections - 35 USC § 112 (New Matter) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Amended claims 18, 24 and 26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new ground of rejection necessitated by Applicant’s amendment. Amended claims 18, 24 and 26 recite the limitation “The composition of claim 1, wherein the nucleic acid encoding lubricin is part of a genome of a virus”. The claims encompass a composition comprising: i) a nucleic acid encoding a mammalian lubricin protein and ii) a cationic polymer comprising polyethyleneimine (PEI) or poly(amidoamine)(PAMAM), wherein i) and ii) combine to form nanoplexes, wherein the nanoplexes comprise a polysaccharide coating; and wherein the nucleic acid encoding lubricin is part of a genome of a virus (e.g., adenovirus, adeno-associated virus, a herpes virus, a lentivirus or a retrovirus; dependent claim 24), and wherein the virus is combined with nanoparticles (dependent claim 26). The as-filed specification does not have a written support for the new limitation of “wherein the nucleic acid encoding lubricin is part of a genome of a virus” in currently amended claims 18, 24 and 26. As an initial matter, amended claims 18, 24 and 26 have been introduced in the Amendment filed on 03/26/2026, so the claims themselves are not part of the original disclosure. 37 CFR § 1.115(a)(2). “New or amended claims which introduce elements or limitations that are not supported by the as-filed disclosure violate the written description requirement. . . . While there is no in haec verba requirement, newly added claims or claim limitations must be supported in the specification through express, implicit, or inherent disclosure. . . . The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed.” MPEP § 2163, part (I)(B); see also MPEP § 2163.02. In this case, the original specification does not convey the particular invention recited in claims 18, 24 and 26 with reasonable clarity to skilled artisans. “The trouble is that there is no such disclosure, easy though it is to imagine it.” MPEP § 2163.05, part (II) (quoting In re Ruschig, 379 F.2d 990, 995, 154 USPQ 118, 123 (CCPA 1967)). In the Amendment filed on 03/26/2026, Applicant did not cite or point out any written support for the new limitation in claims 18, 24 and 26. Upon careful examination of the as-filed specification, the application simply teaches a plasmid DNA encoding lubricin being complexed with a cationic polymer (e.g., PEI or PAMAM) to form nanoplexes, which were then encapsulated into degradable nanoparticles (see at least Summary; particularly lines 23-29 at page 2; at page 26, line 28 continues to line 5 at page 27; and Examples 1-2); and not a recombinant virus comprising a nucleic acid encoding lubricin to be complexed with a cationic polymer to form nanoplexes which were then encapsulated into degradable nanoparticles as claimed in currently amended claims 18, 24 and 26. Although the as-filed specification also discloses the use of a recombinant viral comprising a nucleic acid encoding a mammalian lubricin for in vivo gene therapy, as well as in combination with the nanoparticles of the present application (see at least Summary; particularly lines 13-20 at page 3; line 3 at page 4 continues to line 7 at page 5; lines 6-11 at page 27; and Examples 1-2); but the specification does not teach nor suggest the concept of complexing a recombinant virus comprising a nucleic acid encoding lubricin with a cationic polymer to form nanoplexes which were then encapsulated into degradable nanoparticles as claimed in currently amended claims 18, 24 and 26. Accordingly, the as-filed specification does not have a written support for the limitation recited in currently amended claims 18, 24 and 26. The fact that the person of ordinary skill in the art could have carried out the claimed invention without undue experimentation based on applicants’ disclosure is inadequate to meet this requirement. “The Federal Circuit has pointed out that, under United States law, a description that merely renders a claimed invention obvious may not sufficiently describe the invention for the purposes of the written description requirement of 35 U.S.C. 112.” MPEP § 2163, part (I)(A). Therefore, given the lack of sufficient guidance provided by the originally filed specification, it would appear that Applicants did not contemplate or have possession of invention as now claimed at the time the application was filed. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Amended claims 1-2, 10, 15-16 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Sharma et al (WO 2018/067545; IDS) in view of Emans et al (US 2013/0123314; IDS), Ruan et al (WO 2014/115022), D’Mello et al (The AAPS Journal 19:43-53; 2017) and Wang et al (AAPS Pharm Sci Tech 15:585-592, 2013). This is a modified rejection necessitated by Applicant’s amendment. The instant claims encompass a composition comprising: i) a nucleic acid encoding a mammalian lubricin/PRG4 protein (e.g., a lubricin having at least 80% amino acid sequence identity to the elected SEQ ID NO: 1) and ii) a cationic polymer comprising polyethyleneimine (PEI) or poly(amidoamine) (PAMAM), wherein i) and ii) combine to form nanoplexes, wherein the nanoplexes are encapsulated by nanoparticles formed of lactic acid and glycolic acid, wherein the nanoparticles comprise a polysaccharide coating (e.g., chitosan as the elected species). With respect to the elected species, Sharma et al already taught to provide at least chondroprotective nanoparticles into the extracellular matrix (ECM) of tissues, such as degenerating cartilage, to provide local and sustained release of drugs/therapeutic agents for the treatment of osteoarthritis (e.g., post-traumatic osteoarthritis), wherein the nanoparticles are biodegradable and formed from any natural or synthetic biocompatible polymer, and the nanoparticles comprises a therapeutic agent (e.g., Kartogenin (KGN), PDGF-BB, antioxidants, anti-catabolic agents, anabolic agents and anti-inflammation agents) encapsulated therein (Abstract; Summary; particularly page 16, line 18 continues to line 23 at page 18). Sharma et al stated “In some embodiments, the nanoparticles are formed from a polymer selected from the group consisting of hyaluronan, chitosan, collagen, gelatin, alginate, polylactic acid (PLLA), polyglycolic acid (PGA), poly(lactic-co-glycolic acid) (PLGA), poly(ethylene glycol), and chondroitin sulfate” (page 3, lines 15-20); and “The disclosed delivery system can involve nanoparticles that are limited in size from about 5 nanometers to about 750 nanometers, including about 10 to about 500 nanometers, about 20 to about 200 nanometers, and about 30 nanometers to about 100 nanometers” (page 16, lines 19-22). In a particular/preferred embodiment, Sharma et al disclosed the nanoparticle has a mean diameter ranging from 30 nm to 300 nm (page 3, lines 11-13). Sharma et al also defined the term “agent” to include modified and unmodified nucleic acids, with a nucleic acid as an active agent (page 9, lines 16-28); and anti-cancer therapeutic agents include DNA such as plasmid DNA for wild type p53 for delivering into the ECM of tumor margins using the disclosed nanoparticles (Abstract; and page 12, lines 14-16). Sharma et al also taught that KGN is a small molecule having chondrogenic and chondroprotective effects, and it has been demonstrated to induce lubricin/Prg4 expression (page 26, lines 31-35). Sharma et al did not teach explicitly that the chondroprotective nanoparticles (e.g., elected species of the combination of lactic acid and glycolic acid, such as PLGA) comprising encapsulated nanoplexes comprising a nucleic acid encoding a mammalian lubricin and a cationic polymer comprising polyethyleneimine (PEI), wherein the nanoparticles comprise a polysaccharide coating, preferably a chitosan coating. Before the effective filing date of the present application (10/28/2019), Emans already taught to deliver at least agents/drugs that enhance lubrication of a joint such as hyaluronan and/or superficial zone protein (SZP)/lubricin inside a biodegradable and biocompatible release system that will slowly release the enclosed drugs for improving cartilage repair and/or slowing down of cartilage degeneration (Abstract; Summary of the Invention; particularly paragraphs [0039]-[0040], [0065] and [0081]). Emans et al also stated “The invention may also be practiced with other release systems which have been described. Some non-limiting examples of such systems include microspheres, liposomes, alone or in combination with the above described biogels and hydrogels” (paragraph [0082]). Additionally, Ruan et al already disclosed at least one helper-dependent adenoviral vector containing a nucleic acid sequence encoding for human or mammalian proteoglycan 4 (PRG4) for use in the treatment of a musculoskeletal disorder such as osteoarthritis and rheumatoid arthritis (Abstract; Summary of the Invention; and pages 14-16). Ruan et al stated “[t]he helper-dependent adenoviral vector comprising proteoglycan 4 (PRG4) comprises a nucleic acid sequence set forth in SEQ ID NO 1 (human HDAd) or SEQ ID NO 2 (murine HDAd). Preferably, the nucleic acid sequence comprises a cDNA sequence of the PRG4 gene or a fragment thereof” (page 6, lines 26-29). The sequence of nucleotides 28157-32368 in SEQ ID NO 1 encodes the amino acid sequence that is 99.9% identical to SEQ ID NO: 1 of the present application (see attached sequence search below). Moreover, in a review of bone regeneration and soft tissue healing (e.g., blood vessels, cartilage, muscles, ligaments and tendons) using gene-activated matrices (GAM) D’Mello et al stated “In spite of lower transfection efficiencies compared to that of viral vectors, non-viral vectors are safer and can be clinically translated for potential bone regeneration applications” (page 46, left column, second last paragraph); and “pDNA can be complexed via electrostatic interactions with liposomes, polymers, or other polycations to form either lipoplexes or polyplexes. Among the numerous non-viral gene vectors studied in vitro and in vivo, polyethylenimine (PEI), especially the branched 25-kDa PEI polymer, is one of the most successful gene transfer agents to date (40). PEI is believed to exhibit higher transfection efficiencies than many other non-viral vectors due to a phenomenon known as the “proton sponge effect” (41) and the level of transfection efficiency attained with PEI is considered comparable with that of viral vectors” (page 46, right column, bottom of first paragraph). Table III lists different types of GAMs for induction of bone formation, including the PLGA scaffold containing PEI-pDNA complexes, wherein the pDNA comprises a sequence encoding BMP-4 (section titled “Hard tissue regeneration with a focus on the use of GAMs” on page 49; and Table III on page 50). Furthermore, Wang et al already taught chitosan-modified PLGA nanoparticles with versatile surface for improved drug delivery (Abstract and Figure 1). Wang et al stated “The chitosan on PLGA nanoparticles surface affected the drug release profile. The positive charge and hydrophilic property induced a moderate and prolonged drug release and a high cumulative drug release” (page 591, right column, first full paragraph in the “Conclusions” section). Accordingly, it would have been obvious for an ordinary skill in the art to modify the teachings of Sharma et al by also selecting at least a nucleic acid encoding a mammalian lubricin having at least 80% amino acid sequence identity to SEQ ID NO: 1 of the present application in the form of a recombinant pDNA-PEI polyplex as a therapeutic agent encapsulated within the disclosed chondroprotective nanoparticles (including nanoparticles having an average diameter of about 450 nm to about 700 nm) for sustained release of the therapeutic agent in the treatment of osteoarthritis and/or post-traumatic osteoarthritis, as well as also coating their PLGA nanoparticles with chitosan for improving drug delivery; in light of the teachings of Emans et al, Ruan et al, D’Mello et al and Wang et al as presented above. An ordinary skill in the art would have been motivated to carry out the above modifications because: (i) Emans already taught to deliver at least agents/drugs that enhance lubrication of a joint such as hyaluronan and/or superficial zone protein (SZP)/lubricin inside a biodegradable and biocompatible release system that will slowly release the enclosed drugs for improving cartilage repair and/or slowing down of cartilage degeneration; (ii) Ruan et al already taught at least a helper-dependent adenoviral vector containing a nucleic acid sequence encoding for human or mammalian proteoglycan 4 (PRG4), including the sequence of nucleotides 28157-32368 in SEQ ID NO 1 (human HDAd) that encodes the amino acid sequence that is 99.9% identical to SEQ ID NO: 1 of the present application, for use in the treatment of a musculoskeletal disorder such as osteoarthritis and rheumatoid arthritis; (iii) D’Mello et al already taught that non-viral vectors are safer relative to viral vectors, and pDNA can be complexed via electrostatic interactions with polymers, or other polycations to form polyplexes; and among the numerous non-viral gene vectors studied in vitro and in vivo, polyethylenimine (PEI), especially the branched 25-kDa PEI polymer, is one of the most successful gene transfer agents to date that exhibits higher transfection efficiencies than many other non-viral vectors due to a phenomenon known as the “proton sponge effect” and the level of transfection efficiency attained with PEI is considered comparable with that of viral vectors; and (iv) Wang et al already taught using chitosan-modified PLGA nanoparticles with versatile surface for improved drug delivery. Please also note that the primary Sharma reference also taught using the disclosed nanoparticles for delivering into the ECM of tumor margins a cancer therapeutic agent such as plasmid DNA for wild type p53. With respect to the limitation of “wherein the nanoparticles have an average diameter of about 450 nm to about 700 nm” in claim 10, the primary Sharma reference also taught at least that the disclosed delivery system can involve nanoparticles that are limited in size from about 5 nanometers to about 750 nanometers, including about 10 to about 500 nanometers. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al and Wang et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified composition resulting from the combined teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al and Wang et al as set forth above is indistinguishable and encompassed by the presently claimed invention. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Response to Arguments Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 03/26/2026 (pages 5-9) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below. Applicant argued basically that currently amended claims require a specific, integrated particle architecture that is not taught or suggested by the cited documents. Specifically, Sharma does not teach or suggest the claimed nanoplex-encapsulated PLGA-type nanoparticle having a polysaccharide coating; Emans is directed to delivering lubricin as an “agent”, and not to the claimed nanoplex-encapsulated, polysaccharide-coated nanoparticle; Ruan is drawn to helper-dependent adenoviral vectors expressing PRG4 and does not teach the claimed non-viral, nanoplex-encapsulated, polysaccharide-coated particle architecture; D’Mello discloses PEI polyplexes generally and mentions PLGA scaffold systems, but not the claimed nanoplex encapsulated by a PLGA-type nanoparticle (and polysaccharide-coated) for lubricin gene delivery; and Wang’s chitosan-modified PLGA work is performed in buffered media and cancer cell contexts, not in synovial fluid or cartilage systems, and provides no motivation to modify Sharma’s joint-specific nanoparticles in the manner proposed by the Office. Applicant further argued that Sharma teaches away from cationic/amine-functionalized surfaces in synovial fluid, and thereby undermining any articulated rationale or reasonable expectation of success to apply Wang’s chitosan coating to Sharma’s intra-articular nanoparticles. Applicant specifically referred the Office to Example 3 and Discussion section of Example 3 in Sharma, and argued that Sharma’s data demonstrate that amine/cationic surfaces are destabilized by synovial fluid and lose cartilage retention, and that cationic/amine surfaces form gels, aggregate, undergo charge reversal, and lose cartilage retention in the presence of synovial fluid/cartilage. Accordingly, grafting a cationic polysaccharide coating such as chitosan (which confers a positive surface charge) onto intra-articular PLGA nanoparticles is the opposite of what Sharma suggests a skilled artisan to do for joint delivery; and the proposed modification lacks the required rational underpinning and reasonable expectation of success. First, since the above rejection was made under 35 U.S.C. 103 none of the cited references individually has to teach every limitation of the instant claims. For example, Sharma does not have to teach or suggest a nanoplex-encapsulated PLGA-type nanoparticle having a polysaccharide coating; nor does D’Mello teach or suggest a nanoplex-encapsulated by a PLGA-type nanoparticle for lubricin gene delivery. Similarly, Wang does not have to teach chitosan-modified PLGA nanoparticles for use specifically in a synovial fluid or cartilage system. It appears that Applicant considered each of the cited references in total isolation one from the others, without taking into consideration of the specific combined teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al and Wang et al as set forth in the above modified 103 rejection. Please refer to the above modified 103 rejection for details along with the provided motivations for combining the cited references. Second, as set forth in the above 103 rejection an ordinary skilled in the art would have been motivated to coat PLGA nanoparticles with chitosan to improve drug delivery. Wang et al stated clearly “The chitosan on PLGA nanoparticles surface affected the drug release profile. The positive charge and hydrophilic property induced a moderate and prolonged drug release and a high cumulative drug release” (right column, second paragraph at page 591); and “PLGA nanoparticles modified by chitosan showed versatility of surface and a possible improvement in the efficacy of current PLGA-based drug delivery system” (last sentence in the abstract). There is no teaching or suggestion whatsoever in the Wang reference that their chitosan-modified PLGA nanoparticles are limited for use only in cancer cells. Third, there is no teaching-away whatsoever by Sharma. In Example 3 of Sharma, Sharma stated clearly “The cationic DMAB NPs demonstrated greatest interaction and penetration with cartilage relative to the anionic PVA NPs under all conditions. All NPs experienced a drop in cartilage retention and synoviocyte uptake when incubated with synovial fluid” (lines 5-8 at page 35). On the basis of this teaching an ordinary skilled in the art would readily recognize at least the advantage of using cationic chitosan-PLGA nanoparticles over non-coated PLGA nanoparticles for drug delivery to cartilage. Moreover, Sharma also stated “Reduction in cationic PLGA NP interaction with OA tissue is likely related to loss of negatively charged glycosaminoglycan in the cartilage. This loss may weaken any electrostatic attraction with cationic particles and increase tissue porosity, thereby allowing NPs to be flushed out of the tissue during washing” (lines 24-28 at page 36 in Discussion section). These statements in fact suggest an advantage offered by cationic PLGA nanoparticles due to the electrostatic attraction between the cationic particles and negatively charged glycosaminoglycans in a cartilage for retention. Once again, there is no teaching-away whatsoever by the primary Sharma reference over the use of chitosan-modified PLGA nanoparticles taught by Wang as set forth in the above modified 103 rejection. Fourth, please note that the standard under 35 U.S.C. 103 is a “reasonable” expectation of success. Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Sharma et al (WO 2018/067545; IDS) in view of Emans et al (US 2013/0123314; IDS), Ruan et al (WO 2014/115022), D’Mello et al (The AAPS Journal 19:43-53; 2017) and Wang et al (AAPS Pharm Sci Tech 15:585-592, 2013) as applied to claims 1-2, 10, 15-16 and 18 above, and further in view of Bain et al (WO 2018/048942). The combined teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al and Wang et al were presented above. However, none of the cited references teach explicitly that the composition further comprising an anti-fibrotic agent. Before the effective filing date of the present application (10/28/2019), Bain et al already taught using a lysyl oxidase like 2 (LOXL2) inhibitor, an antifibrotic agent, for treating at least osteoarthritis and rheumatoid arthritis (Abstract; Summary of the Invention; particularly paragraphs [0033]-[0036], [0065], [0071], [00253]-[00256], [00259]; and claims 64-65). Bain et al disclosed that fibrosis refers to the accumulation of extracellular matrix constituents that occurs following trauma, inflammation, tissue repair, immunological reactions, cellular hyperplasia, and neoplasia (paragraph [0071]); and LOXL2 is involved in fibrotic processes (paragraph [0065]). Bain et al stated “Osteoarthritis (OA) is a type of joint disease that results from breakdown of joint cartilage and underlying bone. LOXL2 has been shown to be highly expressed in the damaged region of OA cartilage” (first sentence of paragraph [00259]). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al and Wang et al by also further including at least a LOXL2 inhibitor into the composition for the treatment of osteoarthritis, in light of the teachings of Bain et al as presented above. An ordinary skill in the art would have been motivated to further carry out the above modification because Bain et al already taught using a lysyl oxidase like 2 (LOXL2) inhibitor, an antifibrotic agent, for treating at least osteoarthritis. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al, Wang et al and Bain et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified composition resulting from the combined teachings of Sharma et al, Emans et al, Ruan et al, D’Mello et al, Wang et al and Bain et al as set forth above is indistinguishable and encompassed by the presently claimed invention. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Response to Arguments Applicant’s arguments related to the above 103 rejection in the Amendment filed on 03/26/2026 (page 9) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below. Applicant argued that Bain’s LOXL2 inhibitors are presented as systemic antifibrotics, and there is no articulated rationale for co-encapsulated such antifibrotics with the claimed gene-delivery nanoparticles. Additionally, Bain does not remedy the deficiencies discussed above for the combination of Sharma, Emans, Ruan, D’Mello and Wang. First, with respect to the deficiencies of Sharma, Emans, Ruan, D’Mello and Wang please refer to the Examiner’s same responses to Applicant’s arguments for the rejection of claims 1-2, 10, 15-16 and 18 above. Second, Bain was cited to supplement the combined teachings of Sharma, Emans, Ruan, D’Mello and Wang for the limitation “The composition of claim 1, further comprising an anti-fibrotic agent” recited in dependent claim 19. Third, please note that claim 19 does not require an anti-fibrotic agent to be co-encapsulated in nanoparticles formed of lactic acid and glycolic acid. Additionally, claim 19 is a composition claim, and not a method claim. Moreover, as set forth in the above 103 rejection, an ordinary skilled in the art would have been motivated to further modify the combined teachings of Sharma, Emansl, Ruan, D’Mello and Wang by also further including at least a LOXL2 inhibitor into the composition for the treatment of osteoarthritis because Bain already taught using a lysyl oxidase like 2 (LOXL2) inhibitor, an antifibrotic agent, for treating at least osteoarthritis. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Dias Figueiredo et al (US 11,905,531) already taught recombinant AAV vectors/virus expressing osteoprotective genes, including HAS2 and Lubricin (PRG4) such as a full-length canine lubricin cDNA, that are useful in the treatment of osteoarthritis and related joint conditions in mammals (see at least Abstract; col. 2, line 64 continues to line 28 at column 3; col. 4, lines 28-46; and Example 2). Dias Figueiredo et al also disclosed the nucleic acid sequence of SEQ ID NO: 12, in which the sequence of nucleotides 52-4263 encodes the amino acid sequence that is 100% identical to SEQ ID NO: 1 of the present application (see col. 18, lines 10-19; Figs. 15-16; and attached sequence search below). Conclusions No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Human PRG4 gene containing HDAd vector DNA, SEQ ID 1. WO2014115022-A1. Alignment Scores: Length: 33136 Score: 7516.00 Matches: 1403 Percent Similarity: 99.9% Conservative: 0 Best Local Similarity: 99.9% Mismatches: 1 Query Match: 99.9% Indels: 0 Gaps: 0 US-17-772-450-1 (1-1404) x BBL00108 (1-33136) Qy 1 MetAlaTrpLysThrLeuProIleTyrLeuLeuLeuLeuLeuSerValPheValIleGln 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28157 ATGGCATGGAAAACACTTCCCATTTACCTGTTGTTGCTGCTGTCTGTTTTCGTGATTCAG 28216 Qy 21 GlnValSerSerGlnAspLeuSerSerCysAlaGlyArgCysGlyGluGlyTyrSerArg 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28217 CAAGTTTCATCTCAAGATTTATCAAGCTGTGCAGGGAGATGTGGGGAAGGGTATTCTAGA 28276 Qy 41 AspAlaThrCysAsnCysAspTyrAsnCysGlnHisTyrMetGluCysCysProAspPhe 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28277 GATGCCACCTGCAACTGTGATTATAACTGTCAACACTACATGGAGTGCTGCCCTGATTTC 28336 Qy 61 LysArgValCysThrAlaGluLeuSerCysLysGlyArgCysPheGluSerPheGluArg 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28337 AAGAGAGTCTGCACTGCGGAGCTTTCCTGTAAAGGCCGCTGCTTTGAGTCCTTCGAGAGA 28396 Qy 81 GlyArgGluCysAspCysAspAlaGlnCysLysLysTyrAspLysCysCysProAspTyr 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28397 GGGAGGGAGTGTGACTGCGACGCCCAATGTAAGAAGTATGACAAGTGCTGTCCCGATTAT 28456 Qy 101 GluSerPheCysAlaGluValHisAsnProThrSerProProSerSerLysLysAlaPro 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28457 GAGAGTTTCTGTGCAGAAGTGCATAATCCCACATCACCACCATCTTCAAAGAAAGCACCT 28516 Qy 121 ProProSerGlyAlaSerGlnThrIleLysSerThrThrLysArgSerProLysProPro 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28517 CCACCTTCAGGAGCATCTCAAACCATCAAATCAACAACCAAACGTTCACCCAAACCACCA 28576 Qy 141 AsnLysLysLysThrLysLysValIleGluSerGluGluIleThrGluGluHisSerVal 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28577 AACAAGAAGAAGACTAAGAAAGTTATAGAATCAGAGGAAATAACAGAAGAACATTCTGTT 28636 Qy 161 SerGluAsnGlnGluSerSerSerSerSerSerSerSerSerSerSerSerThrIleArg 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28637 TCTGAAAATCAAGAGTCCTCCTCCTCCTCCTCCTCTTCCTCTTCTTCTTCAACAATTCGG 28696 Qy 181 LysIleLysSerSerLysAsnSerAlaAlaAsnArgGluLeuGlnLysLysLeuLysVal 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28697 AAAATCAAGTCTTCCAAAAATTCAGCTGCTAATAGAGAATTACAGAAGAAACTCAAAGTA 28756 Qy 201 LysAspAsnLysLysAsnArgThrLysLysLysProThrProLysProProValValAsp 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28757 AAAGATAACAAGAAGAACAGAACTAAAAAGAAACCTACCCCCAAACCACCAGTTGTAGAT 28816 Qy 221 GluAlaGlySerGlyLeuAspAsnGlyAspPheLysValThrThrProAspThrSerThr 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28817 GAAGCTGGAAGTGGATTGGACAATGGTGACTTCAAGGTCACAACTCCTGACACGTCTACC 28876 Qy 241 ThrGlnHisAsnLysValSerThrSerProLysIleThrThrAlaLysProIleAsnPro 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28877 ACCCAACACAATAAAGTCAGCACATCTCCCAAGATCACAACAGCAAAACCAATAAATCCC 28936 Qy 261 ArgProSerLeuProProAsnSerAspThrSerLysGluThrSerLeuThrValAsnLys 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28937 AGACCCAGTCTTCCACCTAATTCTGATACATCTAAAGAGACGTCTTTGACAGTGAATAAA 28996 Qy 281 GluThrThrValGluThrLysGluThrThrThrThrAsnLysGlnThrSerThrAspGly 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28997 GAGACAACAGTTGAAACTAAAGAAACTACTACAACAAATAAACAGACTTCAACTGATGGA 29056 Qy 301 LysGluLysThrThrSerAlaLysGluThrGlnSerIleGluLysThrSerAlaLysAsp 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29057 AAAGAGAAGACTACTTCCGCTAAAGAGACACAAAGTATAGAGAAAACATCTGCTAAAGAT 29116 Qy 321 LeuAlaProThrSerLysValLeuAlaLysProThrProLysAlaGluThrThrThrLys 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29117 TTAGCACCCACATCTAAAGTGCTGGCTAAACCTACACCCAAAGCTGAAACTACAACCAAA 29176 Qy 341 GlyProAlaLeuThrThrProLysGluProThrProThrThrProLysGluProAlaSer 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29177 GGCCCTGCTCTCACCACTCCCAAGGAGCCCACGCCCACCACTCCCAAGGAGCCTGCATCT 29236 Qy 361 ThrThrProLysGluProThrProThrThrIleLysSerAlaProThrThrProLysGlu 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29237 ACCACACCCAAAGAGCCCACACCTACCACCATCAAGTCTGCACCCACCACCCCCAAGGAG 29296 Qy 381 ProAlaProThrThrThrLysSerAlaProThrThrProLysGluProAlaProThrThr 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29297 CCTGCACCCACCACCACCAAGTCTGCACCCACCACTCCCAAGGAGCCTGCACCCACCACC 29356 Qy 401 ThrLysGluProAlaProThrThrProLysGluProAlaProThrThrThrLysGluPro 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29357 ACCAAGGAGCCTGCACCCACCACTCCCAAGGAGCCTGCACCCACCACCACCAAGGAGCCT 29416 Qy 421 AlaProThrThrThrLysSerAlaProThrThrProLysGluProAlaProThrThrPro 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29417 GCACCCACCACCACCAAGTCTGCACCCACCACTCCCAAGGAGCCTGCACCCACCACCCCC 29476 Qy 441 LysLysProAlaProThrThrProLysGluProAlaProThrThrProLysGluProThr 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29477 AAGAAGCCTGCCCCAACTACCCCCAAGGAGCCTGCACCCACCACTCCCAAGGAGCCTACA 29536 Qy 461 ProThrThrProLysGluProAlaProThrThrLysGluProAlaProThrThrProLys 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29537 CCCACCACTCCCAAGGAGCCTGCACCCACCACCAAGGAGCCTGCACCCACCACTCCCAAA 29596 Qy 481 GluProAlaProThrAlaProLysLysProAlaProThrThrProLysGluProAlaPro 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29597 GAGCCTGCACCCACTGCCCCCAAGAAGCCTGCCCCAACTACCCCCAAGGAGCCTGCACCC 29656 Qy 501 ThrThrProLysGluProAlaProThrThrThrLysGluProSerProThrThrProLys 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29657 ACCACTCCCAAGGAGCCTGCACCCACCACCACCAAGGAGCCTTCACCCACCACTCCCAAG 29716 Qy 521 GluProAlaProThrThrThrLysSerAlaProThrThrThrLysGluProAlaProThr 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29717 GAGCCTGCACCCACCACCACCAAGTCTGCACCCACCACTACCAAGGAGCCTGCACCCACC 29776 Qy 541 ThrThrLysSerAlaProThrThrProLysGluProSerProThrThrThrLysGluPro 560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29777 ACTACCAAGTCTGCACCCACCACTCCCAAGGAGCCTTCACCCACCACCACCAAGGAGCCT 29836 Qy 561 AlaProThrThrProLysGluProAlaProThrThrProLysLysProAlaProThrThr 580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29837 GCACCCACCACTCCCAAGGAGCCTGCACCCACCACCCCCAAGAAGCCTGCCCCAACTACC 29896 Qy 581 ProLysGluProAlaProThrThrProLysGluProAlaProThrThrThrLysLysPro 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29897 CCCAAGGAGCCTGCACCCACCACTCCCAAGGAACCTGCACCCACCACCACCAAGAAGCCT 29956 Qy 601 AlaProThrThrProLysGluProAlaProThrThrProLysGluThrAlaProThrThr 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 29957 GCACCCACCACTCCCAAAGAGCCTGCCCCAACTACCCCCAAGGAGACTGCACCCACCACC 30016 Qy 621 ProLysLysLeuThrProThrThrProGluLysLeuAlaProThrThrProGluLysPro 640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30017 CCCAAGAAGCTCACGCCCACCACCCCCGAGAAGCTCGCACCCACCACCCCTGAGAAGCCC 30076 Qy 641 AlaProThrThrProGluGluLeuAlaProThrThrProGluGluProThrProThrThr 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30077 GCACCCACCACCCCTGAGGAGCTCGCACCCACCACCCCTGAGGAGCCCACACCCACCACC 30136 Qy 661 ProGluGluProAlaProThrThrProLysAlaAlaAlaProAsnThrProLysGluPro 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30137 CCTGAGGAGCCTGCTCCCACCACTCCCAAGGCAGCGGCTCCCAACACCCCTAAGGAGCCT 30196 Qy 681 AlaProThrThrProLysGluProAlaProThrThrProLysGluProAlaProThrThr 700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30197 GCTCCAACTACCCCTAAGGAGCCTGCTCCAACTACCCCTAAGGAGCCTGCTCCAACTACC 30256 Qy 701 ProLysGluThrAlaProThrThrProLysGlyThrAlaProThrThrLeuLysGluPro 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30257 CCTAAGGAGACTGCTCCAACTACCCCTAAAGGGACTGCTCCAACTACCCTCAAGGAACCT 30316 Qy 721 AlaProThrThrProLysLysProAlaProLysGluLeuAlaProThrThrThrLysGlu 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30317 GCACCCACTACTCCCAAGAAGCCTGCCCCCAAGGAGCTTGCACCCACCACCACCAAGGAG 30376 Qy 741 ProThrSerThrThrSerAspLysProAlaProThrThrProLysGlyThrAlaProThr 760 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 30377 CCCACATCCACCACCTGTGACAAGCCCGCTCCAACTACCCCTAAGGGGACTGCTCCAACT 30436 Qy 761 ThrProLysGluProAlaProThrThrProLysGluProAlaProThrThrProLysGly 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30437 ACCCCTAAGGAGCCTGCTCCAACTACCCCTAAGGAGCCTGCTCCAACTACCCCTAAGGGG 30496 Qy 781 ThrAlaProThrThrLeuLysGluProAlaProThrThrProLysLysProAlaProLys 800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30497 ACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGAAGCCTGCCCCCAAG 30556 Qy 801 GluLeuAlaProThrThrThrLysGlyProThrSerThrThrSerAspLysProAlaPro 820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30557 GAGCTTGCACCCACCACCACCAAGGGGCCCACATCCACCACCTCTGACAAGCCTGCTCCA 30616 Qy 821 ThrThrProLysGluThrAlaProThrThrProLysGluProAlaProThrThrProLys 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30617 ACTACACCTAAGGAGACTGCTCCAACTACCCCCAAGGAGCCTGCACCCACTACCCCCAAG 30676 Qy 841 LysProAlaProThrThrProGluThrProProProThrThrSerGluValSerThrPro 860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30677 AAGCCTGCTCCAACTACTCCTGAGACACCTCCTCCAACCACTTCAGAGGTCTCTACTCCA 30736 Qy 861 ThrThrThrLysGluProThrThrIleHisLysSerProAspGluSerThrProGluLeu 880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30737 ACTACCACCAAGGAGCCTACCACTATCCACAAAAGCCCTGATGAATCAACTCCTGAGCTT 30796 Qy 881 SerAlaGluProThrProLysAlaLeuGluAsnSerProLysGluProGlyValProThr 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30797 TCTGCAGAACCCACACCAAAAGCTCTTGAAAACAGTCCCAAGGAACCTGGTGTACCTACA 30856 Qy 901 ThrLysThrProAlaAlaThrLysProGluMetThrThrThrAlaLysAspLysThrThr 920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30857 ACTAAGACTCCTGCAGCGACTAAACCTGAAATGACTACAACAGCTAAAGACAAGACAACA 30916 Qy 921 GluArgAspLeuArgThrThrProGluThrThrThrAlaAlaProLysMetThrLysGlu 940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30917 GAAAGAGACTTACGTACTACACCTGAAACTACAACTGCTGCACCTAAGATGACAAAAGAG 30976 Qy 941 ThrAlaThrThrThrGluLysThrThrGluSerLysIleThrAlaThrThrThrGlnVal 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 30977 ACAGCAACTACAACAGAAAAAACTACCGAATCCAAAATAACAGCTACAACCACACAAGTA 31036 Qy 961 ThrSerThrThrThrGlnAspThrThrProPheLysIleThrThrLeuLysThrThrThr 980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31037 ACATCTACCACAACTCAAGATACCACACCATTCAAAATTACTACTCTTAAAACAACTACT 31096 Qy 981 LeuAlaProLysValThrThrThrLysLysThrIleThrThrThrGluIleMetAsnLys 1000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31097 CTTGCACCCAAAGTAACTACAACAAAAAAGACAATTACTACCACTGAGATTATGAACAAA 31156 Qy 1001 ProGluGluThrAlaLysProLysAspArgAlaThrAsnSerLysAlaThrThrProLys 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31157 CCTGAAGAAACAGCTAAACCAAAAGACAGAGCTACTAATTCTAAAGCGACAACTCCTAAA 31216 Qy 1021 ProGlnLysProThrLysAlaProLysLysProThrSerThrLysLysProLysThrMet 1040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31217 CCTCAAAAGCCAACCAAAGCACCCAAAAAACCCACTTCTACCAAAAAGCCAAAAACAATG 31276 Qy 1041 ProArgValArgLysProLysThrThrProThrProArgLysMetThrSerThrMetPro 1060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31277 CCTAGAGTGAGAAAACCAAAGACGACACCAACTCCCCGCAAGATGACATCAACAATGCCA 31336 Qy 1061 GluLeuAsnProThrSerArgIleAlaGluAlaMetLeuGlnThrThrThrArgProAsn 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31337 GAATTGAACCCTACCTCAAGAATAGCAGAAGCCATGCTCCAAACCACCACCAGACCTAAC 31396 Qy 1081 GlnThrProAsnSerLysLeuValGluValAsnProLysSerGluAspAlaGlyGlyAla 1100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31397 CAAACTCCAAACTCCAAACTAGTTGAAGTAAATCCAAAGAGTGAAGATGCAGGTGGTGCT 31456 Qy 1101 GluGlyGluThrProHisMetLeuLeuArgProHisValPheMetProGluValThrPro 1120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31457 GAAGGAGAAACACCTCATATGCTTCTCAGGCCCCATGTGTTCATGCCTGAAGTTACTCCC 31516 Qy 1121 AspMetAspTyrLeuProArgValProAsnGlnGlyIleIleIleAsnProMetLeuSer 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31517 GACATGGATTACTTACCGAGAGTACCCAATCAAGGCATTATCATCAATCCCATGCTTTCC 31576 Qy 1141 AspGluThrAsnIleCysAsnGlyLysProValAspGlyLeuThrThrLeuArgAsnGly 1160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31577 GATGAGACCAATATATGCAATGGTAAGCCAGTAGATGGACTGACTACTTTGCGCAATGGG 31636 Qy 1161 ThrLeuValAlaPheArgGlyHisTyrPheTrpMetLeuSerProPheSerProProSer 1180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31637 ACATTAGTTGCATTCCGAGGTCATTATTTCTGGATGCTAAGTCCATTCAGTCCACCATCT 31696 Qy 1181 ProAlaArgArgIleThrGluValTrpGlyIleProSerProIleAspThrValPheThr 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31697 CCAGCTCGCAGAATTACTGAAGTTTGGGGTATTCCTTCCCCCATTGATACTGTTTTTACT 31756 Qy 1201 ArgCysAsnCysGluGlyLysThrPhePhePheLysAspSerGlnTyrTrpArgPheThr 1220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31757 AGGTGCAACTGTGAAGGAAAAACTTTCTTCTTTAAGGATTCTCAGTACTGGCGTTTTACC 31816 Qy 1221 AsnAspIleLysAspAlaGlyTyrProLysProIlePheLysGlyPheGlyGlyLeuThr 1240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31817 AATGATATAAAAGATGCAGGGTACCCCAAACCAATTTTCAAAGGATTTGGAGGACTAACT 31876 Qy 1241 GlyGlnIleValAlaAlaLeuSerThrAlaLysTyrLysAsnTrpProGluSerValTyr 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31877 GGACAAATAGTGGCAGCGCTTTCAACAGCTAAATATAAGAACTGGCCTGAATCTGTGTAT 31936 Qy 1261 PhePheLysArgGlyGlySerIleGlnGlnTyrIleTyrLysGlnGluProValGlnLys 1280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31937 TTTTTCAAGAGAGGTGGCAGCATTCAGCAGTATATTTATAAACAGGAACCTGTACAGAAG 31996 Qy 1281 CysProGlyArgArgProAlaLeuAsnTyrProValTyrGlyGluThrThrGlnValArg 1300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 31997 TGCCCTGGAAGAAGGCCTGCTCTAAATTATCCAGTGTATGGAGAAACGACACAGGTTAGG 32056 Qy 1301 ArgArgArgPheGluArgAlaIleGlyProSerGlnThrHisThrIleArgIleGlnTyr 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32057 AGACGTCGCTTTGAACGTGCTATAGGACCTTCTCAAACACACACCATCAGAATTCAATAT 32116 Qy 1321 SerProAlaArgLeuAlaTyrGlnAspLysGlyValLeuHisAsnGluValLysValSer 1340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32117 TCACCTGCCAGACTGGCTTATCAAGACAAAGGTGTCCTTCATAATGAAGTTAAAGTGAGT 32176 Qy 1341 IleLeuTrpArgGlyLeuProAsnValValThrSerAlaIleSerLeuProAsnIleArg 1360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32177 ATACTGTGGAGAGGACTTCCAAATGTGGTTACCTCAGCTATATCACTGCCCAACATCAGA 32236 Qy 1361 LysProAspGlyTyrAspTyrTyrAlaPheSerLysAspGlnTyrTyrAsnIleAspVal 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32237 AAACCTGACGGCTATGATTACTATGCCTTTTCTAAAGATCAATACTATAACATTGATGTG 32296 Qy 1381 ProSerArgThrAlaArgAlaIleThrThrArgSerGlyGlnThrLeuSerLysValTrp 1400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32297 CCTAGTAGAACAGCAAGAGCAATTACTACTCGTTCTGGGCAGACCTTATCCAAAGTCTGG 32356 Qy 1401 TyrAsnCysPro 1404 |||||||||||| Db 32357 TACAACTGTCCT 32368 Sequence 12, Patent No. 11905531 Human PRG4 transcript variant A nucleic acid sequence Alignment Scores: Length: 5050 Score: 7521.00 Matches: 1404 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-17-772-450-1 (1-1404) x US-16-524-645-12 (1-5050) Qy 1 MetAlaTrpLysThrLeuProIleTyrLeuLeuLeuLeuLeuSerValPheValIleGln 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 52 ATGGCATGGAAAACACTTCCCATTTACCTGTTGTTGCTGCTGTCTGTTTTCGTGATTCAG 111 Qy 21 GlnValSerSerGlnAspLeuSerSerCysAlaGlyArgCysGlyGluGlyTyrSerArg 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 112 CAAGTTTCATCTCAAGATTTATCAAGCTGTGCAGGGAGATGTGGGGAAGGGTATTCTAGA 171 Qy 41 AspAlaThrCysAsnCysAspTyrAsnCysGlnHisTyrMetGluCysCysProAspPhe 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 172 GATGCCACCTGCAACTGTGATTATAACTGTCAACACTACATGGAGTGCTGCCCTGATTTC 231 Qy 61 LysArgValCysThrAlaGluLeuSerCysLysGlyArgCysPheGluSerPheGluArg 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 232 AAGAGAGTCTGCACTGCGGAGCTTTCCTGTAAAGGCCGCTGCTTTGAGTCCTTCGAGAGA 291 Qy 81 GlyArgGluCysAspCysAspAlaGlnCysLysLysTyrAspLysCysCysProAspTyr 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 292 GGGAGGGAGTGTGACTGCGACGCCCAATGTAAGAAGTATGACAAGTGCTGTCCCGATTAT 351 Qy 101 GluSerPheCysAlaGluValHisAsnProThrSerProProSerSerLysLysAlaPro 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 352 GAGAGTTTCTGTGCAGAAGTGCATAATCCCACATCACCACCATCTTCAAAGAAAGCACCT 411 Qy 121 ProProSerGlyAlaSerGlnThrIleLysSerThrThrLysArgSerProLysProPro 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 412 CCACCTTCAGGAGCATCTCAAACCATCAAATCAACAACCAAACGTTCACCCAAACCACCA 471 Qy 141 AsnLysLysLysThrLysLysValIleGluSerGluGluIleThrGluGluHisSerVal 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 472 AACAAGAAGAAGACTAAGAAAGTTATAGAATCAGAGGAAATAACAGAAGAACATTCTGTT 531 Qy 161 SerGluAsnGlnGluSerSerSerSerSerSerSerSerSerSerSerSerThrIleArg 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 532 TCTGAAAATCAAGAGTCCTCCTCCTCCTCCTCCTCTTCCTCTTCTTCTTCAACAATTCGG 591 Qy 181 LysIleLysSerSerLysAsnSerAlaAlaAsnArgGluLeuGlnLysLysLeuLysVal 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 592 AAAATCAAGTCTTCCAAAAATTCAGCTGCTAATAGAGAATTACAGAAGAAACTCAAAGTA 651 Qy 201 LysAspAsnLysLysAsnArgThrLysLysLysProThrProLysProProValValAsp 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 652 AAAGATAACAAGAAGAACAGAACTAAAAAGAAACCTACCCCCAAACCACCAGTTGTAGAT 711 Qy 221 GluAlaGlySerGlyLeuAspAsnGlyAspPheLysValThrThrProAspThrSerThr 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 712 GAAGCTGGAAGTGGATTGGACAATGGTGACTTCAAGGTCACAACTCCTGACACGTCTACC 771 Qy 241 ThrGlnHisAsnLysValSerThrSerProLysIleThrThrAlaLysProIleAsnPro 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 772 ACCCAACACAATAAAGTCAGCACATCTCCCAAGATCACAACAGCAAAACCAATAAATCCC 831 Qy 261 ArgProSerLeuProProAsnSerAspThrSerLysGluThrSerLeuThrValAsnLys 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 832 AGACCCAGTCTTCCACCTAATTCTGATACATCTAAAGAGACGTCTTTGACAGTGAATAAA 891 Qy 281 GluThrThrValGluThrLysGluThrThrThrThrAsnLysGlnThrSerThrAspGly 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 892 GAGACAACAGTTGAAACTAAAGAAACTACTACAACAAATAAACAGACTTCAACTGATGGA 951 Qy 301 LysGluLysThrThrSerAlaLysGluThrGlnSerIleGluLysThrSerAlaLysAsp 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 952 AAAGAGAAGACTACTTCCGCTAAAGAGACACAAAGTATAGAGAAAACATCTGCTAAAGAT 1011 Qy 321 LeuAlaProThrSerLysValLeuAlaLysProThrProLysAlaGluThrThrThrLys 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1012 TTAGCACCCACATCTAAAGTGCTGGCTAAACCTACACCCAAAGCTGAAACTACAACCAAA 1071 Qy 341 GlyProAlaLeuThrThrProLysGluProThrProThrThrProLysGluProAlaSer 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1072 GGCCCTGCTCTCACCACTCCCAAGGAGCCCACGCCCACCACTCCCAAGGAGCCTGCATCT 1131 Qy 361 ThrThrProLysGluProThrProThrThrIleLysSerAlaProThrThrProLysGlu 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1132 ACCACACCCAAAGAGCCCACACCTACCACCATCAAGTCTGCACCCACCACCCCCAAGGAG 1191 Qy 381 ProAlaProThrThrThrLysSerAlaProThrThrProLysGluProAlaProThrThr 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1192 CCTGCACCCACCACCACCAAGTCTGCACCCACCACTCCCAAGGAGCCTGCACCCACCACC 1251 Qy 401 ThrLysGluProAlaProThrThrProLysGluProAlaProThrThrThrLysGluPro 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1252 ACCAAGGAGCCTGCACCCACCACTCCCAAGGAGCCTGCACCCACCACCACCAAGGAGCCT 1311 Qy 421 AlaProThrThrThrLysSerAlaProThrThrProLysGluProAlaProThrThrPro 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1312 GCACCCACCACCACCAAGTCTGCACCCACCACTCCCAAGGAGCCTGCACCCACCACCCCC 1371 Qy 441 LysLysProAlaProThrThrProLysGluProAlaProThrThrProLysGluProThr 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1372 AAGAAGCCTGCCCCAACTACCCCCAAGGAGCCTGCACCCACCACTCCCAAGGAGCCTACA 1431 Qy 461 ProThrThrProLysGluProAlaProThrThrLysGluProAlaProThrThrProLys 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1432 CCCACCACTCCCAAGGAGCCTGCACCCACCACCAAGGAGCCTGCACCCACCACTCCCAAA 1491 Qy 481 GluProAlaProThrAlaProLysLysProAlaProThrThrProLysGluProAlaPro 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1492 GAGCCTGCACCCACTGCCCCCAAGAAGCCTGCCCCAACTACCCCCAAGGAGCCTGCACCC 1551 Qy 501 ThrThrProLysGluProAlaProThrThrThrLysGluProSerProThrThrProLys 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1552 ACCACTCCCAAGGAGCCTGCACCCACCACCACCAAGGAGCCTTCACCCACCACTCCCAAG 1611 Qy 521 GluProAlaProThrThrThrLysSerAlaProThrThrThrLysGluProAlaProThr 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1612 GAGCCTGCACCCACCACCACCAAGTCTGCACCCACCACTACCAAGGAGCCTGCACCCACC 1671 Qy 541 ThrThrLysSerAlaProThrThrProLysGluProSerProThrThrThrLysGluPro 560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1672 ACTACCAAGTCTGCACCCACCACTCCCAAGGAGCCTTCACCCACCACCACCAAGGAGCCT 1731 Qy 561 AlaProThrThrProLysGluProAlaProThrThrProLysLysProAlaProThrThr 580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1732 GCACCCACCACTCCCAAGGAGCCTGCACCCACCACCCCCAAGAAGCCTGCCCCAACTACC 1791 Qy 581 ProLysGluProAlaProThrThrProLysGluProAlaProThrThrThrLysLysPro 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1792 CCCAAGGAGCCTGCACCCACCACTCCCAAGGAACCTGCACCCACCACCACCAAGAAGCCT 1851 Qy 601 AlaProThrThrProLysGluProAlaProThrThrProLysGluThrAlaProThrThr 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1852 GCACCCACCACTCCCAAAGAGCCTGCCCCAACTACCCCCAAGGAGACTGCACCCACCACC 1911 Qy 621 ProLysLysLeuThrProThrThrProGluLysLeuAlaProThrThrProGluLysPro 640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1912 CCCAAGAAGCTCACGCCCACCACCCCCGAGAAGCTCGCACCCACCACCCCTGAGAAGCCC 1971 Qy 641 AlaProThrThrProGluGluLeuAlaProThrThrProGluGluProThrProThrThr 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1972 GCACCCACCACCCCTGAGGAGCTCGCACCCACCACCCCTGAGGAGCCCACACCCACCACC 2031 Qy 661 ProGluGluProAlaProThrThrProLysAlaAlaAlaProAsnThrProLysGluPro 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2032 CCTGAGGAGCCTGCTCCCACCACTCCCAAGGCAGCGGCTCCCAACACCCCTAAGGAGCCT 2091 Qy 681 AlaProThrThrProLysGluProAlaProThrThrProLysGluProAlaProThrThr 700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2092 GCTCCAACTACCCCTAAGGAGCCTGCTCCAACTACCCCTAAGGAGCCTGCTCCAACTACC 2151 Qy 701 ProLysGluThrAlaProThrThrProLysGlyThrAlaProThrThrLeuLysGluPro 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2152 CCTAAGGAGACTGCTCCAACTACCCCTAAAGGGACTGCTCCAACTACCCTCAAGGAACCT 2211 Qy 721 AlaProThrThrProLysLysProAlaProLysGluLeuAlaProThrThrThrLysGlu 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2212 GCACCCACTACTCCCAAGAAGCCTGCCCCCAAGGAGCTTGCACCCACCACCACCAAGGAG 2271 Qy 741 ProThrSerThrThrSerAspLysProAlaProThrThrProLysGlyThrAlaProThr 760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2272 CCCACATCCACCACCTCTGACAAGCCCGCTCCAACTACCCCTAAGGGGACTGCTCCAACT 2331 Qy 761 ThrProLysGluProAlaProThrThrProLysGluProAlaProThrThrProLysGly 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2332 ACCCCTAAGGAGCCTGCTCCAACTACCCCTAAGGAGCCTGCTCCAACTACCCCTAAGGGG 2391 Qy 781 ThrAlaProThrThrLeuLysGluProAlaProThrThrProLysLysProAlaProLys 800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2392 ACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGAAGCCTGCCCCCAAG 2451 Qy 801 GluLeuAlaProThrThrThrLysGlyProThrSerThrThrSerAspLysProAlaPro 820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2452 GAGCTTGCACCCACCACCACCAAGGGGCCCACATCCACCACCTCTGACAAGCCTGCTCCA 2511 Qy 821 ThrThrProLysGluThrAlaProThrThrProLysGluProAlaProThrThrProLys 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2512 ACTACACCTAAGGAGACTGCTCCAACTACCCCCAAGGAGCCTGCACCCACTACCCCCAAG 2571 Qy 841 LysProAlaProThrThrProGluThrProProProThrThrSerGluValSerThrPro 860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2572 AAGCCTGCTCCAACTACTCCTGAGACACCTCCTCCAACCACTTCAGAGGTCTCTACTCCA 2631 Qy 861 ThrThrThrLysGluProThrThrIleHisLysSerProAspGluSerThrProGluLeu 880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2632 ACTACCACCAAGGAGCCTACCACTATCCACAAAAGCCCTGATGAATCAACTCCTGAGCTT 2691 Qy 881 SerAlaGluProThrProLysAlaLeuGluAsnSerProLysGluProGlyValProThr 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2692 TCTGCAGAACCCACACCAAAAGCTCTTGAAAACAGTCCCAAGGAACCTGGTGTACCTACA 2751 Qy 901 ThrLysThrProAlaAlaThrLysProGluMetThrThrThrAlaLysAspLysThrThr 920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2752 ACTAAGACTCCTGCAGCGACTAAACCTGAAATGACTACAACAGCTAAAGACAAGACAACA 2811 Qy 921 GluArgAspLeuArgThrThrProGluThrThrThrAlaAlaProLysMetThrLysGlu 940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2812 GAAAGAGACTTACGTACTACACCTGAAACTACAACTGCTGCACCTAAGATGACAAAAGAG 2871 Qy 941 ThrAlaThrThrThrGluLysThrThrGluSerLysIleThrAlaThrThrThrGlnVal 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2872 ACAGCAACTACAACAGAAAAAACTACCGAATCCAAAATAACAGCTACAACCACACAAGTA 2931 Qy 961 ThrSerThrThrThrGlnAspThrThrProPheLysIleThrThrLeuLysThrThrThr 980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2932 ACATCTACCACAACTCAAGATACCACACCATTCAAAATTACTACTCTTAAAACAACTACT 2991 Qy 981 LeuAlaProLysValThrThrThrLysLysThrIleThrThrThrGluIleMetAsnLys 1000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2992 CTTGCACCCAAAGTAACTACAACAAAAAAGACAATTACTACCACTGAGATTATGAACAAA 3051 Qy 1001 ProGluGluThrAlaLysProLysAspArgAlaThrAsnSerLysAlaThrThrProLys 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3052 CCTGAAGAAACAGCTAAACCAAAAGACAGAGCTACTAATTCTAAAGCGACAACTCCTAAA 3111 Qy 1021 ProGlnLysProThrLysAlaProLysLysProThrSerThrLysLysProLysThrMet 1040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3112 CCTCAAAAGCCAACCAAAGCACCCAAAAAACCCACTTCTACCAAAAAGCCAAAAACAATG 3171 Qy 1041 ProArgValArgLysProLysThrThrProThrProArgLysMetThrSerThrMetPro 1060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3172 CCTAGAGTGAGAAAACCAAAGACGACACCAACTCCCCGCAAGATGACATCAACAATGCCA 3231 Qy 1061 GluLeuAsnProThrSerArgIleAlaGluAlaMetLeuGlnThrThrThrArgProAsn 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3232 GAATTGAACCCTACCTCAAGAATAGCAGAAGCCATGCTCCAAACCACCACCAGACCTAAC 3291 Qy 1081 GlnThrProAsnSerLysLeuValGluValAsnProLysSerGluAspAlaGlyGlyAla 1100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3292 CAAACTCCAAACTCCAAACTAGTTGAAGTAAATCCAAAGAGTGAAGATGCAGGTGGTGCT 3351 Qy 1101 GluGlyGluThrProHisMetLeuLeuArgProHisValPheMetProGluValThrPro 1120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3352 GAAGGAGAAACACCTCATATGCTTCTCAGGCCCCATGTGTTCATGCCTGAAGTTACTCCC 3411 Qy 1121 AspMetAspTyrLeuProArgValProAsnGlnGlyIleIleIleAsnProMetLeuSer 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3412 GACATGGATTACTTACCGAGAGTACCCAATCAAGGCATTATCATCAATCCCATGCTTTCC 3471 Qy 1141 AspGluThrAsnIleCysAsnGlyLysProValAspGlyLeuThrThrLeuArgAsnGly 1160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3472 GATGAGACCAATATATGCAATGGTAAGCCAGTAGATGGACTGACTACTTTGCGCAATGGG 3531 Qy 1161 ThrLeuValAlaPheArgGlyHisTyrPheTrpMetLeuSerProPheSerProProSer 1180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3532 ACATTAGTTGCATTCCGAGGTCATTATTTCTGGATGCTAAGTCCATTCAGTCCACCATCT 3591 Qy 1181 ProAlaArgArgIleThrGluValTrpGlyIleProSerProIleAspThrValPheThr 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3592 CCAGCTCGCAGAATTACTGAAGTTTGGGGTATTCCTTCCCCCATTGATACTGTTTTTACT 3651 Qy 1201 ArgCysAsnCysGluGlyLysThrPhePhePheLysAspSerGlnTyrTrpArgPheThr 1220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3652 AGGTGCAACTGTGAAGGAAAAACTTTCTTCTTTAAGGATTCTCAGTACTGGCGTTTTACC 3711 Qy 1221 AsnAspIleLysAspAlaGlyTyrProLysProIlePheLysGlyPheGlyGlyLeuThr 1240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3712 AATGATATAAAAGATGCAGGGTACCCCAAACCAATTTTCAAAGGATTTGGAGGACTAACT 3771 Qy 1241 GlyGlnIleValAlaAlaLeuSerThrAlaLysTyrLysAsnTrpProGluSerValTyr 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3772 GGACAAATAGTGGCAGCGCTTTCAACAGCTAAATATAAGAACTGGCCTGAATCTGTGTAT 3831 Qy 1261 PhePheLysArgGlyGlySerIleGlnGlnTyrIleTyrLysGlnGluProValGlnLys 1280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3832 TTTTTCAAGAGAGGTGGCAGCATTCAGCAGTATATTTATAAACAGGAACCTGTACAGAAG 3891 Qy 1281 CysProGlyArgArgProAlaLeuAsnTyrProValTyrGlyGluThrThrGlnValArg 1300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3892 TGCCCTGGAAGAAGGCCTGCTCTAAATTATCCAGTGTATGGAGAAACGACACAGGTTAGG 3951 Qy 1301 ArgArgArgPheGluArgAlaIleGlyProSerGlnThrHisThrIleArgIleGlnTyr 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3952 AGACGTCGCTTTGAACGTGCTATAGGACCTTCTCAAACACACACCATCAGAATTCAATAT 4011 Qy 1321 SerProAlaArgLeuAlaTyrGlnAspLysGlyValLeuHisAsnGluValLysValSer 1340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4012 TCACCTGCCAGACTGGCTTATCAAGACAAAGGTGTCCTTCATAATGAAGTTAAAGTGAGT 4071 Qy 1341 IleLeuTrpArgGlyLeuProAsnValValThrSerAlaIleSerLeuProAsnIleArg 1360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4072 ATACTGTGGAGAGGACTTCCAAATGTGGTTACCTCAGCTATATCACTGCCCAACATCAGA 4131 Qy 1361 LysProAspGlyTyrAspTyrTyrAlaPheSerLysAspGlnTyrTyrAsnIleAspVal 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4132 AAACCTGACGGCTATGATTACTATGCCTTTTCTAAAGATCAATACTATAACATTGATGTG 4191 Qy 1381 ProSerArgThrAlaArgAlaIleThrThrArgSerGlyGlnThrLeuSerLysValTrp 1400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4192 CCTAGTAGAACAGCAAGAGCAATTACTACTCGTTCTGGGCAGACCTTATCCAAAGTCTGG 4251 Qy 1401 TyrAsnCysPro 1404 |||||||||||| Db 4252 TACAACTGTCCT 4263
Read full office action

Prosecution Timeline

Apr 27, 2022
Application Filed
Nov 26, 2025
Non-Final Rejection mailed — §103, §112
Mar 26, 2026
Response Filed
Jun 04, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Patent 12649928
RNA-Guided Human Genome Engineering
6y 0m to grant Granted Jun 09, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.9%)
4y 0m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 741 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month