Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 17-38 are pending and under examination.
Drawings
The drawings are not of sufficient quality to permit examination. Accordingly, replacement drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to this Office action. The replacement sheet(s) should be labeled “Replacement Sheet” in the page header (as per 37 CFR 1.84(c)) so as not to obstruct any portion of the drawing figures. If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action.
Applicant is given a shortened statutory period of TWO (2) MONTHS to submit new drawings in compliance with 37 CFR 1.81. Extensions of time may be obtained under the provisions of 37 CFR 1.136(a) but in no case can any extension carry the date for reply to this letter beyond the maximum period of SIX MONTHS set by statute (35 U.S.C. 133). Failure to timely submit replacement drawing sheets will result in ABANDONMENT of the application.
It is submitted that certain Figures such as at least Figures 3, 18, 21, 23, 24, 26 lack sufficient clarity.
Nucleotide and/or Amino Acid Sequence Disclosures
Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
The sequence disclosures are located at least in figures 4, 9, 23.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
It is noted that if the depicted sequences are smaller segments of the sequences in the sequences listed in the sequence listing, they should be appropriately labelled in the specification and drawings.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 17-38 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as failing to set forth the subject matter which the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the applicant regards as the invention.
Regarding claim 17: The claim recites a plant genome editing system comprising a fusion protein and/or a pegRNA, such that the pegRNA is optional. However, the claim further requires that “the at least one pegRNA can form a complex with the fusion protein and target the fusion protein to a target sequence.” In embodiments encompassed by the claim that do not include a pegRNA, this functional limitation cannot be met. Accordingly, the claim contains an internal inconsistency and fails to inform, with reasonable certainty, the scope of the claimed invention.
Claims 18-38 are rejected for their dependency on the rejected claim.
Regarding claim 21, and 24: The word "preferably" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Regarding claim 22: the claim requires pegRNA to have sufficient sequence identity with the target sequence. It is not clear what percentage is considered to be “sufficient.” The specification indicated that “sufficient sequence identity is preferably 100%. However, such exemplary limitations cannot be read into the claim. As such the metes and bounds of the claims are unclear.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 17 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Liu et al U.S. Patent No.: US12435330B2 as supported by priority application number 62/913,480, filed on Oct 10, 2019; hereinafter "Liu" in view of Belhaj et al (Curr Opin Biotechnol. 2015 Apr; hereinafter "Belhaj;" See PTO-892 of 07/24/25).
Regarding claim 17: Liu taught “methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein encoding one or more components of the RNA prime editor (RPE) system described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells.” (See Liu [0068]). The delivering one or more polynucleotides encoding one or more components of the RNA prime editor (RPE) system reads on providing step as claimed. Liu disclosed that “RPE RNA editing system described herein comprises an RPEgRNA to direct the Cas 13 component to the target RNA molecule of interest.” (See Liu [0038]). Further Liu disclosed that “a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence.” (See Liu [0077]). It is noted that the examples of Liu are directed to mammalian cell editing. However, Belhaj taught that CRISPR systems are modular and readily adaptable in plants (See Belhaj Abstract). Belhaj also taught that Cas variants can be functional in plants (See Belhaj p. 77, first para). Given the disclosure of Liu, in combination with the teachings of Belhaj regarding the adaptability of mammalian CRISPR systems in plants, a person of ordinary skill in the art would have had reasonable expectation of success in adapting the methods of Liu in plants, making the approach in achieving plant genome modification obvious.
Regarding claim 18: The teachings of Liu are set forth above. However, Liu did not teach transforming the plant genome editing system into an isolated plant cell or tissue, and then regenerating the transformed plant cell or tissue into an intact plant; or wherein said introducing comprises transforming the plant genome editing system into a specific part of an intact plant. However, Belhaj taught a “pipeline of generating a CRISPR/Cas9-mutagenised plant line: (See Belhaj Figure 3). Belhaj taught that “[i]f a mutagenesis event occurs early in plant regeneration, that is, before the first embryogenic cell divides, a diploid plant may be: first, heterozygous, if the locus on only one of the two sister chromatids was mutagenized, second, homozygous, if both alleles were mutagenized and the breaks were repaired with the same mutation, or third, biallelic, if both alleles were mutagenized but repair resulted in different alleles. In many cases, the mutation would occur later in development and independently in different tissues resulting in a chimeric plant consisting of cells with different genotypes, including wild type, heterozygous, homozygous or biallelic. CRISPR/Cas9-induced homozygous and biallelic mutations in first-generation transgenics have been reported in Arabidopsis, rice and tomato allowing early gene-function studies. If homozygous or biallelic mutants are not generated as primary transformants, they must be progressed to the next generation for loss-of-function phenotype analysis. A number of studies have demonstrated Mendelian heritability of CRISPR/Cas9- induced mutations in Arabidopsis, rice and tomato.” As such Belhaj taught a method to regenerate a plant cell into an intact plant. It would have been obvious for a person of ordinary skill in the art to use the method of gene editing in organisms including plants as taught by Liu in plants as taught by Belhaj to arrive at an intact modified plant. One of ordinary skill would have a reasonable expectation of success in view of teachings of Belhaj to believe CRISPR systems can be used in plants.
Claims 17, 20-22, 24, 26-27, 35 and 37 are rejected under 35 U.S.C. 103 as being unpatentable over Anzalone et al U.S. Patent No.: US11447770B1 as supported by priority application number 62/858,958, filed on Jun 07, 2019; hereinafter "Anzalone-II" in view of Belhaj et al (Curr Opin Biotechnol. 2015 Apr; hereinafter "Belhaj;" See PTO-892 of 07/24/25).
Regarding claims 17, 20-21, 27 and 37: Anzalone-II disclosed methods comprising delivering one or more polynucleotides, such as or one or more vectors encoding one or more components of the target-primed reverse transcription (TPRT) editing system, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell, as well as “cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells.” (See Anzalone-II [0248]). Further Anzalone-II indicated that “The term "TPRT editing system" or "TPRT editor" or "PE system" or "PE editing system" refers the compositions involved in the method of genome editing using target-primed reverse transcription (TPRT) describe herein, including, but not limited to the napDNAbps, reverse transcriptases, fusion proteins (e.g., comprising napDNAbps and reverse transcriptases)” (See Anzalone-II [0128]). Anzalone-II disclosed a mechanism of target-primed reverse transcription (TPRT) which can be leveraged or adapted for conducting precision CRISPR/Cas based genome editing with high efficiency and genetic flexibility. (See Anzalone-II [006]). The delivering one or more polynucleotides, such as or one or more vectors as described herein encoding one or more components of the TPRT editing system reads on providing step as claimed. Further Anzalone-II disclosed that the napDNAbp has a nickase activity, such as Cas9 nickase (nCas9) as required by claim 20 (See Anzalone-II FIG. 5, [0275]). It is also noted the FIG. 4D shows TPRT on full dsDNA substrates with Cas9(H840A) and 5'-extended gRNAs, which is identical to SEQ ID NO: 2, as required by claim 37 (See Anzalone-II, [0074]). Further Anzalone-II used M-MLV RT for in vitro TPRT assays (See Anzalone-II Fig. 4A-4E, [0074]), as required by claim 21. It is noted that the examples of Anzalone-II are directed to mammalian cell editing. However, Belhaj taught that CRISPR systems are modular and readily adaptable in plants (See Belhaj Abstract). Belhaj also taught that Cas variants can be functional in plants (See Belhaj p. 77, first para). Given the disclosure of Anzalone-II, in combination with the teachings of Belhaj regarding the adaptability of mammalian CRISPR systems in plants, a person of ordinary skill in the art would have had reasonable expectation of success in adapting the methods of Anzalone-II in plants, making the approach in achieving plant genome modification obvious.
Regarding claim 22, 24 and 26: [0066] of Anzalone-II and FIG. 1 of Anzalone-II disclosed that “a reverse transcriptase (RT) fused to a Cas9 nickase, in a complex with a guide RNA (gRNA), binds the DNA target site and nicks the PAM-containing DNA strand adjacent to the target nucleotide. The RT enzyme uses the nicked DNA as a primer for DNA synthesis from the gRNA, which is used as a template for the synthesis of a new DNA strand that encodes the desired edit.” As such it is submitted that Anzalone-II discloses a guide sequence of the pegRNA configured to have sufficient sequence identity with the target sequence and thus can bind to a complementary strand of the target sequence by base pairing so as to achieve sequence-specific targeting.
Regarding claim 35: Anzalone-II indicated that “newly synthesized strand would be homologous to the genomic target sequence except for the inclusion of a desired nucleotide change (e.g., a single nucleotide change, a deletion, or an insertion, or a combination thereof).” (See Anzalone-II [006]).
Claims 19 and 36 are rejected under 35 U.S.C. 103 as being unpatentable over Anzalone et al (U.S. Patent No.: US11447770B1 as supported by priority application number 62/858,958, filed on Jun 07, 2019; hereinafter "Anzalone-II") in view of Belhaj et al (Curr Opin Biotechnol. 2015 Apr; hereinafter "Belhaj;" See PTO-892 of 07/24/25), and further in view of Le Blanc et al (Plant J.; Published 2018 Jan; hereinafter "LeBlanc;" See PTO-892 of 07/24/25).
Regarding claims 19 and 36: The teachings of Anzalone-II and Belhaj are set forth above. Briefly, Anzalone-II methods comprising delivering one or more polynucleotides, such as or one or more vectors encoding one or more components of the target-primed reverse transcription (TPRT) editing system, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell, as well as “cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells.” Anzalone taught that the system can be used in plants, as shown above. Further Belhaj taught a “pipeline of generating a CRISPR/Cas9-mutagenised plant line.” However, Anzalone-II and Belhaj did not teach or suggest introducing genome editing system at an elevated temperature. LeBlanc taught that using CRISPR/Cas9 in Arabidopsis at 37C yielded higher mutations. For example, LeBlanc taught “targeted mutagenesis by CRISPR/Cas9 in Arabidopsis is increased by approximately 5-fold in somatic tissues and up to 100-fold in the germline upon heat treatment. This effect of temperature on the mutation rate is not limited to Arabidopsis, as we observed a similar increase in targeted mutations by CRISPR/Cas9 in Citrus plants exposed to heat stress at 37°C.” (See LeBlanc Abstract). It is submitted that a person of ordinary skill in the art would have been motivated to improve the probability of targeted mutations to generate genetically varied crops. LeBlanc clearly taught that heat stress increases the probability of targeted mutations. One of ordinary skill in the art would have pursued method taught by LeBlanc with a reasonable expectation of success to precisely modify plant genome at higher rates. If this leads to the anticipated success, it is likely that method [was] not of innovation but of ordinary skill and common sense. See KSR, 550 U.S. at 421, 82 USPQ2d at 1397.
Claim 23 is rejected under 35 U.S.C. 103 as being unpatentable over Anzalone et al U.S. Patent No.: US11447770B1 as supported by priority application number 62/858,958, filed on Jun 07, 2019; hereinafter "Anzalone-II", in view of Belhaj et al (Curr Opin Biotechnol. 2015 Apr; hereinafter "Belhaj;" See PTO-892 of 07/24/25) and further in view of Mali et al (US20140342456; Published Nov 20, 2014; hereinafter "Mali;" See PTO-892 of 07/24/25) as further evidenced by Nelson et al (Nat Biotechnol; Published 2022; hereinafter "Nelson;" See PTO-892 of 07/24/25).
Regarding claim 23: The teachings of Anzalone-II in view of Belhaj are set forth above. However, Anzalone-II and Belhaj did not teach or suggest a scaffold sequence comprising SEQ ID NO: 8. Mali (14/318,933) disclosed a gRNA scaffold sequence, SEQ ID NO: 46, which is 100% identical to the instant SEQ ID NO: 8. (See alignment below)
Query Match 100.0%; Score 76; Length 76;
Best Local Similarity 100.0%;
Matches 76; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU 60
Qy 61 GGCACCGAGUCGGUGC 76
||||||||||||||||
Db 61 GGCACCGAGUCGGUGC 76
Sequence alignment between SEQ ID NO: 46 of Mali to SEQ ID NO: 8 of instant application
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Anzalone et al U.S. Patent No.: US11447770B1 as supported by priority application number 62/858,958, filed on Jun 07, 2019; hereinafter "Anzalone-II", in view of Belhaj et al (Curr Opin Biotechnol. 2015 Apr; hereinafter "Belhaj;" See PTO-892 of 07/24/25) and further in view of Wilson et al (Front Pharmacol. 2018 Jul 12; hereinafter "Wilson" ; See PTO-892 of 07/24/25).
Regarding claim 25: The teachings of Anzalone-II in view of Belhaj are set forth above. However, Anzalone-II and Belhaj did not teach or suggest the claimed melting temperatures. Wilson taught that melting temperature was an important indicator of CRISPR/Cas9 activity. For example, Wilson taught that “a G preceding the PAM being a strong indicator of CRISPR-Cas9 activity, or global variables such as GC content and gRNA melting temperature were consistently reported as being important.” (See Wilson p. 2, col. 2, para 1). As such a person of ordinary skill in the art would have found it obvious to optimize Tm of primer binding site, which is an analogous to gRNA in CRISPR. It is submitted that “[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.” In reAller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). “The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages.”); In reHoeschele, 406 F.2d 1403, 160 USPQ 809 (CCPA 1969).
Response to Applicant Arguments and Declaration under 37 C.F.R. 1.132
Applicants argued that the instant claims are directed to gene editing in plants and not mammalian cells, which uses nCas9(H840A) fused with M- MLV reverse transcriptase (RT) and pegRNA comprising a primer binding site (PBS) and an RT template. It is acknowledged from both the Applicant’s declaration and arguments that present application relates to a novel plant DNA precise editing system. It is noted from the declaration and the Applicant’s arguments that, editing system is unpredictable in plants and based on Anzalone’s mammalian cell editing data, especially owing to differences in sequence structure characteristics and DNA repair mechanisms between animal and plant genomes, the base editing system exerts different effects in animal and plant cells. Applicants specifically pointed out certain inconsistencies in plant gene editing as compared to mammalian gene editing as taught by Anzalone, that addition of sgRNA to the prime editing system did not increase the efficiency of gene editing in rice and wheat (See dec. #7). Applicant’s arguments and declaration are considered but are not persuasive.
It is initially noted the test data/Exhibits provided in the Declaration submitted 11/24/2025 are of poor quality and illegible and thus insufficient evidence.
Applicant’s evidence appears to demonstrate that plant DNA repair mechanisms result in different efficiencies and outcomes relative to animal cells. However, such differences in biological response do not constitute a “teaching away” unless the prior art expressly criticizes, discredits, or discourages the claimed approach. See MPEP 2145. Anzalone does not teach that prime editing would fail or be unsuitable in plants, nor does it suggest that alternative repair mechanisms in plants would render the approach inoperative.
It is especially noted that the claims are not limited to the specific repair outcomes, efficiencies, plant species (rice or wheat), or optimization strategies demonstrated by applicant. Instead, the claims broadly encompass application of a prime editing system comprising a CRISPR nickase–reverse transcriptase fusion and pegRNA to plant genomes. Applicant’s evidence, while potentially supporting patentability of narrow, plant-optimized embodiments, does not establish that the claimed subject matter as a whole would not have been obvious to a person of ordinary skill in the art.
Regarding claims 28-34 and 38: Applicants arguments and declaration regarding enhanced efficiency using two pegRNAs are noted. It is submitted that the prior art did not teach enhanced editing efficiency using two or more than two pegRNA in plants as shown by the Applicant.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 17-38 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1-15 of copending Application No. 18/689,009 (reference application).
Although the claims at issue are not identical, they are not patentably distinct from each other because of the reason listed below.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Pending claim 15 of the reference is directed to producing a genetically modified plant by prime editing system comprising a nickase fused to a reverse transcriptase. As such the claim anticipates all pending claims of the instant application.
Response to Arguments: Applicants argued that the present application has an earlier effective filing date, than the reference (18/689,009) Application. Consequently, pursuant to M.P.E.P. § 1490(VI)(D) this rejection should be withdrawn.
It is submitted that according to MPEP 804(I)(B)(1)(b)(i) and MPEP 1490(VI)(D)(2)(a), a provisional nonstatutory double patenting rejection is only withdrawn when it is the only rejection remaining in an application having the earliest effective U.S. filing date (taking into account any benefit under 35 U.S.C. 120, 121, 365(c), or 386(c) ) with respect to the conflicting claims); at which point the "provisional" nonstatutory double patenting rejection in the other (later filed) application(s) will be converted into a nonstatutory double patenting rejection when the application with the earliest U.S. effective filing date issues as a patent.
PNG
media_image1.png
18
19
media_image1.png
Greyscale
Conclusion
Claims 28-24 and 38 appear free of art.
Claims 17-27, and 35-37 remain rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAGAMYA VIJAYARAGHAVAN whose telephone number is (703)756-5934. The examiner can normally be reached 9:00a-5:00p.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher M. Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JAGAMYA NMN VIJAYARAGHAVAN/ Examiner, Art Unit 1633
/EVELYN Y PYLA/Primary Examiner, Art Unit 1633