Office Action Predictor
Application No. 17/773,478

MICRORNA BLOCKADE FOR THE TREATMENT OF DISEASE

Non-Final OA §103§112
Filed
Apr 29, 2022
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Yale University
OA Round
1 (Non-Final)
52%
Grant Probability
Moderate
1-2
OA Rounds
2y 12m
To Grant
99%
With Interview

Examiner Intelligence

52%
Career Allow Rate
25 granted / 48 resolved
Without
With
+62.5%
Interview Lift
avg trend
2y 12m
Avg Prosecution
47 pending
95
Total Applications
career history

Statute-Specific Performance

§101
8.1%
-31.9% vs TC avg
§103
27.4%
-12.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
30.3%
-9.7% vs TC avg
Black line = Tech Center average estimate • Based on career data

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s reply and amendments to the claims filed October 10, 2025 are acknowledged. Claims 18-19 were introduced. Accordingly, claims 1-19 are pending. Restriction/Election Applicant’s election of Group I (claims 1-3, and newly added claims 18-19) without traverse in the reply filed October 10, 2025 is acknowledged. The requirement for Applicant to elect a single species of “cardiovascular disease” and “neurodegenerative disease” has been reviewed in view of Applicant’s reply and the prior art uncovered during the search. The election of species requirements are officially withdrawn. The restriction requirement between the inventions of Groups I-VI remains in effect. Accordingly, claims 4-17 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions. Claims 1-3, and 18-19 are under examination hereinafter. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing, defective, or incomplete. See item 1) a) or 1) b) above. Specifically, USPTO records indicate that the title of the sequence listing filed April 29, 2022 is “39978187_1.TXT,” rather than “047162-7264US1-SequenceListing.txt,” as indicated in the amendments to the specification also filed April 29, 2022. The title of the sequence listing in the Incorporation by Reference paragraph should be amended, accordingly. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Priority Applicant’s priority claims to Application Nos. 62/932,205 and PCT/US2020/059065 are acknowledged. Claims 1-3, and 18-19 find support in provisional Application No. 62/932,205, filed November 7, 2019. The effective filing date of the claims under examination, therefore, is November 7, 2019. Claim Objections Claim 19 is objected to because of the following informalities: Claim 19 recites “The composition of claims 1,” which should be amended to recite “The composition of claim[[s]] 1.” Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-3, and 18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites “a polynucleotide comprising one or more of SEQ ID NOS: 1-41….” The plain language of claim 1 indicates that the polynucleotide may comprise one, two, three, etc., or up to all of the recited SEQ ID NOs. The specification provides literal support for this limitation (pg. 1, lines 18-19; pg. 17, lines 10-11). However, the polynucleotides of the specification consist of a single SEQ ID NO designed to block a miRNA target site, wherein the miRNA target sites blocked by the SEQ ID NOs are, in many cases, located in distinct target mRNAs (see Table 1). It is not clear whether the plain language interpretation of claim 1 (i.e., a polynucleotide comprising up to all of the recited SEQ ID NOs, wherein the SEQ ID NOs, in many cases, would correspond to many miRNA target sites in many distinct genes) is a reasonable interpretation based on the content of the specification. Claims 2-3, and 18 are rejected for depending from claim 1 and failing to remedy the indefiniteness. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 18 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 18 recites that “the polynucleotide comprises one or more of SEQ ID NOS: 1-41.” Claim 1 from which it depends recites “a polynucleotide comprising one or more of SEQ ID NOS: 1-41….” Claim 18 recites limitations which are already required of the claim 1, and therefore, fails to further limit the subject matter of claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Brancato in view of Grünweller The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-3, and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Brancato (Brancato et al., WO 03/040182 A1, published 15 May 2003; of record) in view of Grünweller (Grünweller and Hartmann, 2007, Biodrugs, 21(4):235-243). Regarding claims 1 and 18, Brancato teaches a composition comprising a polynucleotide (i.e., ODN1, corresponding to SEQ ID NO: 1) comprising a sequence 100% identical to instant SEQ ID NO: 1 (pg. 5, line 8; pg. 7, lines 18; “the invention is directed to pharmaceutical compositions containing one or more oligonucleotides herein provided… The oligonucleotides are suitably formulated with pharmaceutically acceptable vehicles and excipients,” pg. 6, lines 11-16). See alignments of record in Appendix I and Fig. A below. Brancato teaches that that ODN1 comprising SEQ ID NO: 1 is complementary to an Adenine and Uracil Rich Element (A + U-rich Element, ARE) in the 3’ untranslated region of bcl-2 mRNA (pg. 1, lines 2-5; pg. 3, line 27 to pg. 4, line 1; pg. 4, lines 23-26). Brancato teaches that bcl-2 expression can be modulated by the bcl-2 ARE-targeting polynucleotides – increasing bcl-2 mRNA and BCL-2 protein levels, and thereby, elevating the apoptotic threshold of cells (pg. 3, lines 19-26). Brancato teaches that the polynucleotides “benefit all pathological conditions that are related to excessive apoptosis” or “low bcl-2 expression,” e.g., various neurological pathologies, and several ophthalmologic diseases (pg. 3, lines 25-26; pg. 6, line 25 to pg. 7, line 7). Figure A. TGTCTTAAATAAATAAATCTTTTTTTC Brancato SEQ ID NO: 1 (ODN1) GTCTTAAATAAATAAATCTTT Instant SEQ ID NO: 1 Brancato teaches the polynucleotide is chemically modified, e.g., by 2’-O-Me and phosphorothioate (pg. 4, lines 1-11; pg. 5, lines 12-24); however, Brancato does not teach that the polynucleotide comprises at least one modification selected from the group consisting of locked nucleic acid, bridged nucleic acid, phosphorothioate nucleic acid, and peptide nucleic acid. Grünweller teaches that locked nucleic acid (LNA) modified polynucleotides are “particularly attractive for in vivo applications that are inaccessible to RNA interference technology, such as… inhibition of oncogenic microRNAs” (Abstract), and provides working examples from the prior art of inhibiting miRNA function using LNA modified polynucleotides (section 4.5, pg. 240, right col.). Grünweller also teaches a working example of a polynucleotide comprising LNA and phosphorothioate modifications, which outperforms a polynucleotide comprising 2’-O-Me and phosphorothioate modifications in a splice-silencing application, which like miRNA target site silencing, functions through steric blocking (rather than RNase H mechanisms) (section 3.2, pg. 238, left col.; Fig. 2). Grünweller teaches that particular LNA formats confer “extreme antisense-target duplex stability (formation of persistent steric blocks)” owing to their “conformational rigidity” (Abstract; section 1, pg. 236, right col.). Grünweller teaches that LNA modification offers additional improved properties, including “high sensitivity, good mismatch discrimination, low toxicity, and increased metabolic stability” (section 2, pg. 236, left col.). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the chemistry of Brancato’s polynucleotide to comprise LNA and a phosphorothioate backbone in view of Grünweller. It would have amounted to applying a known chemistry to a known polynucleotide, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in modifying Brancato’s polynucleotide to comprise LNA and a phosphorothioate backbone, because Brancato’s polynucleotide is itself chemically modified, and Grünweller teaches an improved chemistry relative to Brancato’s, which is particularly attractive for steric blocking applications and inhibiting miRNAs. The skilled artisan would have been motivated to modify the chemistry of Brancato’s polynucleotide using LNA and a phosphorothioate backbone given the many advantages Grünweller teaches for LNA modified polynucleotides in therapeutic applications, and the improved success of an LNA-phosphorothioate modified polynucleotide in a similar steric blocking application to that of Brancato. Regarding claim 2, the phrase “the polynucleotide is a locked nucleic acid,” is interpreted as requiring that the polynucleotide comprise “a covalent bond between the 2’ oxygen and the 4’ carbon of the pentose” (specification, pg. 3, lines 32-34). The polynucleotide rendered obvious above comprises a phosphorothioate backbone, and a locked nucleic acid (LNA), which as taught by Grünweller comprises a covalent bond between the 2’ oxygen and the 4’ carbon of the pentose (“In LNA modified oligonucleotides, a varying number of natural nucleotides are replaced with nucleotide analogs carrying an altered sugar moiety, in which the ribose 2’-O- and 4’-C atoms are connected via methylene bridge,” pg. 236, left col.; Fig. 1). Regarding claim 3, Brancato teaches that the composition further comprises at least one pharmaceutically acceptable excipient (“the invention is directed to pharmaceutical compositions containing one or more oligonucleotides herein provided… The oligonucleotides are suitably formulated with pharmaceutically acceptable vehicles and excipients,” pg. 6, lines 11-16). Claim Rejections - 35 USC § 103 – Brancato and Grünweller in further view of Bandyopadhyay Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Brancato (Brancato et al., WO 03/040182 A1, published 15 May 2003; of record) and Grünweller (Grünweller and Hartmann, 2007, Biodrugs, 21(4): 235-243) as applied to claims 1-3, and 18, in further view of Bandyopadhyay (Bandyopadhyay et al., 2003, Biochemical Pharmacology, 66 (2003) 1151-1162). The teachings of Brancato and Grünweller are described above and applied hereinafter. In addition, Brancato references “Schiavone et al., 2000” as providing information regarding the specifically targeted bcl-2 ARE (pg. 4, lines 23-26; see reference 46, pg. 16). Brancato also teaches that the polynucleotides are “preferably [] 13 to 30 nucleotides” in length (pg. 5, lines 4-5). Grünweller teaches that LNA-modified polynucleotides have several advantages over other chemically modified polynucleotides. In addition to the advantages described above, Grünweller teaches that “LNA-modified oligonucleotides exert their biologic effects at a shorter length than other oligonucleotides,” which may “lower unspecific toxicity, increase bioavailability, and body clearance, and improve cell delivery” (pg. 241, left col.) Neither Brancato and Grünweller teach a polynucleotide consisting of SEQ ID NO: 1. Bandyopadhyay provides specific guidance regarding the functional sequence of the bcl-2 ARE taught by Schiavone et al., 2000, which is targeted by the polynucleotides of Brancato (section 3.2, pg. 1156-1157). Bandyopadhyay teaches that Schiavone’s bcl-2 ARE contains a region, designated “ARE 1-A,” which contains the “entire destabilizing element,” and is characterized by the following sequence elements “three overlapping pentamers ((AUUU)3A) which contain the nonamer sequence (UUAUUUAUU)” (“Schiavone et al., [15] reported that bcl-2 mRNA contains a functional ARE in the 3’ UTR… ARE 1 (described by Schiavone et al., [15]) has three overlapping pentamers ((AUUU)3A) which contain the nonamer sequence (UUAUUUAUU) that can trigger rapid deadenylation and decay when inserted into β-globin mRNA … Within the 405 nucleotide ARE 1, there is a sequence of 137 nucleotides (referred to here as ARE 1-A) that contains the two pentamers and the (AUUU)3A sequence, which is likely to be the functional part of ARE 1,” “The level of β-globin ARE 1-A mRNA decreased at a rate similar to that of β-globin ARE-1, suggesting that the entire destabilizing element is contained within the 137 nucleotides of ARE 1-A,” pg. 1156-1157). Based on Bandyopadhyay, the skilled artisan would be able to determine the sequence of Brancato’s polynucleotide which targets the functional sequence of the bcl-2 ARE (i.e., the sequences that target the three overlapping pentamers ((AUUU)3A) which contain the nonamer sequence (UUAUUUAUU)). Fig. B illustrates the 13-nt sequence within Brancato’s polynucleotide which targets the three overlapping pentamers (underlined) containing the nonamer sequence (bold). As shown in Fig. B below, instant SEQ ID NO: 1 also comprises this 13-nt sequence. Figure B. TGTCTTAAATAAATAAATCTTTTTTTC Brancato SEQ ID NO: 1 (ODN1) GTCTTAAATAAATAAATCTTT Instant SEQ ID NO: 1 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the polynucleotide rendered obvious above to arrive at a polynucleotide consisting of SEQ ID NO: 1, in view of the teachings of Brancato and Grünweller regarding polynucleotide lengths (i.e., 13-30-nts, shorter LNA-modified polynucleotides) and the teachings of Bandyopadhyay regarding the functional sequences of the targeted bcl-2 ARE. It would have amounted to modifying the length of an obvious polynucleotide to a length within a preferred prior art range, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in modifying the polynucleotide length because as evidenced by Brancato and Grünweller, designing polynucleotides of various lengths to target known sequences was well within the purview of the skilled artisan. Furthermore, because Bandyopadhyay teaches the 13-nt functional sequence of the bcl-2 ARE which is targeted by Brancato’s polynucleotide, the skilled artisan could have readily modified Brancato’s polynucleotide to lengths within the claimed range (i.e., 13-30-nts) which preserve this target, with a reasonable expectation that the polynucleotides would be effective for their purpose (i.e., binding and blocking the bcl-2 ARE). In an effort to further develop the obvious polynucleotide for use in the therapeutic purposes proposed by Brancato, the skilled artisan would have been motivated to modify the polynucleotide length, because Grünweller teaches that an LNA-modified polynucleotide exerts biologic effects at a shorter length, which improves therapeutic properties, including “lower unspecific toxicity, increase[d] bioavailability, and body clearance, and improve[d] cell delivery.” Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Apr 29, 2022
Application Filed
Nov 29, 2025
Non-Final Rejection — §103, §112
Mar 18, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology. Study what changed to get past this examiner.

Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Apr 07, 2026
Patent 12570705
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12570975
COMPOSITION FOR DIAGNOSIS OR TREATMENT OF A CONDITION ASSOCIATED WITH INCREASED ACTIVITY OF EIF4E COMPRISING AN EIF4E INHIBITOR
2y 5m to grant Granted Mar 10, 2026
Patent 12570706
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12551573
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Feb 17, 2026

AI Strategy Recommendation

Click below to generate an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+62.5%)
2y 12m
Median Time to Grant
Low
PTA Risk
Based on 48 resolved cases by this examiner