DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 4 and 14 are directed to an allowable product. Pursuant to the procedures set forth in MPEP § 821.04(B), claims 31, 36, and 38-39, directed to the process of making or using an allowable product, previously withdrawn from consideration as a result of a restriction requirement, are hereby rejoined and fully examined for patentability under 37 CFR 1.104.
Because all claims previously withdrawn from consideration under 37 CFR 1.142 have been rejoined, the restriction requirement as set forth in the Office action mailed on 4/10/25 is hereby withdrawn. In view of the withdrawal of the restriction requirement as to the rejoined inventions, applicant(s) are advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application. Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01.
The non-elected sequences in claims 1, 4, 10, 11, and 14 were cancelled in the amendment filed on 10/22/25 and the sequences remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim.
Response to Arguments
Applicant’s arguments, see pages 7-10, filed 10/22/25, with respect to the rejection(s) of claims 1-7, 14, 17, 18, 20, 22-23, and 26 under 102 or 103 have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of the cancellation of SEQ ID NO: 1 or 25 in the independent claims.
The provisional nonstatutory double patenting rejection over claims 1-6, 8, 10-21, and 24 of co-pending Application No. 17/789,894 is withdrawn because ‘894 was abandoned on 12/5/25.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 22 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 22 recites the limitation "the INTASYL™" in line 4. There is insufficient antecedent basis for this limitation in the claim.
Claim 22 contains the trademark/trade name INTASYL™. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a self-delivering chemically modified double stranded molecule and, accordingly, the identification/description is indefinite.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Instant SEQ ID NOs: 20 (20-mer) and 44 (41-mer) are regions of a human BRD4 sequence. The prior art teaches that the BRD4 sequence (GenBank No. NM_058243.2) comprising the instant SEQ ID NOs. See pages 85-86 of the specification.
Claims 1, 3, and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Dharmacon (US 20050255487, cited on an IDS) taken with SilenSeed Ltd. (EP 2592146A2, of record) and GenBank NM_014299.2.
Dharmacon teaches identifying hyper-functional siRNA (pages 1-4, 8-24, and 84-87) using a “rational design” method of identifying hyper-functional siRNA target sequences. The siRNAs can be 18-30 base pairs. The hyper-functional siRNA with maximized efficacy can be used in therapeutics. See pages 2-3, 8-12 and 84-87.
Dharmacon teaches several siRNA, including SEQ ID NOs: 370161 (Db) that read on instant SEQ ID NOs: 20 (Qy) or a 19-mer of SEQ ID NO: 44.
Qy 1 UCCAGGAUGUGUUCGAAAU 19
Db 1 UCCAGGAUGUGUUCGAAAU 19
Nucleotides 11-29 of instant SEQ ID NO: 44
Qy 11 UCCAGGAUGUGUUCGAAAU 29
SEQ ID NO: 370161 (Db)
Db 1 UCCAGGAUGUGUUCGAAAU 19
Qy 2 CCCGCAAGCUCCAGGAUGU 20 of SEQ ID NO: 44
SEQ ID NO: 370172 (Db)
Db 1 CCCGCAAGCUCCAGGAUGU 19
Dharmacon further discloses modifying a ribonucleotide with a 2’-sugar modification, including 2’-O-methyl modification or 2’-Fluoro modification and a non-natural phosphodiester linkage, such as phosphorothioate (pages 7 and 20-23). Dharmacon teaches a pharmaceutical composition comprising a siRNA (page 24).
Dharmacon does not specifically teach wherein the siRNA comprising at least 12 contiguous nucleotides of SEQ ID NOs: 20 and/or 44 is chemically modified.
Silenseed Ltd teaches siRNA targeting a gene associated with prostate carcinoma stem cells, including BRD4 (GenBank NM_014299.2, Table 1, pages 5-6).
In addition, GenBank NM_014229.2 discloses a BRD4 nucleotide sequence, which comprises instant SEQ ID NO: 20 or 44.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Dharmacon taken with SILENSEED and GenBank No. NM_014299.2, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to make a double stranded comprising SEQ ID NO: 20 and/or 44 to study the possible treatment of prostate carcinoma. A person of ordinary skill in the art would have been motivated to make effective siRNA molecules against BRD4, including at least 12 contiguous nucleotides of SEQ ID NO: 20 or 44, using an art-recognized siRNA identification and design protocol disclosed by Dharmacon. The siRNA selection criteria set forth in Table IV of Dharmacon are based on a 19-mer strand sequence, and it is found that a siRNA having a 19-mer of SEQ ID NO: 20 or 44 would be produced by the method:
Sense strand: SEQ ID NO: 44 gcccgcaagcuccaggauguguucgaaaugcgcuuugccaa
Sense strand: SEQ ID NO: 20 uccaggauguguucgaaaug
The instant double stranded nucleic acid molecule satisfies several of the criterion I (30%-52% G/C content); criterion II (At least 3 A/U bases at positions 15-19 of the sense strand); criterion III (Absence of internal repeats, as measured by Tm of secondary structure < 20°); criterion IV (An A base at position 19 of the sense strand); criterion V (An A base at position 3 of the sense strand); criterion VI (A U base at position 10 of the sense strand); criterion VII (A base other than C at position 19 of the sense strand); and criterion VIII (A base other than G at position 13 of the sense strand) set forth Dharmacon, thereby satisfying seven criteria out of a total of eight criteria. A person of ordinary skill in the art would arrive at the claimed nucleic acid molecule (as an identifiable and predictable solution. See MPEP 2143(I)E), in view of Dharmacon by utilizing the eight criteria-based selection algorithm, identified a 19-mer sequence against Brd4 represented by NM_014229.2, wherein the identified 19-mer strand sequence of SEQ ID NO: 20 or nucleotides of SEQ ID NO: 44 is disclosed in their electronic sequence listing tables (see paragraph 0002 of Dharmacon), wherein the entire 19-mer of SEQ ID NO: 370161 is 100% identical to the 19-mer sequence of SEQ ID NO:20 or 44 disclosed in the instant claims. While it is acknowledged that Dharmacon provides millions of hyper-functional siRNA, including sequences that read on the instant double stranded nucleic acid molecule, the guidelines set forth by Dharmacon and the BRD4 nucleotide was known in the prior art and there was motivation to target this sequence to treat prostate cancer would limit the number of siRNA that would read on claimed product. In view of the limited number of identifiable and predictable siRNA, it would have been obvious to try making the claimed siRNA with a reasonable expectation of success. See MPEP 2143(I)E. Since Dharmacon teaches hyper-functional siRNA that comprises at least 12 consecutive nucleotides of SEQ ID NO: 20 or 44, one of ordinary skill in the art would reasonable expect producing the claimed double stranded nucleic acid molecules.
One of ordinary skill in the art would have been motivated to use at least one 2’-O-methyl modification and/or at least 2’-Fluoro modification, and at least one phosphorothioate modification to increase the bioavailability of the siRNA. A person of ordinary skill in the art would have been motivated to make a composition comprising the double stranded nucleic acid and a pharmaceutically acceptable to store or assist in delivery of the nucleic acid molecule to a cell.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 2 is rejected under 35 U.S.C. 103 as being unpatentable over Dharmacon (US 20050255487, cited on an IDS) taken with SILENSEED and GenBank NM_014299.2 as applied to claims 1, 3, and 7 above, and further in view of PHIO PHARMACUETICALS, CORP (WO 2019/0326191A1, published on 2/14/19, of record).
Below is an example of claimed asymmetric double stranded nucleic acid, sd-rxRna (Intasyl™). The passenger strand of 8-18 nucleotides in length would also have the single stranded region of 4-12 making the molecule comprises at least 12 contiguous nucleotides in each strand.
PNG
media_image1.png
116
521
media_image1.png
Greyscale
Dharmacon, Silenseed and GenBank NM_014299.2 do not specifically teach the siRNA has the structural limitations of instant claim 2.
However, PHIO PHARMACEUTICALS disclose making and using compositions comprising a self-delivering RNA (sd-rxRNA) for production of immunogenic compositions (abstract and pages 124-130). The sd-rxRNA technology is particularly suitable for controlling the differentiation process of cells, including T-cells and the production of therapeutic cells rich in desired phenotypes (page 12). Page 12 disclosed the advantages of using sd-rxRNA. The immunogenic composition is a host cell that is a T-cell and has one or more transgenes expressing high affinity T-cell receptor (TCR) and/or a chimeric antigen receptor (CAR). At least one nucleotide of the sd-rxRNA molecule has a 2’-O-methyl modification and/or 2’-fluoro modification, and at least one phosphorothioate modification. The composition is for controlling the differentiation process of T-cells during production of immunogenic compositions to enhance levels of excipient to store the nucleic acid or assist in delivery of the nucleic acid to a cell. desired subtypes of therapeutic T cells. The oligonucleotide in the host cell can target genes associated with signal transduction/transcription factors, epigenetic, metabolic and co-inhibitory/negative regulatory targets (page 2).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of DHARMACON, SILENSEED, and GenBank NM_014299.2 taken with PHIO Pharmaceuticals to make a sd-rxRNA comprising a sequence of at least 12 contiguous nucleotides of a sequence selected from instant SEQ ID NOs: 20 and/or 44, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching as a simple substitution to use sd-rxRNA to deliver the BRD4 siRNA to cancer cells in place of the delivery system taught by. See MPEP 2143(I)B. See page 12 of PHIO Pharmaceutical, which teaches the advantages of using sd-rxRNA. The sd-rxRNA taught by PHIO Pharmceuticals reads on the structural limitations of the asymmetric double stranded nucleic acid molecule recited in instant claim 2. At least one nucleotide of the sd-rxRNA molecule has a 2’-O-methyl modification and/or 2’-fluoro modification, and at least one phosphorothioate modification. A person of ordinary skill in the art would have been motivated to make a composition comprising the double stranded nucleic acid and a pharmaceutically acceptable.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Allowable Subject Matter
Claims 4, 9-11, 14, 17, 20, 23, 26, 31, 36, and 38-39 are in condition for allowance. See the reasons for allowance in the non-final rejection mailed on 7/22/25, which are hereby incorporated herein. The working examples on pages 83-84 of the specification teach that the method claims are enabled.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636