DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendments to the claims filed on November 12, 2025 have been received and entered. Claims 1-7, 9-12 have been amended, while claims 14-20 are newly added. Claims 1-20 are pending in the instant application.
Election/Restrictions
Newly submitted claim 11 is directed to an invention that is independent or distinct from the invention originally claimed for the following reasons: In the instant case, Inventions I (claims 1-10, 12-13, newly presented claims 14-20) and Invention II (claim 11) are related as product and process of use. The groups of inventions listed above do not relate to a single general inventive concept under PCT Rule 13.1 because, under PCT Rule 13.2, they lack the same or corresponding special technical features for the following reasons:
The invention of group I and II lack unity of invention because even though the inventions of these groups require the technical feature of an enhancer polynucleotide comprising a first enhancer polynucleotide consisting of a sequence having at least 80% sequence identity with a sequence of SEQ ID NO: 1 or 2, this technical feature is not a special technical feature as it does not make a contribution over the prior art of record as set forth in previous office action mailed on 05/12/2025 or Yoshida et al (WO2008069122, dated 06/12/2008). Yoshida teaches a polynucleotide as set forth in SEQ ID NO: 31 comprises nucleotide sequence that has 100% sequence identity to SEQ ID NO: 1. Therefore, the special technical feature linking the invention of group I does not contribute over prior art. Since applicant has received an action on the merits for the originally presented invention, this invention has been constructively elected by original presentation for prosecution on the merits. Accordingly, claim 11 is withdrawn from consideration as being directed to a non-elected invention. See 37 CFR 1.142(b) and MPEP § 821.03.
To preserve a right to petition, the reply to this action must distinctly and specifically point out supposed errors in the restriction requirement. Otherwise, the election shall be treated as a final election without traverse. Traversal must be timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are subsequently added, applicant must indicate which of the subsequently added claims are readable upon the elected invention.
Should applicant traverse on the ground that the inventions are not patentably distinct, applicant should submit evidence or identify such evidence now of record showing the inventions to be obvious variants or clearly admit on the record that this is the case. In either instance, if the examiner finds one of the inventions unpatentable over the prior art, the evidence or admission may be used in a rejection under 35 U.S.C. 103 or pre-AIA 35 U.S.C. 103(a) of the other invention. However, in the event of rejoinder, the requirement for restriction between the product/apparatus claims and the rejoined process claims will be withdrawn, and the rejoined process claims will be fully examined for patentability in accordance with 37 CFR 1.104. Thus, to be allowable, the rejoined claims must meet all criteria for patentability including the requirements of 35 U.S.C. 101, 102, 103 and 112. Until all claims to the elected product/apparatus are found allowable, an otherwise proper restriction requirement between product/apparatus claims and process claims may be maintained. Withdrawn process claims that are not commensurate in scope with an allowable product/apparatus claim will not be rejoined. See MPEP § 821.04. Additionally, in order for rejoinder to occur, applicant is advised that the process claims should be amended during prosecution to require the limitations of the product/apparatus claims. Failure to do so may result in no rejoinder. Further, note that the prohibition against double patenting rejections of 35 U.S.C. 121 does not apply where the restriction requirement is withdrawn by the examiner before the patent issues. See MPEP § 804.01.
Claim 11 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Priority
This application is a 371 of PCT/JP2020/042283 filed on 11/12/2020, which claims priority from a foreign application JP 2019-206823 filed on 11/15/2019.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e).
Failure to provide a certified translation may result in no benefit being accorded for the non-English application.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 11/12/2025, 11/18/2025 and 01/26/2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered by the examiner.
Claims 1-10, 12-20 are under consideration.
Withdrawn-Claim Rejections - 35 USC § 112
Claims 1, 3-13 were rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Applicant’s amendment to the claims deleting the parenthesis and replacing the phrase “represented by SEQ ID NO:” with --as set forth in SEQ IDNO-- in the claim obviate the basis of the rejection. Therefore, the previous rejections of claims 1-13 are hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot.
Maintained-Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 2 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 2 are vague and infinite to the extent, scope of sequence(s) represented by SEQ ID No is unclear. ... The claims are indefinite because it is unclear as to how similar or dissimilar sequences would be represented by SEQ ID numbers as set forth in claim 2 and 12. Claims 6. 8-11 and 13 are included in the rejection because they directly or indirectly depend from the rejected base claim 1. Appropriate correction is required.
Response to arguments
In response to applicant’s argument that recitation of phrase represented by has been replaced is not found persuasive as claim 2 continue to recite the phrase “sequence represented by” and therefore, the rejection is maintained for the reasons of record.
Withdrawn-35 USC § 102-in modified form
Claims 1-5, 7-13 remain rejected and claims 14-under 35 U.S.C. 102(a)(1) as being anticipated by Takashima et al (JP2014084764, dated 05/07/2015, IDS). Applicant’s amendments to the base claim excluding the scope of enhancer obviates the basis of the rejection. Therefore, the previous rejections of claims are hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot. The claims are however subject to new rejections over the prior art of record, as set forth below.
New-Claim Rejections - 35 USC § 102- necessitated by amendments
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-3, 6 and 14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Yoshida et al (WO2008069122, dated 06/12/2008).
Claims are directed to an enhancer polynucleotide comprising: a first enhancer polynucleotide consisting of: a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1. Likewise, recitation of any sequence consists of a sequence having 70% or 80% or more identity with a sequence as set forth in SEQ ID NO: is interpreted sequence homology of any sequence that is 70% or 80% identical with any sequence as set forth in SEQ ID NO. (entire length or part of sequence set forth in SEQ ID NO).
Claim interpretation: Recitation of term “an enhancer polynucleotide comprising a first enhancer polynucleotide” is interpreted as synonymous to "including," "containing," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Further, recitation of a first enhancer polynucleotide consisting of a sequence having 80% or more identity with any sequence as set forth in SEQ ID NO: 1 is interpreted to encompass any fragment of a polynucleotide consisting of any sequence having at least 80% sequence identity with any sequence as set forth in SEQ ID NO: 1 or 2.
With respect to claims 1-3, 14, Yoshida teaches a polynucleotide as set forth in SEQ ID NO: 31 comprises nucleotide sequence that has 100% sequence identity to SEQ ID NO: 1 and it consist of a sequence having at least 70% identity with any sequence set forth in SEQ ID NO:4.
ESULT 1
NASEQ2_03172026_175135
Query Match 100.0%; Score 12; DB 1; Length 28;
Best Local Similarity 100.0%;
Matches 12; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGGACAATGAGG 12
||||||||||||
Db 16 TGGACAATGAGG 27
With respect to claim 6, the polynucleotide is 28 nucleotide long that is less than 200 nucleotides.
Accordingly, Yoshida anticipates claims 1-3, 6 and 14.
Maintained-Claim Rejections - 35 USC § 103-in modified form
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-10, 17-20 are rejected under 35 U.S.C. 103 as being unpatentable over Takashima et al (JP2014084764, dated 05/07/2015, IDS) and Wang (Circulation Research, 2000, 86, 478-484, IDS)/Yoshida et al (JBC, 2016, 291 25578-25590).
Claim interpretation: Recitation of term “an enhancer polynucleotide comprising a first enhancer polynucleotide” is interpreted as synonymous to "including," "containing," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Further, recitation of a first enhancer polynucleotide consisting of a sequence having 80% or more identity with any sequence as set forth in SEQ ID NO: 1 is interpreted to encompass any fragment of a polynucleotide consisting of any sequence having at least 80% sequence identity with any sequence as set forth in SEQ ID NO: 1 or 2. The enhancer is not limited by any size and includes large DNA regions. Likewise, recitation of any sequence consists of a sequence having 70% or 80% or more identity with a sequence as set forth in SEQ ID NO: is interpreted sequence homology of any sequence that is 70% or 80% identical with any sequence as set forth in SEQ ID NO. (entire length or part of sequence set forth in SEQ ID NO).
Claim 5 is product by process limitation (MPEP2113).
With respect to claims 1-3, Takashima teaches a CR9 element polynucleotide comprising a polynucleotide as set forth in SEQ ID NO: 1 having 100% sequence identity to SEQ ID NO: 2, wherein said CR9 polynucleotide respond to heart failure (see sequence search results and SEQ ID NO: 1 and claim 4 of ‘764).
Qy 1 TGGGCAATGAGG 12
||||||||||||
Db 331 TGGGCAATGAGG 342
Regarding claims 2-3, 17-18, 20, teaches that the CR9 element polynucleotide comprises polynucleotide sequence as set forth in SEQ ID NO: 1 having 100% sequence identity to SEQ ID NO: 7 is a sequence of SEQ ID NO: 3 (see SEQ ID NO: 1 of ‘764).
Query Match 100.0%; Score 60; DB 1; Length 650;
Best Local Similarity 100.0%;
Matches 60; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGGAAGCGCTCCGGCGATCCTGGGCAATGAGGTCAGCAGGACCAATGGGACCCTCCACCT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 311 AGGAAGCGCTCCGGCGATCCTGGGCAATGAGGTCAGCAGGACCAATGGGACCCTCCACCT 370
With respect to claims 4-5, 19, Takashima teaches that the CR9 element polynucleotide comprises polynucleotide sequence as set forth in SEQ ID NO: 1 that has 100% sequence identity to SEQ IDNO: 8 (See SEQ ID NO: 1 of ‘764).
Query Match 100.0%; Score 60; DB 1; Length 650;
Best Local Similarity 100.0%;
Matches 60; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 191 GGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAA 250
Regarding claim 5, 7-8, Takashima teaches that CR9 element polynucleotide as set forth in SEQ ID NO: 1 that is represented by both SEQ ID NO: 2 and SEQ ID NO: 8 or a reverse complement thereof. Takashima further teaches that the enhancer polynucleotide comprising a polynucleotide represented by SEQ ID NO: 11, wherein the enhancer polynucleotide responds to heart failure. (see SEQ ID NO: 1 and claim 4 of ‘764, also see claim interpretation of term represented by above).
With respect to claims 9-11, Takashima teaches an expression vector comprising a polynucleotide containing a promoter sequence and the enhancer polynucleotide as set forth in SEQ ID NO: 1, wherein the polynucleotide containing a promoter sequence and the enhancer polynucleotide are operably linked so that the enhancer polynucleotide enhances the transcriptional activity of the promoter polynucleotide (para. 18-20, claims in ‘764). Claim 10 is included in the rejection because the claim merely recites the intended use of the composition. To the extent, the expression of vector of claim 9 is structurally similar to one claimed in the instant application, it is capable for use in gene therapy. It is further noted that that the polynucleotide in the expression vector is expressible (see claims para. 3, 18-20 and 41). Claim 11 is included in the rejection because it merely recites intended use limitation.
Regarding claims 12 and 13, Takashima teaches a polynucleotide comprising a sequence that binds to a polynucleotide represented by SEQ ID NO: 1 that would bind to the claimed complementary sequence of SEQ ID NOL:2 (see claims in ‘764). Please note that the term kit is not accorded any patentable weight, as it is directed to a composition according to claim 12 of the invention. With regard to claim 13, the limitation that the kit contains instructions, the inclusion of instructions is not considered to provide a patentable limitation on the claims because the instructions merely represent a statement of intended use in the form of instructions in a kit. See In re Ngai, 367 F.3d 1336, 70 U.S.P.Q.2d 1862 (Fed. Cir. 2004) (holding that an inventor could not patent known kits by simply attaching new set of instructions to that product).
Takashima differs from claimed invention by not disclosing wherein the total length of the enhancer polynucleotide is 200 nucleotides or less.
However, before the effective filing date of instant application, it was routine to provide assay regulatory sequence bashing to determine minimum regulatory sequence. For instance, Takashima teaches testing fragments of regulatory sequence to determine minimum sequence that could function as regulatory sequence (see page 14). Likewise, Wang et al teaches generating site-directed mutants and investigate for their regulatory activities in both cultured neonatal cardiomyocytes and transgenic mice (see figures 1, 3 and 4). This is further evidenced by Yoshida who reported a method of identifying a region within intron 2 that is responsible for AT2R induction during myoblast differentiation by generating a series of luciferase reporter vectors with the minimal promoter and truncated AT2R intron 2 (Fig. 5). The results shows that the +691/+1080 and +1081/+1468 regions do not have enhancer activity, whereas +286/+690 showed significant increase in luciferase activity during myoblast differentiation. Deletion of +1081/+1468 region increased luciferase activity, suggesting that the +1081/+1467 region has a repressor activity (see fig. 5).
Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to modify the CR9 enhancer sequence of Takashima by truncating to identify the minimal region having enhancer region using the method disclosed in Wang/Yoshida, as a matter of design choice, in the method of identifying the minimal sequence having enhancer activity, as instantly claimed, with a reasonable expectation of success, before the effective filing date of instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do deletion/mutation analysis to identify multiple transcription factor binding sites within the CR9 region having the activity. One of skill in the art would have been expected to have a reasonable expectation of success in identifying the minimum region with CR9 enhancer having the expression control activity because the art teaches successfully reported generating site-directed mutants to investigate for their regulatory activities in both cultured cells. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Claims 1, 12-13 are rejected under 35 U.S.C. 103 as being unpatentable over Takashima et al (JP2014084764, dated 05/07/2015, IDS) and Wang (Circulation Research, 2000, 86, 478-484, IDS)/Yoshida et al (JBC, 2016, 291 25578-25590) as applied above and further in view of Du et al (Cell Research (2015) 25:877-880)/Li (Nature Communication, 2020, 11:485. 1-16).
The teaching of Takashima, Wang/Yoshida have been described above and relied in same manner here. While Takashima teaches a polynucleotide comprising a sequence that binds to a polynucleotide represented by SEQ ID NO: 1 that would bind to the claimed complementary sequence of SEQ ID NOL:2 (see claims in ‘764) but differs from claimed invention by not explicitly disclosing a polynucleotide comprising an sgRNA sequence that binds to an enhancer polynucleotide consisting of the sequence represented by SEQ ID NO: 2.
However, before the effective filing date of instant application, it was routine to design sgRNA sequence that binds to an enhancer polynucleotide as evident from the teaching of Du. Du teaches sequence-specific targeting of IFNB1 cis-elements by dCas9/sgRNA (see fog. 1S1a). Du further teaches dCas9/sgRNA to target both promoter and cis element (S2a). Likewise, Li teaches development of enCRISPRa system for enhancer activation by engineering the enhancer targeting dual-activator systems using a single effector dCas9 activators to a known MYOD enhancer using sequence specific sgRNAs in HEK293T cells (see page 2, col. 2, para. 2-3 fig. 1b).
Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to modify the CR9 enhancer sequence of Takashima by truncating to identify the minimal region having enhancer region using the method disclosed in Wang/Yoshida and design gRNA sequence that binds to said enhancer polynucleotide using the method disclosed in Du/Li, as a matter of design choice, to design sgRNA sequence that binds to an enhancer polynucleotide, as instantly claimed, with a reasonable expectation of success, before the effective filing date of instant invention. Said design choice amounting to combining prior art elements according to known methods to yield predictable results. Please note that the term kit in claim 13 is not accorded any patentable weight, as it is directed to a composition according to claim 12 of the invention. One of ordinary skill in the art would be motivated to do so in order to use sgRNA for activation and/or repression of an endogenous enhancer region. Absent evidence of any unexpected result, one of skill in the art would have been expected to have a reasonable expectation of success in designing gRNA that binds to an enhancer polynucleotide as prior art successfully reported designing gRNA that binds enhancer region as evident from Du/Li. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Response to arguments
Applicant disagree with the rejection arguing provide no guidance whatsoever that would direct one of ordinary skill in the art to shorten Takashima's CR9 enhancer sequence to a length needed to facilitate entry into a viral vector while retaining a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1 or 2. At best, the selection of the specific enhancer sequences recited in the pending claims can only be based upon hindsight recognition. "In such circumstances, where a defendant merely throws metaphorical darts at a board filled with combinatorial prior art possibilities, courts should not succumb to hindsight claims of obviousness. Applicants’ arguments have been fully considered, but are not found persuasive.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1 or 2 or specific enhancer sequences recited in the pending claims or a length needed to facilitate entry into a viral vector) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). It is emphasized that independent claims are directed to an enhancer polynucleotide comprising: a first enhancer polynucleotide consisting of: a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1, or a polynucleotide consisting of a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 2. In the instant case, recitation of term “an enhancer polynucleotide comprising a first enhancer polynucleotide” is synonymous to "including," "containing," is inclusive or open-ended and does not exclude additional sequence. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Therefore, applicant’s argument of selection of the specific enhancer sequences is flawed as claimed enhancer is not limited to any specific length or any specific enhancer sequences as argued by the applicant. Absent any specific enhancer sequence or any specific length, it would have been obvious to one of ordinary skill in the art to modify the CR9 enhancer sequence containing SEQ ID NO: 1 or 2 as disclosed in Takashima by truncating to identify the minimal region having enhancer region using the method disclosed in Wang/Yoshida One of ordinary skill in the art would be motivated to do deletion/mutation analysis to identify multiple transcription factor binding sites within the CR9 region having the activity. One of skill in the art would have been expected to have a reasonable expectation of success in identifying the minimum region with CR9 enhancer having the expression control activity because the art teaches successfully reported generating truncation mutants to investigate for their regulatory activities in both cultured cells.
Applicant continue to argue that claimed subject matter provides unexpected results in part relying on the Experimental Example 2 showing that the enhancer activity of constructs in which mouse CR9 (an enhancer polynucleotide consisting of a 650 bp sequence described in Takashima) was modified to delete 30 bp. In these constructs, each enhancer was bound to the BNP promoter, and the luciferase gene, as a reporter gene, was bound downstream of the BNP promoter. See Specification, II [0101]-[0116], Figures 4-6. Applicant continue to argue that enhancer activity for the BMP promoter-the recited nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 has stronger enhancer activity for the BMP promoter than the CR9 sequence. Applicant further provide Annex 1and Annex 2 to show that MmCR9 120 bp), that was bound upstream of the BNP promoter-luciferase gene and inserted into an AAV6 vector showed strong signals only in the heart, while CR9 demonstrated non-specific signal in brain and heart. Applicants’ arguments have been fully considered, but are not found persuasive.
In response, it is noted that unexpected results have to be commensurate with the scope of the invention. "Whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980)." Example 2 and 6 (page 26) discloses enhancing the activity of BNP promoter, the enhancer activity of the enhancer having both of the 191-250 region and the 311-370 region (SEQ ID NO: 11) is stronger that CP9 (650 bp). The claims are not so limited.
Maintained-Claim Rejections - 35 USC § 112-written description-in modified form
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-10, 12-19 and 20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claim embraces a genus of enhancer polynucleotide comprising a first enhancer polynucleotide consisting of a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1, or a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 2 wherein the enhancer polynucleotide responds to heart failure. Dependent claim limits the sequence consist of a sequence as set forth in SEQ ID NO: 3 or enhancer polynucleotide further comprising a second enhancer polynucleotide consisting of a sequence having 90% or more identity with a sequence as set forth in SEQ ID NO: 5 or 8. Claims are also directed to an enhancer polynucleotide comprising a polynucleotide consisting of any sequence as set forth in SEQ ID NO: 10 or SEQ ID NO: 11, wherein the enhancer polynucleotide responds to heart failure. Claims are also directed to a composition for preventing and/or treating heart failure, comprising any polynucleotide comprising an sgRNA sequence that binds to a polynucleotide consisting of the sequence as set forth in SEQ ID NO: 1, the sequence as set forth in SEQ ID NO: 2, the sequence as set forth in SEQ ID NO: 4, the sequence as set forth in SEQ ID NO: 5, the sequence as set forth in SEQ ID NO: 7 or the sequence as set forth in SEQ ID NO: 8.
The specification contemplated enhancer polynucleotide comprises any polynucleotide consisting of a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, and includes an enhancer polynucleotide that responds to heart failure. The claims as written encompass any fragment of a polynucleotide consisting of any sequence having at least 80% sequence identity with any sequence as set forth in SEQ ID NO: 1 or 2 or 4 or 5. The recitation of an enhancer polynucleotide comprising further broaden the scope of size of first and second enhancer as required by the claims.
Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that ''applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed.'' Vas-cath Inc. v. Mahurkar, 19USPQ2d at 1 117. The specification does not ''clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.'' Vas-cath Inc. v. Mahurkar, 19USPQ2d at 1116.
The specification teaches identification of important region in the CR element as set forth in SEQ ID NO: 12 using a vector having an enhancer region obtained by deleting a part of the 650 bp in units of 30 bp (see fig. 5). Results of the luciferase assay as shown in Fig. 6 and Fig. 7 shows that deletion of region 191-250 (SEQ ID NO: 8) or 311-370 (SEQ ID NO: 7) had reduced reactivity to Phenylephrine. The enhancer activity of the enhancer having both of the 191-250 region and the 311-370 region is stronger. In addition, the length of nucleotide of the enhancer having the 191-250 region and the 311-370 region is shorter than that of the CR9 650 bp, but its enhancer activity is higher than that of the CR9 650 bp (see para. 116 of the specification
The specification further discloses that the total length of the enhancer polynucleotide responding to heart failure is preferably 200 nucleotides or less, 150 nucleotides or less, 130 nucleotides or less, 125 nucleotides or less, or 120 nucleotides or less when the length of the enhancer polynucleotide is expressed by the number of nucleotides in a single strand. Thus, claims as written encompass variant of CR9 enhancer element.
The DNA sequences of enhancer sequences, other than sequence as set forth in SEQ ID NO: 1, 2, 3, 4, 7, 8, 10 or 11 encompassed within the genus of enhancer sequence have not been disclosed for the contemplated biological activity. The term sequence a polynucleotide consisting of a sequence having at least 80% sequence identity with a sequence as set forth in SEQ ID NO: 1 or 2 or 4 or 5 or 7 or 8 read on a fragment that is set forth in SEQ ID NO. The specification does not teach any sequence that has addition, substitution and/or deletion in SEQ ID NO: 1, 2-3, 5, 7-8, 10 and 11 and also show contemplated biological activity. Li et al identified nucleotides capable of disrupting binding of transcription factors and deactivating enhancers if mutated (dubbed candidate killer mutations or KMs) in HepG2 enhancers. On average, approximately 11% of enhancer positions are prone to KMs. It is further disclosed that a comparable number of enhancer positions are capable of creating de novo binding sites via a single-nucleotide mutation (dubbed candidate restoration mutations or RSs). Both KM and RS positions are evolutionarily conserved and tend to form clusters within an enhancer. We observed that KMs have the most deleterious effect on enhancer activity (see abstract, Li et al Molecular Biology and Evolution, Volume 32, Issue 8, August 2015, 2161–2180, art of record). In the instant case, claims are drawn to variants encompass an innumerable number of sequences with no relevance to responds to heart failure (see attached sequence search results). The specification fails to provide the relevant identifying characteristics of any of the fragments or variant that is broadly encompassed by various region as set forth in SEQ ID NO: 1, 2, 4, 5, 7 or 8 having addition, substitution or deletion of nucleotide that would exhibit contemplated biological effect other than SEQ ID NO: 7-8, 10 and 11 incorporated in an expression vector and a promoter downstream of said enhancers showing contemplated biological activity. Additionally, the specification lacks the possession of any sgRNA or crRNA targeting any polynucleotide consisting of the sequence as set forth in SEQ IDNO: 1, 2 4, -5, 7 and 8 for preventing and/or treating heart failure. There specification is silent on providing any evidence of preventing and/or treating heart failure using any of the sgRNA targeting CR9 element (SEQ ID NO: 12 or 13). There is simply no evidence that increasing CR9 expression would result in a therapeutic effect. It is emphasized that mere presence of gRNA or crRNA would have no therapeutic effect.
The skilled artisan cannot envision the detailed structure of other all the other fragments, variant showing the contemplated biological activity, and therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity/simplicity of the structure and/or methods disclosed in specification.
Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics. Inc., 48 USPQ2d 1641, 1646 (1998). In the instant case, the claimed embodiments of genus of enhancer sequence comprising a polynucleotide that are represented by SEQ ID NO: 1, 2, 4, 5, other than SEQ ID NO: 7, 8, 10 or 11 encompassed within the genus of enhancer sequences lack a written description for the contemplated biological activity. The specification discloses that the enhancer polynucleotide may contain substitution, insertion, and/or deletion of about 1 or 2 nucleotides out of the 12 nucleotides at any of the 12 nucleotides. The specification fails to describe what enhancer sequence molecules fall into this genus. The skilled artisan cannot envision the detailed chemical structure of the encompassed variant enhancer sequences, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen lnc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991).
One cannot describe what one has not conceived. See Fiddes v. Baird, 30 UsPQ2d 1481, 1483. In Fiddes, claims directed to mammalian FGF'S were found to be unpatentable due to lack of written description for that broad class. The specification provided only the bovine sequence.
In view of the above considerations one of skill in the art would not recognize that applicant was in possession of the necessary common features or attributes possessed by member of the genus of enhancer sequences, other than the polynucleotide sequence as set forth in SEQ ID NO: 7 8, 10 and 11 incorporated in an expression vector and a promoter downstream of said enhancers showing contemplated biological activity..
Therefore, Applicant was not in possession of the genus of enhancer sequence as broadly encompassed by the claims. University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 held that to fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that ''the inventor invented the claimed invention.''
Response to arguments
Applicant disagree with the rejection arguing SEQ ID NO: 1 and 2 both are short (12 nucleotide in length) sequence and therefore one of ordinary skill in the art would be able to "immediately envisage" the different possible species of nucleotide sequences having 80% or more identity with a sequence as set forth in SEQ ID NO: 1 or 2. Applicant continue to argue As documented in the specification, the inventors were the first to identify the correlation between the nucleotide sequences as set forth in SEQ ID NOs: 1 and 2 (the CR9 "core 12bp" structure) and the function of the sequences in enhancing expression of the atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) genes in response to heart failure. See, e.g., Specification, Experimental Example 2, Я [0101]-[0106], Figures 6-7. Thus, the specification details the structure-function relationship pertinent to the claimed enhancer polynucleotide's ability to respond to heart failure. Additionally, one of ordinary skill in the art would recognize that this pattern extends to sequences having 80% or more identity with a sequence as set forth in SEQ ID NO: 1 or 2. The sequences of the CR9 region for human, mouse, and other species are publicly available. A simple comparison of the sequences quickly reveals the high degree of conservation across species for the SEQ ID NO: For example, the attached document, "Identity of HsCR9 Core 12bp (SEQ ID NO: 1) Sequence in Various Mammals," shows the alignment of SEQ ID NO: 1 (amino acids 325 to 336 of the human CR9 sequence) and SEQ ID NO: 2 (amino acids 331 to 342 of the mouse CR9 sequence) with the corresponding regions of the CR9 sequence in various animals. Applicants’ arguments have been fully considered, but are not found persuasive.
As an initial matter, it should be noted that Examiner explicitly stated that recitation of transitional phrase “comprising” and “a” is broad and encompasses genus of sequences during the interview held on October 1, 2025. It is emphasized that claims as presented are not limited to a sequence that is a short (12 nucleotide in length) sequence as argued by the applicant. Independent claim 1 is drawn to any enhancer polynucleotide comprising: any first enhancer polynucleotide consisting of: a sequence having 80% or more identity with a(ny) sequence as set forth in SEQ ID NO: 1. The transitional phrase comprising is synonymous to "including," "containing," is inclusive or open-ended and does not exclude additional sequence (see MPEP2111.03). Thus, contrary to applicant’s argument that claimed enhancer polynucleotide is not limited to short 12 nucleotide sequence. Further, the first core enhancer recites a phrase consisting of a sequence having 80% or more identity with a sequence as set forth in SEQ ID NO: 1. The claims as written read on any sequence having 80% or more identity with any sequence set forth in SEQ ID NO: 1 that would include a sequence that has at least 80% sequence identity to any sequence (fragments) as set forth in SEQ ID NO: 1. Independent claims encompasses sequences of any length or large DNA regions that are merely defined as comprising a short sequence (12 mer) with a limited homology to SEQ ID NO 1 or 2 that responds to heart failure The enhancer sequence is claimed as isolated and not in association with a promoter or part of an expression vector. The 12 mer enhancer core sequence has not been characterized as an isolated polynucleotide having the contemplated biological effect. The enhancer having the desired function is only supported for the 120 bp sequence used in connection with the promoter as part of an expression vector.
Further, if applicant intend to limit the scope to a sequence having 80% or more identity with 12 nucleotide core enhancer sequence as disclosed in the instant specification, applicant should consider amending claim to a sequence having 80% or more identity with the nucleotide sequence of SEQ ID NO: 1. In view of foregoing, it is apparent that the enhancer polynucleotide comprising a first enhancer polynucleotide consisting of: a sequence having 80% or more identity with a sequence set forth in SEQ ID NO: 1 or 2 or 10 or 11 (claims 1, 2, 7) read on a fragment that is set forth in SEQ ID NO. The specification discloses that the enhancer polynucleotide may contain substitution, insertion, and/or deletion of about 1 or 2 nucleotides out of the 12 nucleotides at any of the 12 nucleotides (see para. 16). The specification does not teach any sequence that has addition, substitution and/or deletion in SEQ ID NO: 1, 2-3, 5, 7-8, 10 and 11 and also show contemplated biological activity. Claims are drawn to variants encompass an innumerable number of sequences with no relevance to responds to heart failure (see attached sequence search results). The specification fails to provide the relevant identifying characteristics of any of the fragments or variant that is broadly as set forth in the various region as set forth in SEQ ID NO: 1, 2, 4, 5, 7 or 8 having addition, substitution or deletion of nucleotide that would exhibit contemplated biological effect other than SEQ ID NO: 7-8, 10 and 11 incorporated in an expression vector and a promoter downstream of said enhancers showing contemplated biological activity. The claimed enhancer is not limited by any size and includes large DNA regions comprising variant of SEQ ID NO:1 or 2. Independent claims encompass enhancer sequences of any length merely defined as comprising a short sequence with a limited homology to SEQ ID NO 1 or 2. Said sequence must be an enhancer that responds to heart failure. However, said enhancer having the desired function is only supported for the 120 bp sequence comprising the nucleotide sequence of SEQ ID: 7-8, 10 and 11 operably linked to a promoter is possessed by the applicant before the effective filing date of instant application.
On pages 10-11 of the applicant’s argument, applicant argues that the inventors have shown in the Experimental Examples that enhancer activity can be achieved by introducing the CR9 Core 12bp from outside the genome. Applicant assert that based on the information provided in the specification and the common general knowledge, that stimulation of the endogenous enhancer region (i.e., the CR9 Core 12bp) by sgRNA or crRNA would enhance its activity, thereby preventing and/or treating heart failure. Applicants’ arguments have been fully considered, but are not found persuasive.
In response, it is noted that a 12 mer regulatory sequence as set forth in claims is too short for specific targeting> the attached sequence search analysis for core sequence shows multiple hits including for primer sequences suggesting it is likely to binds multiple unintended sites that would results in off target effects. It is emphasized that CRISPR targeting relies on at least 20bp guide sequence to achieve sufficient specificity. It is in this context, previous office action explicitly stated the specification lacks the possession of any sgRNA or crRNA targeting any polynucleotide consisting of the sequence as set forth in SEQ IDNO: 1, 2 for preventing and/or treating heart failure. There specification is silent on providing any evidence of preventing and/or treating heart failure using any of the sgRNA targeting CR9 element (SEQ ID NO: 12 or 13). There is simply no evidence that increasing CR9 expression would result in a therapeutic effect. It is further emphasized that mere presence of gRNA or crRNA would have no therapeutic effect.
Therefore, in view of the fact patterns of the instant case, and the ground of rejection outlined by the examiner, applicants' arguments are not compelling and do not overcome the rejection of record.
Conclusion
No claims allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANOOP K SINGH/Primary Examiner, Art Unit 1632