DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
2. This action is in response to the papers filed January 27, 2026. Applicant’s remarks and amendments have been fully and carefully considered but are not found to be sufficient to put the application in condition for allowance. Any new grounds of rejection presented in this Office Action are necessitated by Applicant's amendments. Any rejections or objections not reiterated herein have been withdrawn. This action is made FINAL.
Claims 1-5 are currently pending and have been examined herein.
Response To Arguments- 37 CFR 1.105
3. In response to the request under 37 CFR 1.105, the Applicants have provided arguments and an email correspondence attached as Appendix 1.
Applicants argue that the email demonstrates that Shoffner ((2018), New strategies for RNA crystallization and applications to the pri-miRNA processing machinery. UCLA. ProQuestID: Shoffnerucla_0031D_16615 was first described in a printed publication on March 23, 2020. The publication was provided on the ProQuest database. The thesis was under a delayed release and was not placed in a library where it was indexed, cataloged and Shelved until March 23, 2020. Aside from the delayed release (i.e., delayed until March 23, 2020), there was not a policy of confidentiality or an agreement to remain confidential within the organization regarding the thesis.
Applicants arguments and Appendix 1 have been fully considered. Applicants arguments and the email, help to clarify when the dissertation was publicly available from ProQuest and a library shelf, but it does not address when the dissertation was publicly available from eScholarship.org, which is where the Examiner obtained the dissertation. It is noted that eScholarship Publishing is a comprehensive open access publishing program for the University of California academic community. Based on the screenshots shown below, it appears that the dissertation was publicly available as of March, 2018 from eScholarship.org.
PNG
media_image1.png
1022
1228
media_image1.png
Greyscale
PNG
media_image2.png
1026
930
media_image2.png
Greyscale
The rejections based on this dissertation will be maintained until it is clarified when the dissertation was publicly available from eScholarship.org. Applicants may wish to provide a declaration containing this information.
Claim Rejections - 35 USC § 101
4. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 2-3 are rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exceptions without significantly more. The claims have been evaluated using the 2019 Revised Patent Subject Matter Eligibility Guidance (see Federal Register Vol. 84, No. 4 Monday, January 7, 2019).
Step 1: The claims are directed to the statutory category of a composition of matter.
Step 2A, prong one: Evaluate Whether the Claim Recites a Judicial Exception
Claim 2 is drawn to the composition of claim 1 further comprising an agent that binds to the ribonucleic acid. Claim 3 states that the agent is a polynucleotide that hybridizes to the ribonucleic acid. The markedly different characteristics analysis has been used to determine if the nature based product (the polynucleotide) is an exception. The nature based product (the polynucleotide) has been compared to its natural counterparts. There is no indication that the polynucleotide has any characteristics that are different from naturally occurring nucleic acids. There is no difference in function, structure, or other properties. It is noted that the polynucleotide is recited as being in a “composition” with the ribonucleic acid of claim 1. However the claims do not require that the polynucleotide interacts with the ribonucleotide in the composition. There is no indication that the polynucleotide being present in the “composition” with the ribonucleic acid of claim 1 changes the function, structure, or other properties of the polynucleotide. Because the claimed polynucleotide does not have markedly different characteristics, it is a product of nature exception.
Step 2A, prong two: Evaluate Whether the Judicial Exception Is Integrated Into a Practical Application
In addition to the judicial exception, the claims recite that the composition comprises the ribonucleic acid having at least 90% to SEQ ID NO: 1 wherein residues 14-17 (GAAA) are replaced with a heterologous segment of nucleic acid between 4-33 nucleotides in length.
The claims do NOT recite additional steps or elements that integrate the recited judicial exceptions into a practical application of the exception(s). For example, the claims do not practically apply the judicial exception by including one or more additional elements that the courts have stated integrate the exception into a practical application:
An additional element reflects an improvement in the functioning of a computer, or an improvement to other technology or technical field;
An additional element that applies or uses a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition;
An additional element implements a judicial exception with, or uses a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim;
An additional element effects a transformation or reduction of a particular article to a different state or thing; and
An additional element applies or uses the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological
environment, such that the claim as a whole is more than a drafting effort designed to monopolize the exception.
Step 2B: Evaluate Whether the Claim Provides an Inventive Concept
In addition to the judicial exception, the claims recite that the composition comprises the ribonucleic acid having at least 90% to SEQ ID NO: 1 wherein residues 14-17 (GAAA) are replaced with a heterologous segment of nucleic acid between 4-33 nucleotides in length. However at the time of the invention the claimed ribonucleic acid was known in the art. The prior art of Shoffner ((2018). New strategies for RNA crystallization and applications to the pri-miRNA processing machinery. UCLA. ProQuest ID: Shoffner_ucla_0031D_16615. Merritt ID: ark:/13030/m5km484g. Retrieved from https://escholarship.org/uc/item/3m53f2wz) discloses the ribonucleic acid of claim 1 (see pages 56-57, Fig 1 on Page 61). Thus, the claims as a whole do not amount to significantly more than a “product of nature” by itself, and the claims do not quality as eligible subject matter.
Response To Arguments
5. In the response the Applicants traversed the rejection under 35 USC 101. In the response the Applicants argue that claims 2-3 depend from claim 1, which the examiner acknowledges is acceptable subject matter under 35 USC 101. The subject matter in claim 1 renders these dependent claims acceptable subject matter under 35 USC 101.
This argument has been fully considered but is not persuasive. Claim 1 is not a judicial exception because the recited ribonucleic acid cannot be found in nature. However Claims 2 and 3 recite nature based products that are not markedly different from their natural counterparts and thus are “product of nature” exceptions. In addition to the products of nature, the composition comprises the ribonucleic acid recited in claim 1. The ribonucleic acid does not include any additional features that add significantly more to the exception. Further the ribonucleic acid does not add an inventive concept. Thus the rejections are maintained.
Claim Rejections - 35 USC § 102
6. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-5 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Shoffner ((2018). New strategies for RNA crystallization and applications to the pri-miRNA processing machinery. UCLA. ProQuest ID: Shoffner_ucla_0031D_16615. Merritt ID: ark:/13030/m5km484g. Retrieved from https://escholarship.org/uc/item/3m53f2wz).
Regarding Claim 1 Shoffner teaches that to solve the structures, we started with the YdaO c-di-AMP riboswitch structure from Thermoanaerobacter pseudethanolicus (PDB ID: 4QK8) and removed residues 14-17 from the model, corresponding to the GAAA tetraloop on the P2 stem of the riboswitch. We then performed a rigid body fit of the model to data using Phenix [27]. This produced an excellent initial model with Rwork < 30%. We then inspected the electron density map in region of the P2 stem. For all RNAs, additional density for the missing base-pair and loop could clearly be seen in the 2Fo-Fc and difference maps. We then modeled in the missing residues in Coot [28]. In cases where the density was unclear, we stopped modeling with an incomplete loop and performed an additional round of coordinate, ADP, and TLS parameter refinement with Phenix. This typically revealed additional density for the missing residues. Once the loop was completely modeled, we performed subsequent rounds of refinement and manual adjustment as above until reasonable R factors and model geometry were obtained (pages 56-57). Shoffner further discloses the secondary structure of the YdaO riboswitch (Fig 1D)
PNG
media_image3.png
298
260
media_image3.png
Greyscale
Thus Shoffner teaches a composition of matter comprising a ribonucleic acid having an at least 90% sequence identity to: GUUGCCGAAUCCGAAAGGUACGGAGGAACCGCUUUUUGGGUUAAUCUGCAGUGAAGCUGCAGUAGGGAUACCUUCUGUCCCGCACCCGACAGCUAACUCCGGAGGCAAUAAAGGAAGGAG (SEQIDNO:1), wherein: residues 14-17 (GAAA) of the ribonucleic acid are replaced with a heterologous segment of nucleic acids that is between 4 and 33 nucleotides in length.
Regarding Claims 2-3 Shoffner teaches a primer sequence GGTACGGAGGAACCGCTTTTTG that hybridizes to the RNA (page 54).
PNG
media_image4.png
98
430
media_image4.png
Greyscale
Regarding Claims 4-5 Shoffner teaches that to determine if replacing the GAAA tetraloop with a pri-miRNA stem-loop would disrupt the folding of the riboswitch, we generated fusions between YdaO and pri-miR-9-1. These fusions contained the 14-nt pri-miR-9-1 apical junction plus 0-3 additional base-pairs from the stem (page 43).
Response To Arguments- 35 USC 102
7. In the response the Applicants traversed the rejection under 35 USC 102. The Applicants argue that the dissertation was not published until March 23, 2020, well after the November 19, 2019 priority date of the instant application. For this reason, the cited art cannot be used to challenge the novelty of the pending claims.
This argument has been fully considered but is not persuasive. As explained above in paragraph 3, the Applicants arguments and the email, help to clarify when the dissertation was publicly available from ProQuest and a library shelf, but it does not address when the dissertation was publicly available from eScholarship.org, which is where the Examiner obtained the dissertation. It is noted that eScholarship Publishing is a comprehensive open access publishing program for the University of California academic community. Based on the screenshots shown below, it appears that the dissertation was publicly available as of March, 2018 from eScholarship.org. Until this is further clarified, the rejections are maintained.
8. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA HANEY whose telephone number is (571)272-8668. The examiner can normally be reached Monday-Friday, 8:15am-4:45pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached at 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA HANEY/Primary Examiner, Art Unit 1682