Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1. REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency #1- The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specific deficiency #2 – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. In the instant case, it is noted that these sequence identifiers appear in other locations in the specification, but they must appear in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
2. Applicant’s amendment filed 8/3/22 is acknowledged and has been entered.
3. The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
4. Claims 1-15 and 19-23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection.
An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). Possession may be shown in a variety of ways including description of an actual reduction to practice, or by showing that the invention was "ready for patenting" such as by the disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention. See, e.g., Pfaff v. Wells Elecs., Inc., 525 U.S. 55, 68, 119 S.Ct. 304, 312, 48 USPQ2d 1641, 1647 (1998); Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406; Amgen, Inc. v. Chugai Pharm., 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by "whatever characteristics sufficiently distinguish it"). "Compliance with the written description requirement is essentially a fact-based inquiry that will ‘necessarily vary depending on the nature of the invention claimed.' " Enzo Biochem, 323 F.3d at 963, 63 USPQ2d at 1612. An invention described solely in terms of a method of making and/or its function may lack written descriptive support where there is no described or art-recognized correlation between the disclosed function and the structure(s) responsible for the function. See MPEP 2163 I.A.
An applicant may also show that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics which provide evidence that applicant was in possession of the claimed invention, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics. Enzo Biochem, 323 F.3d at 964, 63 USPQ2d at 1613 (quoting the Written Description Guidelines, 66 Fed. Reg. at 1106, n. 49, stating that "if the art has established a strong correlation between structure and function, one skilled in the art would be able to predict with a reasonable degree of confidence the structure of the claimed invention from a recitation of its function".). "Thus, the written description requirement may be satisfied through disclosure of function and minimal structure when there is a well-established correlation between structure and function." See MPEP 2163 II.3.
Applicant has broadly claimed:
a formulation for slowing growth of tumors in a subject comprising an effective amount of a RIG-I agonist comprising pUUC AuK and an adjuvant (base claim 1), wherein the adjuvant is one of the alternatives recited in claim 2, 3 or 4, including wherein the RIG-I agonist comprises an oligonucleotide with at least one double-stranded region and at least one 5” phosphate combined with a squalene emulsion adjuvant (claim 4), or including wherein the RIG-I agonist comprises 3p-hpRNA or pUUC AuK (claim 6), including wherein the agonist comprises a sequence having at least 90% identity with SEQ ID NO: 1 (claim 7) or a sequence having at least 90% identity with SEQ ID NO: 2 (claim 8). The formulation of claim 1 comprises a hairpin region sequence having SEQ ID NO: 4 (claim 9), and including further comprising a sequence having at least 80% identity with a linear region having SEQ ID NO: 3 (claim 10). The formulation of claim 1 as recited in instant dependent claim 11 is characterized by an agonist having a first linear region having a length of 14-18 nucleotides, a hairpin region having a length of 8-12 nucleotides, and a second linear region having a length of 90-100 nucleotides, including in claim 11, wherein the first linear region comprises a sequence having at least 80% identity with SEQ ID NO: 4 (claim 12) or wherein the hairpin region comprises a sequence having at least 90% identity with SEQ ID NO: 4 (claim 13), or wherein the second linear region comprises a sequence having at least 80% identity with SEQ ID NO: 5 (claim 13). The formulation in claim 15 is that of claim 1 and further characterized by effective amount of the agonist, including in claim 19 wherein an effective amount induces an immune response in the subject, or that activates a RIG-I receptor in the subject in claim 20, or triggers signaling cascades that lead to the production of type I IFRNs and pro-inflammatory cytokines in the subject in claim 21. The formulation recited in claim 22 is that of claim 1, further comprising one or more excipients. Claim 23 is drawn to a method for glowing growth of solid tumors in a subject comprising administering an effective amount of the formulation of claim 1 to the subject.
The specification does not disclose a representative number of species of such a RIG-I agonist in the claimed formulation or the method of administering it, nor sufficient relevant identifying characteristics in the form of structure or functional characteristics coupled with a known or disclosed correlation between structure and function. This is the case for the following reasons.
The specification discloses that RIG-I detects certain patterns in dsRNA sequences, often found in the RNA of viruses, and upon such detection changes conformation and initiates a cascade of immune responses that can lead to cell death and inflammatory responses ([0001]).
The specification at [0019] discloses that RIG-I agonists are molecule that bind to RIG-I and induce a conformational change. The specification at [0091] discloses that the RIG-I agonist/adjuvant formulations of the disclosure have use in enhancing or eliciting in a subject or in cell culture, activation of the RIG-I receptor and associated immune response.
The specification at [0022] discloses that as used herein a “RIG-I” agonist refers to any natural or synthetic molecule that directly or indirectly interacts with the RIG-I receptor causing conformational changes in the receptor that induces an immune response and that specific RIG-I agonists are 3p-hpRNA and pUUC Auk, as well as any variations, modifications, or similar molecules thereto that retain the ability to activate RIG-I. The specification discloses that the sequence of 3p-hpRNA is identical to the sequence denoted as SEQ ID NO: 1 ([0105]). The specification further discloses that the limitation “pUUC Auk” includes any oligonucleotide sequence with at least 80% identity to SEQ ID NO: 2, a 5’ triphosphate or diphosphate group, at least one double-stranded region, and a poly-T or poly-U sequence of at least 13 nt ([0108]). The specification at [0005] discloses that pUUC Auk which is a single-stranded DNA molecule with 5’ triphosphate, a single hairpin region, and poly-T regions is a novel agonist provided in this disclosure.
The specification at the Examples discloses efficacy of the RIG-I agonist 3p-hpRNA and pUUC Auk as a therapeutic treatment that can limit tumor growth, presumably wherein the pUUC Auk is identical to SEQ ID NO: 2.
The specification at [0078] discloses that a subject is a patient, individual, person, or animal that receives a RIG-I agonist/adjuvant formulation.
The RIG-I agonist recited in the instant claims must possess the functional properties of slowing growth in tumors of a subject (i.e., an animal including a human), bind to the RIG-I receptor and induce conformational changes in that receptor that induce an immune response (i.e., triggering signaling cascades that lead to the production of type I IFNs and pro-inflammatory cytokines and directly promotes killing of cells in which RIG-I has been activated through intrinsic and extrinsic apoptosis and pyroptosis ([0017]) in said subject.
The specification discloses that the RIG-I agonist encompasses any variations, modifications, or similar molecules to 3p-hpRNA and pUUC AuK that retain the ability to activate RIG-I ([0022]). The specification does not disclose which changes in the sequence of SEQ ID NO: 2 (single stranded DNA “pUUC AuK”) that are at least 80% and less than 100% identical thereto that possess the aforementioned functional properties. Likewise, the specification does not disclose which changes in the sequence of SEQ ID NO: 1 (3p-hpRNA) that are at least 90% and less than 100% identical possess the requisite functional properties. There is no evidence of record for a representative number of species of such variants of SEQ ID NO: 2 and of SEQ ID NO: 1 that possess the requisite functional properties. This is also the case for the RIG-I agonists in dependent claims 8 and 12-14 that recite specific degrees of identity to portions of a RIG-I agonist (and pertinent to SEQ ID NO: 2 and variants thereof having at least 80% identity thereto).
Therefore, it appears that the instant specification does not adequately disclose the breadth of the RIG-I agonist in the claimed formulation for slowing growth of tumors in a subject or that is administered in the method for slowing growth of solid tumors in a subject recited in the instant claims. In light of this, a skilled artisan would reasonably conclude that Applicant was not in possession of the genus of all such RIG-I agonists and hence was not in possession of the genus of formulations that comprise them and the method that administers them at the time the instant application was filed.
5. Claims 1-15 and 19-23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a formulation for slowing growth of tumors in a subject comprising a sequence that is identical to SEQ ID NO: 1 (3p-hpRNA) or to SEQ ID NO: 2 (pUUC Au) or to a method for slowing growth of solid tumors in a subject comprising administering said formulation, does not reasonably provide enablement for a formulation for slowing growth of tumors in a subject comprising an effective amount of a RIG-I agonist comprising variants of SEQ ID NO: 1 or SEQ ID NO: 2 or to a method for slowing growth of solid tumors in a subject comprising administering said formulation. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Applicant has claimed:
a formulation for slowing growth of tumors in a subject comprising an effective amount of a RIG-I agonist (and an adjuvant) comprising pUUC AuK and an adjuvant (base claim 1), wherein the adjuvant is one of the alternatives recited in claim 2, 3 or 4, including wherein the RIG-I agonist comprises an oligonucleotide with at least one double-stranded region and at least one 5” phosphate combined with a squalene emulsion adjuvant (claim 4), or including wherein the RIG-I agonist comprises 3p-hpRNA or pUUC AuK (claim 6), including wherein the agonist comprises a sequence having at least 90% identity with SEQ ID NO: 1 (claim 7) or a sequence having at least 90% identity with SEQ ID NO: 2 (claim 8). The formulation of claim 1 comprises a hairpin region sequence having SEQ ID NO: 4 (claim 9), and including further comprising a sequence having at least 80% identity with a linear region having SEQ ID NO: 3 (claim 10). The formulation of claim 1 as recited in instant dependent claim 11 is characterized by an agonist having a first linear region having a length of 14-18 nucleotides, a hairpin region having a length of 8-12 nucleotides, and a second linear region having a length of 90-100 nucleotides, including in claim 11, wherein the first linear region comprises a sequence having at least 80% identity with SEQ ID NO: 4 (claim 12) or wherein the hairpin region comprises a sequence having at least 90% identity with SEQ ID NO: 4 (claim 13), or wherein the second linear region comprises a sequence having at least 80% identity with SEQ ID NO: 5 (claim 13). The formulation in claim 15 is that of claim 1 and further characterized by effective amount of the agonist, including in claim 19 wherein an effective amount induces an immune response in the subject, or that activates a RIG-I receptor in the subject in claim 20, or triggers signaling cascades that lead to the production of type I IFRNs and pro-inflammatory cytokines in the subject in claim 21. The formulation recited in claim 22 is that of claim 1, further comprising one or more excipients. Claim 23 is drawn to a method for glowing growth of solid tumors in a subject comprising administering an effective amount of the formulation of claim 1 to the subject.
The specification discloses that RIG-I detects certain patterns in dsRNA sequences, often found in the RNA of viruses, and upon such detection changes conformation and initiates a cascade of immune responses that can lead to cell death and inflammatory responses ([0001]).
The specification at [0019] discloses that RIG-I agonists are molecule that bind to RIG-I and induce a conformational change. The specification at [0091] discloses that the RIG-I agonist/adjuvant formulations of the disclosure have use in enhancing or eliciting in a subject or in cell culture, activation of the RIG-I receptor and associated immune response.
The specification at [0022] discloses that as used herein a “RIG-I” agonist refers to any natural or synthetic molecule that directly or indirectly interacts with the RIG-I receptor causing conformational changes in the receptor that induces an immune response and that specific RIG-I agonists are 3p-hpRNA and pUUC Auk, as well as any variations, modifications, or similar molecules thereto that retain the ability to activate RIG-I. The specification discloses that the sequence of 3p-hpRNA is identical to the sequence denoted as SEQ ID NO: 1 ([0105]). The specification further discloses that the limitation “pUUC Auk” includes any oligonucleotide sequence with at least 80% identity to SEQ ID NO: 2, a 5’ triphosphate or diphosphate group, at least one double-stranded region, and a poly-T or poly-U sequence of at least 13 nt ([0108]). The specification at [0005] discloses that pUUC Auk which is a single-stranded DNA molecule with 5’ triphosphate, a single hairpin region, and poly-T regions is a novel agonist provided in this disclosure.
The specification at [0078] discloses that a subject is a patient, individual, person, or animal that receives a RIG-I agonist/adjuvant formulation.
The specification at the Examples discloses efficacy of the RIG-I agonists 3p-hpRNA and pUUC Auk as a therapeutic treatment that can limit tumor growth, presumably wherein the pUUC Auk is identical to SEQ ID NO: 2.
The specification does not disclose working examples of variants of SEQ ID NO: 1 and 2 that can be used for slowing growth of tumors in a subject. The specification discloses that “difficulty identifying in advance which oligonucleotide sequences will be recognized by RIG-I combined with the unpredictable interaction between agonist and adjuvant makes it challenging to identify specific molecules and formulations that are effective cancer therapies” and that “RIG-I-based therapeutic strategies face multiple challenges, such as designing highly specific and stable agonists, and developing efficient agonist delivery modes while avoiding uncontrolled release of pro-inflammatory cytokines” ([0018]).
Evidentiary reference Quijano et al. (Sci. Transl. Med., 2025, 17 eadk1868, pages 1-15) teaches that systemic delivery of nucleic acids mimicking viral components that stimulate RIG-I to induce anti-tumor immune responses through secretion of type I IFNs and inflammatory cytokines is challenging because of degradation risks, low bioavailability, and systemic toxicities. Quijano et al. use an antibody-tumor-targeting molecule to deliver 3p-hpRNA into tumors (page 1 at column 2, 2nd para).
There is insufficient guidance in the specification as to how to make and/or use instant invention. Undue experimentation would be required of one skilled in the art to practice the instant invention. See In re Wands 8 USPQ2d 1400 (CAFC 1988).
6. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
7. Claims 1-15 and 19-23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
a) Claim 6 recites the limitation “wherein the RIG-I agonist comprises 3p-hpRNA or pUUC Auk” in lines 1-2. There is insufficient antecedent basis for this limitation in the claim, as instant base claim 1 only recites the RIG-I agonist comprising pUUC AuK.
b) Claim 1 is indefinite in the recitation of a RIG-I agonist comprising pUUC AuK because it is not clear what is meant, i.e., although the instant specification discloses that a RIG-I agonist is one that has at least 80% sequence identity with instantly recited SEQ ID NO: 2, SEQ ID NO: 2is single stranded DNA, while the corresponding RNA comprising poly U/UC is the actual RIG-I agonist, that is the molecule that binds RIG-I and induces conformational changes thereto.
8. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
9. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
10. Claims 1, 2, 8-15 and 19-23 are rejected under 35 U.S.C. 103 as being unpatentable over US 11,141,377 in view of Kell et al. (J. Virol. 2015, 89(27): 11056-11068).
Claim interpretation: The specification at [0078] discloses that a subject is a patient, individual, person, or animal that receives a RIG-I agonist/adjuvant formulation. The specification discloses at [0119] that “about” denotes a range of plus or minus 10% of the stated value. The specification at [0005] discloses that pUUC Auk which is a single-stranded DNA molecule with 5’ triphosphate, a single hairpin region, and poly-T regions is a novel agonist provided in this disclosure. The specification at [0019] discloses that RIG-I agonists are molecule that bind to RIG-I and induce a conformational change. The specification at [0022] discloses that as used herein a “RIG-I” agonist refers to any natural or synthetic molecule that directly or indirectly interacts with the RIG-I receptor causing conformational changes in the receptor that induces an immune response and that specific RIG-I agonists are 3p-hpRNA and pUUC Auk, as well as any variations, modifications, or similar molecules thereto that retain the ability to activate RIG-I. The specification discloses that the sequence of 3p-hpRNA is identical to the sequence denoted as SEQ ID NO: 1 ([0105]). The specification discloses that the limitation “pUUC Auk” includes any oligonucleotide sequence with at least 80% identity to SEQ ID NO: 2, a 5’ triphosphate or diphosphate group, at least one double-stranded region, and a poly-T or poly-U sequence of at least 13 nt ([0108]). The specification discloses that RIG-I detects certain patterns in dsRNA sequences, often found in the RNA of viruses, and upon such detection changes conformation and initiates a cascade of immune responses that can lead to cell death and inflammatory responses ([0001]). The specification discloses that an “effective amount” refers to an amount that is sufficient to achieve or at least partially achieve the desired effect ([0080]). The open transitional phrase “comprising” opens the claims to encompass other non-recited elements.
US 11,141,377 discloses a composition comprising a nanostructured lipid carrier particle (NLC, i.e., an adjuvant) comprising a RIG-I agonist (e.g., claims 1 and 15), as well as a method of generating or enhancing an immune response comprising administering a therapeutically effective amount of the composition (e.g., claim 1).
US 11,141,377 does not disclose wherein the RIG-I agonist is one recited in the instant claims.
Kell et al. teach a sequence identical to instantly recited SEQ ID NO: 2 (that is disclosed in the instant specification as pUUC AuK) and that it is the coding sequence for making HCV Con1 PU/UC RNA (especially “RNA methods” section). Kell et al. teach that RIG-I recognizes the triphosphate and the pathogen-associated molecular pattern motif located within the 3” UTR region consisting of poly-U/UC (poly-uridine/cytosine motif) in the viral genome of HCV and that recognition of such a sequence by RIG-I induces innate immune responses that restrict acute infection (especially abstract). Kell et al. teach that liver inflammation, fibrosis, and cirrhosis are the consequences of persistent HCV replication and dispose patients to the development of hepatocellular carcinoma (e.g., 1st full paragraph on page 11057).
It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have used the encoding RIG-I agonist taught by Kell et al. as the RIG-I agonist in the composition and method disclosed by the primary art reference.
One of ordinary skill in the art would have been motivated to do this in order to induce innate immune responses that restrict acute infection.
As pertains to the recitation of the intended use of the formulation, the composition is the same composition recited in the claims and must therefore exhibit the same properties. "Products of identical chemical composition cannot have mutually exclusive properties." In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990). A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the properties applicant discloses and/or claims are necessarily present. See MPEP 2112.01.
As regards the recitation of dosage or effective amount of a RIG-I agonist, these said limitations are result effective variables that were well within the purview of one of ordinary skill in the art to ascertain.
Claim 23 is included in this rejection because it would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have used the encoding RIG-I agonist taught by Kell et al. as the RIG-I agonist in the composition and method disclosed by the primary art reference of administering it to a subject who already has cancer in order to limit HCV replication.
Note that instantly recited SEQ ID NO: 3-5 are comprised in SEQ ID NO: 2 of the instant claims.
11. Claims 1, 2, 8-15 and 19-23 are rejected under 35 U.S.C. 103 as being unpatentable over US 11,141,377 in view of Kell et al. (J. Virol. 2015, 89(27): 11056-11068) and Elion and Cook (Oncotarget, 2018, 9(48): 29007-29017, IDS reference).
Claim interpretation: The specification at [0078] discloses that a subject is a patient, individual, person, or animal that receives a RIG-I agonist/adjuvant formulation. The specification discloses at [0119] that “about” denotes a range of plus or minus 10% of the stated value. The specification at [0005] discloses that pUUC Auk which is a single-stranded DNA molecule with 5’ triphosphate, a single hairpin region, and poly-T regions is a novel agonist provided in this disclosure. The specification at [0019] discloses that RIG-I agonists are molecule that bind to RIG-I and induce a conformational change. The specification at [0022] discloses that as used herein a “RIG-I” agonist refers to any natural or synthetic molecule that directly or indirectly interacts with the RIG-I receptor causing conformational changes in the receptor that induces an immune response and that specific RIG-I agonists are 3p-hpRNA and pUUC Auk, as well as any variations, modifications, or similar molecules thereto that retain the ability to activate RIG-I. The specification discloses that the sequence of 3p-hpRNA is identical to the sequence denoted as SEQ ID NO: 1 ([0105]). The specification discloses that the limitation “pUUC Auk” includes any oligonucleotide sequence with at least 80% identity to SEQ ID NO: 2, a 5’ triphosphate or diphosphate group, at least one double-stranded region, and a poly-T or poly-U sequence of at least 13 nt ([0108]). The specification discloses that RIG-I detects certain patterns in dsRNA sequences, often found in the RNA of viruses, and upon such detection changes conformation and initiates a cascade of immune responses that can lead to cell death and inflammatory responses ([0001]). The specification discloses that an “effective amount” refers to an amount that is sufficient to achieve or at least partially achieve the desired effect ([0080]). The open transitional phrase “comprising” opens the claims to encompass other non-recited elements.
US 11,141,377 discloses a composition comprising a nanostructured lipid carrier particle (NLC) comprising a RIG-I agonist (e.g., claims 1 and 15), as well as a method of generating or enhancing an immune response comprising administering a therapeutically effective amount of the composition (e.g., claim 1).
US 11,141,377 does not disclose wherein the RIG-I agonist is one recited in the instant claims.
Kell et al. teach a sequence identical to instantly recited SEQ ID NO: 2 (that is disclosed in the instant specification as pUUC AuK) and that it is the coding sequence for making HCV Con1 PU/UC RNA (especially “RNA methods” section). Kell et al. teach that RIG-I recognizes the triphosphate and the pathogen-associated molecular pattern motif located within the 3” UTR region consisting of poly-U/UC (poly-uridine/cytosine motif) in the viral genome of HCV and that recognition of such a sequence by RIG-I induces innate immune responses that restrict acute infection (especially abstract). Kell et al. teach that liver inflammation, fibrosis, and cirrhosis are the consequences of persistent HCV replication and dispose patients to the development of hepatocellular carcinoma (e.g., 1st full paragraph on page 11057).
Elion and Cook teach that RIG-I agonists are being used as a therapeutic approach in a diverse range of cancers. Elion and Cook teach that RIG-I agonists are capable of triggering RIG-! Signaling , pyroptosis, and acute inflammation, and such activation could provide a three-pronged attack in direct activation of tumor cell death, cytokine-mediated activation of innate immune effectors and increased recruitment and cross-priming of adaptive immune effectors through a cytokine—enriched microenvironment and enhanced activity of professional APCs (see entire reference, including Figures 1-3, and conclusion section).
It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have used the RIG-I agonist taught by Kell et al. as the RIG-I agonist in the composition and method disclosed by the primary art reference.
One of ordinary skill in the art would have been motivated to do this in order to induce innate immune responses that restrict acute infection, and in order to treat tumors in a patient already having a cancer, as Elion and Cook teach that RIG-I agonists are therapeutic formulations for treatment of cancers.
As pertains to the recitation of the intended use of the formulation, the composition is the same composition recited in the claims and must therefore exhibit the same properties. "Products of identical chemical composition cannot have mutually exclusive properties." In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990). A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the properties applicant discloses and/or claims are necessarily present. See MPEP 2112.01.
As regards the recitation of dosage or effective amount of a RIG-I agonist, these said limitations are result effective variables that were well within the purview of one of ordinary skill in the art to ascertain.
Note that instantly recited SEQ ID NO: 3-5 are comprised in SEQ ID NO: 2 of the instant claims.
12. Claims 3-6 are rejected under 35 U.S.C. 103 as being unpatentable over:
a) US 11,141,377 in view of Kell et al. (J. Virol. 2015, 89(27): 11056-11068) and Elion and Cook (Oncotarget, 2018, 9(48): 29007-29017, IDS reference) as applied to claims 1, 2, 8-15 and 19-23 above, and further in view of WO2018232257 A1 (IDS reference).
or
b) US 11,141,377 in view of Kell et al. (J. Virol. 2015, 89(27): 11056-11068) and Elion and Cook (Oncotarget, 2018, 9(48): 29007-29017, IDS reference) as applied to claims 1, 2, 8-15 and 19-23 above, and further in view of WO2018232257 A1 (IDS reference).
The combinations of references cited above at “a)” or “b)” have been discussed above and will not be repeated herein, and are referred to as the “combined references”.
The combined references do not teach wherein the formulation comprises a squalene emulsion.
WO2018232257 A1 teaches a composition comprising a NLC particle for delivery of a bioactive agent to a cell, wherein the bioactive agent may be a nucleic acid molecule, including an RNA (e.g., claims 1 and 26) that comprises a RIG-I agonist. WO2018232257 A1 teaches alternatively, using a squalene emulsion or NLCs containing squalene/dynasan (e.g., [0033], claim 26). WO2018232257 A1 teaches including dextrose and/or polysorbate 80 and/or lecithin in the composition ([00180], [00326], embodiment 23 on page 97). WO2018232257 A1 teaches doses of about 0.001 ug/kg body weight or alternatively 0.1 ug (e.g., [0117], [0119]). See entire reference.
It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have comprised the squalene emulsion in combination and to have additionally added dextrose, polysorbate 80 and lecithin as taught by WO2018232257 A1.
One or ordinary skill in the art would have been motivated to do this in order to use any appropriately effective adjuvant and excipients.
13. Claims 1-7, 11, 15 and 19-22 are rejected under 35 U.S.C. 103 as being unpatentable over US 20040087521 A1 in view of Feldman et al. (Vaccine, 2019 (May), 37: 3326-3334) and Elion and Cook (Oncotarget, 2018, 9(48): 29007-29017, IDS reference).
Claim interpretation: The specification at [0078] discloses that a subject is a patient, individual, person, or animal that receives a RIG-I agonist/adjuvant formulation. The specification discloses at [0119] that “about” denotes a range of plus or minus 10% of the stated value. The specification at [0005] discloses that pUUC Auk which is a single-stranded DNA molecule with 5’ triphosphate, a single hairpin region, and poly-T regions is a novel agonist provided in this disclosure. The specification at [0019] discloses that RIG-I agonists are molecule that bind to RIG-I and induce a conformational change. The specification at [0022] discloses that as used herein a “RIG-I” agonist refers to any natural or synthetic molecule that directly or indirectly interacts with the RIG-I receptor causing conformational changes in the receptor that induces an immune response and that specific RIG-I agonists are 3p-hpRNA and pUUC Auk, as well as any variations, modifications, or similar molecules thereto that retain the ability to activate RIG-I. The specification discloses that the sequence of 3p-hpRNA is identical to the sequence denoted as SEQ ID NO: 1 ([0105]). The specification discloses that the limitation “pUUC Auk” includes any oligonucleotide sequence with at least 80% identity to SEQ ID NO: 2, a 5’ triphosphate or diphosphate group, at least one double-stranded region, and a poly-T or poly-U sequence of at least 13 nt ([0108]). The specification discloses that RIG-I detects certain patterns in dsRNA sequences, often found in the RNA of viruses, and upon such detection changes conformation and initiates a cascade of immune responses that can lead to cell death and inflammatory responses ([0001]). The open transitional phrase “comprising” opens the claims to encompass other sequences or unrecited elements. The specification discloses that an “effective amount” refers to an amount that is sufficient to achieve or at least partially achieve the desired effect ([0080]).
US 20040087521 A1 discloses using viral DNA encoding human influenza virus protein such as for example, SEQ ID NO: 14 of the art reference, in a pharmaceutical/vaccine composition comprising pharmaceutically acceptable carriers such as for example, lecithin liposome or other liposomes (which are also adjuvants) or adjuvants. Note that an RNA encoding SEQ ID NO: 14 (DNA, “Db” sequence appearing below) of the art reference is 98.2% identical to an RNA encoding instantly recited SEQ ID NO:1 (the “Qy sequence below):
Query Match 98.2%; Score 85.4; Length 136;
Best Local Similarity 74.7%;
Matches 65; Conservative 21; Mismatches 1; Indels 0; Gaps 0;
Qy 1 AGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAG 60
Db 24 AGCAAAAGCAGGGTGACAAAAACATAATGGATCCAAACACTGTGTCAAGCTTTCAGGTAG 83
Qy 61 AUUGCUUUCUUUGGCAUGUCCGCAAAC 87
Db 84 ATTGCTTTCTTTGGCATGTCCGCAAAC 110
(see entire reference, especially, [0026], [0089], [0097], [0102], claim 11).
US 20040087521 A1 does not disclose wherein the pharmaceutical composition comprises the RNA that corresponds to the DNA sequence of SEQ ID NO: 14 (and comprising SEQ ID NO: 14) of the art reference.
Feldman et al. teach that mRNA vaccines have the potential for rapid, high-volume manufacturing with precision and flexibility of antigen design necessary to provide timely and effective responses to emerging threats from influenza and other pathogens, with additional advantages are economies in time, cost and scale (see entire reference especially page at column 1 at the 2nd full para).
It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have comprised the RNA corresponding to SEQ ID NO: 14 or one comprising SEQ ID NO: 14 in the vaccine composition of the primary art reference in place of the DNA.
One of ordinary skill in the art would have been motivated to do this in order to reap the advantages taught by Feldman et al.
The primary art reference in view of Feldman et al. do not teach wherein the adjuvant is squalene emulsion.
WO2018232257 A1 teaches a composition comprising a NLC particle for delivery of a bioactive agent to a cell, wherein the bioactive agent may be a nucleic acid molecule, including an RNA (e.g., claims 1 and 26) that comprises a RIG-I agonist or other viral oligonucleotide sequence. WO2018232257 A1 teaches alternatively, using a squalene emulsion or NLCs containing squalene/dynasan (e.g., [0033], claim 26). WO2018232257 A1 teaches including dextrose and/or polysorbate 80 and/or lecithin in the composition ([00180], [00326], embodiment 23 on page 97). WO2018232257 A1 teaches doses of about 0.001 ug/kg body weight or alternatively 0.1 ug (e.g., [0117], [0119]). See entire reference.
It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the claimed invention to have comprised the RNA in a squalene emulsion in combination with the NLCs or by itself as the adjuvant in the formulation, and to have additionally added dextrose, polysorbate 80 and lecithin as taught by WO201823225 in the composition of the primary art reference in view of Feldman et al.
One or ordinary skill in the art would have been motivated to do this in order to use any appropriately effective adjuvant and excipients/preservatives.
As pertains to the recitation of the intended use of the formulation, the composition is the same composition recited in the claims and must therefore exhibit the same properties. "Products of identical chemical composition cannot have mutually exclusive properties." In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990). A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the properties applicant discloses and/or claims are necessarily present. See MPEP 2112.01.
As regards the recitation of dosage or effective amount of a RIG-I agonist, as the subject or laboratory conditions may vary, as the instant specification discloses that an “effective amount” refers to an amount that is sufficient to achieve or at least partially achieve the desired effect ([0080]), and that the subject may be any animal [0078], and the art reference teaches dosage ranges, the claimed formulation appears to be similar to the formulation of the prior art absent a showing of unobvious differences. Since the Patent Office does not have the facilities for examining and comparing the formulation of the instant invention to those of the prior art, the burden is on Applicant to show a distinction between the formulation of the instant invention and that of the prior art. See In re Best, 562 F.2d 1252, 195 USPQ 430 (CCPA 1977).
Instant dependent claim 11 is included in this rejection because the open transitional phrase “comprises” opens the claim to include other non-recited sequences. Instantly recited SEQ ID NO: 1 is a 87-mer oligonucleotide sequence.
14. Claim 23 is objected to because of the following informality: the claim recites “the formulation of any of claim 1”.
Appropriate correction is required.
15. No claim is allowed.
16. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARIANNE DIBRINO whose telephone number is (571)272-0842. The examiner can normally be reached on M, T, Th, F.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the Examiner’s supervisor, MISOOK YU can be reached on 571-272-0839. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Marianne DiBrino/
Marianne DiBrino, Ph.D.
Patent Examiner
Group 1640
Technology Center 1600
/MICHAEL SZPERKA/Primary Examiner, Art Unit 1641