Prosecution Insights
Last updated: April 19, 2026
Application No. 17/778,064

METHOD FOR PROVIDING IMMUNE CELLS WITH ENHANCED FUNCTION

Final Rejection §102§103
Filed
May 19, 2022
Examiner
LEONARD, ARTHUR S
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Cartherics Pty Ltd.
OA Round
2 (Final)
51%
Grant Probability
Moderate
3-4
OA Rounds
3y 6m
To Grant
99%
With Interview

Examiner Intelligence

Grants 51% of resolved cases
51%
Career Allow Rate
255 granted / 503 resolved
-9.3% vs TC avg
Strong +51% interview lift
Without
With
+51.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
62 currently pending
Career history
565
Total Applications
across all art units

Statute-Specific Performance

§101
3.5%
-36.5% vs TC avg
§103
39.8%
-0.2% vs TC avg
§102
17.5%
-22.5% vs TC avg
§112
21.2%
-18.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 503 resolved cases

Office Action

§102 §103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Amendments In the reply filed 11/24/2025, Applicant has amended Claims 1, 12, and 13, canceled claims 3, 9, and 15-20, and added new claims, Claims 49-54. Applicant’s election of the A2AR gene to inhibit function without traverse in the reply filed on 6/09/2025 has been acknowledged. Note that newly submitted claims 49-54 are directed to a species of gene that is independent or distinct from the invention originally claimed because they are structurally distinct. Since applicant has received an action on the merits for the originally presented species, and Applicant was provided the opportunity to elect the newly presented species, the inventions encompassed by the new presented genes has been constructively elected by original presentation for prosecution on the merits. Accordingly, claims 49-54 are withdrawn from consideration as being directed to a non-elected invention. See 37 CFR 1.142(b) and MPEP § 821.03. Claims 10-11, and 49-54 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic claim. Claims 2, 4, 6-8, 12-13 are under consideration. Withdrawn Claim Objections The objection to Claim 2 has been withdrawn due to applicant’s amendment to spell out the abbreviation upon first use.. Withdrawn 35 USC § 112(b) The prior rejection of Claims 12 and 13 under 35 U.S.C. § 112(b) pre-AIA 2nd paragraph as being indefinite is withdrawn in light of Applicant’s amendments of instant claims to describe the immune cell. Withdrawn Claim Rejections - 35 USC § 102 The prior rejection of Claims 2 and 17 under 35 U.S.C. 102(a)(1) as being anticipated by Chen et al., (J Neurosci, 1999, 19:9192-9200) is withdrawn in light of Applicant’s amendment of Claim 2 to limit the stem cell to an IPSC, which is a limitation Chen does not anticipate. Specifically, Chen is directed to embryonic stem cells. The prior rejection of Claims 2, 4, 6-8, 12, 13 under 35 U.S.C. 102(a)(2) as being anticipated by Basar et al. (US2022/0031749 filed 11/27/2019, with priority to provisional 62/772,406 filed 11/28/2018) is withdrawn in light of Applicant’s amendment of Claim 2 to explicitly require a differentiation step for the IPSC into an immune cell, which is a limitation Basar does not anticipate. New Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 2, 4, 6-8, 12, and 13, are rejected under 35 U.S.C. 103 as being unpatentable over Basar et al. (US2022/0031749 filed 11/27/2019, with priority to provisional 62/772,406 filed 11/28/2018, prior art of record), in view of Boyd (WO2017/088012, filed 1/23/2015, published 6/01/2017, see IDS filed 5/20/2022) and Lukashev et al., (Biochemical Pharm., 2003, 65: 2081-2090) In regard to claim 2, Basar claims an in vitro method of making and an engineered induced pluripotent stem cell (iPSC) made by modifying the cell to inhibit by genomic disruption the immune checkpoint gene ADORA2 (alias adenosine A2a receptor A2AR) (Claims 1-15, 24, 58, 61 and 70 of priority document). In regard to claims 4, and 6-8, Basar claims the method of genomic disruption in order to inhibit A2AR is achieved by a CRISPR-Cas9 nuclease gene editing system and guide RNA in complex with the nuclease (Claims 2, 6-8, and 58 of priority document). Specifically in regard to claim 7, Basar teaches the guide RNA targets the nucleic acid sequence of CTCCTCGGTGTACATCACGG (Table 2, p. 20 of priority document), which is 100% identical to the claimed SEQ ID NO:8 (see SCORE search 6/18/2025, rnpbm file, result #1) In regard to claims 12 and 13, Basar claims the modified cell further comprises a nucleic acid encoding a CAR (Claims 17, 44, 45, 63, and 83 of priority document), wherein the CAR recognizes CD19 (Claim 89 of priority document). However, although Basar teaches the clinical benefits of CAR modified T cells for treating cancer ([0051] of priority document), they are silent with respect to the step of in vitro differentiating the iPSC into an immune cell such as a T cell. Boyd teaches an in vitro method of differentiating iPSCs into T cells (Example 3, pgs 86-88), wherein the T cells express a CAR (Example 6 & 7, pgs 89-93). Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to practice an in vitro method of genetically modifying an iPSC to disrupt the A2AR gene as claimed by Basar, and combine the step of differentiating the iPSC into a T cell as taught by Boyd with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so not only because of the clinical relevance of CAR T cells as taught by Basar, but also because Boyd teaches that by genetically modifying iPSCs (such as with a chimeric antigen receptor), the issue of providing sufficient present and future supplies of CAR T cells directed to a particular tumor is resolved due to the ongoing source of somatic T cells derived from these self-renewing modified stem cells [0013]. In regard to the reasonable expectation of success of doing so, Lukashev et al., (2003) demonstrate that well before the time of filing of the invention it was known that A2AR knock out mice demonstrate that the proportions of macrophages, T cells, and B cells (p. 2089, 1st para.), thereby supporting, albeit in vivo, the reasonable expectation of success in differentiating stem cells with a genetic disruption in A2AR into immune cells such as T cells. Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. RESPONSE TO ARGUMENTS Applicant's arguments filed on 11/24/2025 are acknowledged. First, Applicant argues that Basar does not teach or suggest differentiating a modified iPSC into an immune cell. Second, Applicant argues that there is no reduction to practice in Basar showing iPSCs with modified A2AR gene, much less their differentiation into immune cells. Applicant argues that Basar only broadly mentions iPSCs, and lists A2AR as a gene that can be inhibited from a list in Tables 1 & 2. Applicant argues the preferred embodiments of Basr inhibit A2AR only in NK cells, not iPSCs (Figs. 1 & 13 of Basar), and provides no enabling disclosure for A2AR knockout in iPSCs. Third, Applicant argues that they successfully demonstrate the genetic modification of A2AR in iPSCs, and Applicant solved the technical problem of differentiating A2AR KO iPSCs into immune cells with enhanced activity. Applicant's arguments have been fully considered but they are not persuasive. In response to Applicant's first argument, a 35 U.S.C. § 103(a) based test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In instant case, Basar explicitly claims the genetic disruption of A2AR in iPSCs, and while they are silent to the differentiation step, they acknowledge the clinical benefit of CAR T cells for treating cancer. Furthermore, the secondary reference of Boyd teaches the differentiation step of iPSCs to T cells, and provides good reason to do so as the iPSCs represent a source of differentiated CAR T cells for future cell therapy. In response to Applicant’s second argument, although Basar does not provide a preferred embodiment of an iPSC cell genetically modified to disrupt the A2AR gene, Basar does teach the guide RNAs for doing so and provides examples of CRISPR-Cas gene disruption for other checkpoint genes in other cells that could have been applied to A2AR gene disruption in iPSCs. The MPEP 2123 (I) states that patents are relevant as prior art for all they contain, and that a reference may be relied upon for all that it would have reasonably suggested to one having ordinary skill the art, including nonpreferred embodiments. “The use of patents as references is not limited to what the patentees describe as their own inventions or to the problems with which they are concerned. They are part of the literature of the art, relevant for all they contain.” In re Heck, 699 F.2d 1331, 1332-33, 216 USPQ 1038, 1039 (Fed. Cir. 1983) (quoting In re Lemelson, 397 F.2d 1006, 1009, 158 USPQ 275, 277 (CCPA 1968)). A reference may be relied upon for all that it would have reasonably suggested to one having ordinary skill the art, including nonpreferred embodiments. Merck & Co. v. Biocraft Laboratories, 874 F.2d 804, 10 USPQ2d 1843 (Fed. Cir.), cert. denied, 493 U.S. 975 (1989). In regard to Applicant’s third argument, as stated supra, Basar teach the guide RNAs for targeting A2AR and provides examples of CRISPR-Cas gene disruption for other checkpoint genes in other cells that could have been applied to A2AR gene disruption in iPSCs. Furthermore, Boyd provides an enabling disclosure for the differentiation of iPSCs to T cells, while Lukashev suggest the differentiation of A2AR-/- stem cells into T cells would be successful. It would have been therefore predictably obvious to differentiate A2AR-/- iPSCs into T cells when practicing a method of Basar et al. In re O’Farrell, 853 F.2d 894, 903, 7 USPQ2d 1673, 1681 (Fed. Cir. 1988) (citations omitted) (The court held the claimed method would have been obvious over the prior art relied upon because one reference contained a detailed enabling methodology, a suggestion to modify the prior art to produce the claimed invention, and evidence suggesting the modification would be successful.). This reasonable expectation of success is supported by: (1) the reference of Boyd et al. contained a detailed enabling methodology for the differentiation of iPSCs into T cells that could easily be applied to other iPSCs, (2) Basar claims a method to modify iPSCs to be deficient in A2AR, and (3) the success of Lukashev to generate an A2AR-/- deficient animal with a normal amount of T cells suggest modification of the method of Basar to include the differentiation of the A2AR-/- iPSCs into T cells would have been successful. Applicant is reminded that absolute predictability is not a necessary prerequisite to a case of obviousness. Rather, a degree of predictability that one of ordinary skill would have found to be reasonable is sufficient. In regard to Applicant’s success in doing so, the Federal Circuit concluded that Applicant’s “[g]ood science and useful contributions do not necessarily result in patentability.” Id. at 1364, 83 USPQ2d at 1304. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. No claims are allowed. Examiner Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to ARTHUR S LEONARD whose telephone number is (571)270-3073. The examiner can normally be reached on Mon-Fri 9am-5pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James Doug Schultz can be reached on 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ARTHUR S LEONARD/Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

May 19, 2022
Application Filed
Feb 16, 2023
Response after Non-Final Action
Jun 20, 2025
Non-Final Rejection — §102, §103
Nov 24, 2025
Response Filed
Feb 20, 2026
Final Rejection — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570719
CHIMERIC ANTIGEN RECEPTOR COMPRISING ANTI C-MET ANTIBODY OR ANTIGEN BINDING FRAGMENT THEREOF, AND USE THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12564648
GENE EDITING OF CAR-T CELLS FOR THE TREATMENT OF T CELL MALIGNANCIES WITH CHIMERIC ANTIGEN RECEPTORS
2y 5m to grant Granted Mar 03, 2026
Patent 12559771
Acoustically-Driven Buffer Switching for Microparticles
2y 5m to grant Granted Feb 24, 2026
Patent 12559798
COMPOSITIONS AND METHODS FOR DETERMINING GENETIC POLYMORPHISMS IN THE TMEM216 GENE
2y 5m to grant Granted Feb 24, 2026
Patent 12528849
WT1 HLA CLASS II-BINDING PEPTIDES AND COMPOSITIONS AND METHODS COMPRISING SAME
2y 5m to grant Granted Jan 20, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
51%
Grant Probability
99%
With Interview (+51.2%)
3y 6m
Median Time to Grant
Moderate
PTA Risk
Based on 503 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month