DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The Amendments and Remarks filed 28 July 2026 are acknowledged and have been entered. Claims 1-3 and 21 are amended. Claims 4-7, 11-12, 14, 16-20, 24, 26-32 and 34-35 are cancelled. Claims 1-3, 8-10, 13, 15, 21-23, 25, and 33 are pending and are being examined on the merits.
Priority
The instant application is a 371 PCT of application US2020/061850 filed 11/23/2020 that claims priority to application 69/941,392 filed 11/27/2019.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 23 and 33 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 23 recites “wherein modifying the targeted genomic region comprises editing the target polynucleotide.” There is insufficient antecedent basis for “the targeted genomic region.” Claim 21, from which claim 23 depends, recites a “target polynucleotide,” a “target sequence,” and modification of “the target polynucleotide,” but does not previously introduce a “targeted genomic region.” It is therefore unclear whether “the targeted genomic region” refers to the target polynucleotide, the target sequence within the target polynucleotide, some larger genomic region containing the target sequence, or another region. Accordingly, the metes and bounds of claim 23 are unclear.
Claim 33 recites “the guide polynucleotide.” There is insufficient antecedent basis for this limitation. Claim 1 recites “a guide nucleic acid or a polynucleotide encoding a guide nucleic acid,” but does not recite a “guide polynucleotide.” It is therefore unclear whether “the guide polynucleotide” of claim 33 refers to the guide nucleic acid itself or to the polynucleotide encoding the guide nucleic acid. These alternatives are structurally and functionally different. Accordingly, the scope of claim 33 is indefinite.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1–3, 21–23, 25, and 33 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for certain specifically disclosed nucleic-acid-guided nuclease systems comprising the specifically disclosed ABW nuclease sequences, does not reasonably provide enablement for an engineered nucleic-acid-guided nuclease having at least 85% homology to any of multiple ABW reference proteins, including SEQ ID NOs. 29, 107, 16, 42, 55, 68, 94, 81, and 3. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Nature of the Invention/Breadth of claims
Claims 1 and 21 encompass an engineered nucleic-acid-guided nuclease having at least 85% homology to any of multiple ABW reference proteins, including SEQ ID NOs. 29, 107, 16, 42, 55, 68, 94, 81, and 3, and further require the protein to participate in a functional targetable nuclease complex with a split gRNA and, in claims 1 and 21, function with respect to a target sequence in a human cell. Claim 2 encompasses proteins having at least 95% homology to the recited ABW sequences, while claim 3 encompasses proteins having at least 99% homology to the identified ABW sequences.
Guidance of the Specification
The specification provides working examples for particular ABW proteins. Example 4 individually evaluates disclosed ABW nuclease proteins with predicted gRNA, Cas12a gRNA, and STAR split gRNA and demonstrates that activity differs among the tested nuclease/guide combinations. The specification further reports Jurkat-cell genome-editing experiments in which particular ABW proteins, including ABW1, ABW2, ABW3, ABW4, and ABW8, demonstrated editing at the tested DNMT1 and/or TRAC loci [example 6]. Example 8 similarly describes preparing RNPs using disclosed ABW proteins and either single gRNA or STAR gRNA. These working examples demonstrate operability of specifically selected ABW proteins but do not establish a relationship between overall percentage amino-acid identity and retention of the several functions required by the claims. In particular, the specification does not identify which amino-acid positions may be varied while preserving protein folding, catalytic activity, PAM recognition, guide-RNA association, split-guide compatibility, target recognition, and genome-editing activity in a human cell. Nor does the specification provide representative amino-acid variants distributed throughout the claimed 85%, 95%, or 99% sequence genera from which such a structure-function relationship could reasonably be derived.
State of the Art
The unpredictability of the art is further demonstrated by Zetsche (Zetsche et al., he Keio journal of medicine 69.3 (2020): 59-65). Zetsche tested sixteen Cas12a orthologs in eukaryotic cells and observed targeted activity for only four of the new enzymes, with only one exhibiting robust indel formation [abstract]. Zetsche further reported substantially different genome-editing activities for two Cas12a proteins having approximately 94.7% predicted homology, demonstrating that high overall sequence similarity did not reliably predict comparable genome-editing function [pg. 61-62; Fig. 3]. Kleinstiver (Kleinstiver et al., Nature Biotechnology 37:276–282 (2019)), using structure-guided engineering, generated ten single-amino-acid AsCas12a variants selected in an effort to alter PAM-associated activity; only four of the ten tested variants showed increased genome-editing activity under the tested conditions, and additional combinations of the substitutions produced different activity and PAM profiles [pg. 276, col. 2, para 2]. Thus, even rationally selected individual substitutions could not simply be presumed to preserve or improve the relevant Cas12a functions.
Experimentation Required
Accordingly, a skilled artisan attempting to practice substantially the full scope of the claims would be required to make numerous amino-acid variants falling within the claimed percentage-homology ranges and empirically determine for each whether the variant: (1) properly folds and retains nuclease activity; (2) retains appropriate PAM recognition; (3) associates productively with an appropriate guide nucleic acid; (4) remains compatible with the claimed split-gRNA architecture; and (5) forms a functional targetable nuclease complex capable of the claimed activity in a human cell. Although construction and individual testing of a particular variant may employ techniques known in the art, the requirement to empirically identify operative members throughout the claimed protein genera is not merely routine verification of a predictable result. Rather, the experimentation is required to determine which members of the broad genus possess the claimed function in the first instance.
Under the factors set forth in In re Wands, the breadth of the claims is extensive; the specification supplies only a limited number of working protein species relative to the scope of the claimed amino-acid genera; the specification provides little guidance identifying permissible amino-acid substitutions that retain the claimed combination of functions; the art demonstrates substantial unpredictability in the functional consequences of Cas12a sequence differences; and significant empirical screening would therefore be required. The quantity and nature of experimentation necessary to practice substantially the full scope of the claims is considered undue.
Claim 2 does not overcome the deficiency merely by increasing the homology threshold to 95%, as contemporaneous evidence demonstrates that highly similar Cas12a orthologs can exhibit materially different editing activities. Claim 3 similarly does not overcome the deficiency merely by requiring 99% homology. The claim continues to permit amino-acid substitutions at arbitrary positions throughout the protein without identifying which substitutions preserve the multiple functional requirements of the claimed nuclease system; the art demonstrates that even individual amino-acid substitutions can materially alter Cas12a activity and PAM recognition.
Claims 22, 23, 25, and 33 depend directly or indirectly from claims 1 or 21 and do not limit the nuclease sequence genus in a manner that cures the enablement deficiency. Accordingly, these claims are rejected for the same reasons.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2 and 21-23 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019) and Murthy (US 2018/0237800 A1).
Regarding claims 1-2, and 21, Zhang teaches an engineered, non-naturally occurring CRISPR associated (Cas) (CRISPR-Cas) system (a) comprising one or more Type V CRISPR-Cas polynucleotide sequences comprising a guide RNA which comprises a guide sequence linked to a direct repeat sequence, wherein the guide sequence is capable of hybridizing with a target sequence, or one or more nucleotide sequences encoding the one or more Type V CRISPR-Cas polynucleotide sequences, and (b) a Cpf1 nuclease effector protein, or one or more nucleotide sequences encoding the Cpf1 effector protein; wherein the one or more guide sequences hybridize to said target sequence, said target sequence is 3' of a Protospacer Adjacent Motif (PAM), and said guide RNA forms a complex with the Cpf1 effector protein [0174, 1760-1763]. Zhang teaches that the invention also provides for the effector protein (e.g., a Cpf1) comprising an effector protein (e.g., a Cpf1) from an organism from a genus comprising Lachnospiraceae MC2017 [0037]. Zhang teaches a method of modifying sequences associated with or at a target locus of interest, the method comprising delivering to said sequences associated with or at the locus a non-naturally occurring or engineered composition comprising a Cpf1 loci effector protein and one or more nucleic acid components (such as crRNA, guide RNA, or single guide RNA), wherein the Cpf1 effector protein forms a complex with the one or more nucleic acid components and upon binding of the said complex to the locus of interest the effector protein induces the modification of the sequences associated with or at the target locus of interest [0012, 0200]. Zhang teaches that the target locus of interest may be comprised in a DNA molecule within a human cell [0018].
Zhang does not teach where the Cpf1 effector protein comprises a polypeptide sequence having at least 95% homology to a polypeptide sequence consisting of SEQ ID NO: 29. Zhang does teach that the diversity of Cpf1-family proteins available in the public sequences databases wase exploited [1738]. Zhang teaches that a BLAST search of the WGS database at the NCBI revealed 46 non-redundant Cpf1-family proteins [1738]. Zhang teaches that CRISPR repeats can be identified using PILER-CR and CRISPR-finder and that the spacer sequences can be searched against the NCRI nucleotide database using MEGABLAST [1726-27; 209]. These teachings support use of newly identified Cpf1-family proteins with corresponding compatible guide sequences.
WP_087408205 teaches a type V CRISPR-associated protein Cpf1 protein sequence that is 100% identical to 95% of SEQ ID NO:29, thereby teaching a sequence that is 95% identical to SEQ ID NO: 29.
It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the system of Zhang by searching and identifying a guide nucleotide sequence that works with the Cpf1 nuclease effector protein identified by WP_087408205 to facilitate use in the method of Zhang. One of ordinary skill would be motivated to make the modification with a reasonable expectation of success because Zhang teaches the ability to search databases for Cpf1 proteins and usable spacers sequence.
Zhang does not provide a persuasive reason to use the presently claimed split gRNA in its Cpf1 system. Indeed, Zhang teaches that Cpf1 can function without tracrRNA and reports that a Cpf1 effector protein plus crRNA was sufficient for target cleavage.
Murthy cures this deficiency. Murthy expressly teaches a complex containing a Type II or Type V CRISPR system comprising Cas9 or Cpf1 and a guide RNA [claim 1]. Claim 15 expressly limits the complex to Cpf1, while claim 20, depending from any of claims 1–18, expressly states that “the guide RNA is a dual-molecule guide RNA.” Thus, the express dependency of Murthy claim 20 on the Cpf1 embodiments of claims 15–18 teaches a Cpf1-containing Type V system employing a dual-molecule guide RNA. Murthy additionally teaches that suitable guide RNAs include both single-molecule and dual-molecule guide RNAs [0222]. Murthy explains that a dual guide comprises two separate nucleic-acid molecules, each containing complementary stretches that hybridize to form the RNA duplex of the protein-binding segment [0232]. Murthy further identifies activator/tracrRNA and targeter/crRNA sequences for the two portions of the dual-guide architecture [0233]–[0253].
It would therefore have been obvious to one of ordinary skill in the art to employ the compatible guide RNA used with the Cpf1-family nuclease of Zhang/WP_087408205 in the dual-molecule or split configuration expressly taught by Murthy. Murthy provides an express suggestion that the guide RNA in a Type V/Cpf1 complex may be a dual-molecule guide RNA. Murthy claim 15 identifies Cpf1 and claim 20 expressly selects the dual-molecule guide configuration from the Cpf1-containing claims. The skilled artisan therefore would have understood the dual-molecule configuration as one of the guide architectures contemplated for a Cpf1-containing Type V nuclease complex. One of ordinary skill would have had a reasonable expectation of success because Murthy expressly places enzymatically active Cpf1 within the Type V system, teaches guide-RNA complex formation with Cpf1, and claims the dual-molecule guide alternative for the Cpf1-containing embodiments [0216–0222 and claims 15–20]. The resulting system comprises a Cpf1/Cas12a protein satisfying the claimed ABW3 homology limitation, a guide sequence capable of hybridizing with the target, formation of a targetable nuclease complex, use with a target sequence in a human cell as taught by Zhang, and the split/dual-molecule gRNA architecture expressly suggested by Murthy, thereby rendering claim 1 obvious.
Regarding claims 22-23, Zhang teaches that in the method of modifying a target RNA where an exogenous RNA template (i.e., editing sequence) is integrated, a break is introduced into the DNA or RNA sequence by the nucleic acid-targeting complex, the break is repaired via homologous recombination with an exogenous RNA template such that the template is integrated into the RNA target of a cell, thereby changing the sequence [0222, 949]. Zhang teaches that the template nucleic acid may include sequence which results in a change in sequence of one or more nucleotides of the target sequence [0640-641].
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019) and Murthy (US 2018/0237800 A1), as applied to claims 1 and 21-22, and further in view of Hotta (WO 2019017321 A1, published 01/24/2019).
The teachings of Zhang, WP_087408205 and Murthy are discussed above as applied to claim 1 and 21-22, and similarly apply to claim 25. Zhang, WP_087408205 and Murthy do not teach where the editing sequence further comprises a mutation in a protospacer adjacent motif (PAM) site.
Hotta teaches a method of genome editing efficiency at HLA-A locus using the CRISP-Cas system [Example 16]. Hotta teaches the use of a single-stranded DNA (HLA-ssODN2; i.e., editing sequence) to edit the HLA-A gene on a chromosome [Example 6]. Hotta teach that the DNA donor was designed to have a point mutation (single base mutation) in the PAM sequence and to prevent re-cleavage by the same gRNA after homologous recombination (i.e., genome editing).
It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the method as taught and suggested by Zhang, WP_087408205 and Murthy where the editing sequence further comprises a mutation in a protospacer adjacent motif (PAM) site. One of ordinary skill would be motivated to make the modification for the advantage of preventing re-cleavage by the same gRNA after genome editing. One of ordinary skill in the art would have a reasonable expectation of success because both systems employ CRISPR-guided cleavage followed by donor-template-mediated sequence modification, and Hotta teaches that alteration of the PAM in the donor prevents renewed recognition/cleavage after editing.
Claim 33 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019) and Murthy (US 2018/0237800 A1), as applied to claim 1, and further in view of Kim (US 20170314016 A1).
The teachings of Zhang, WP_087408205 and Murthy are discussed above as applied to claim 1, and similarly apply to claim 33. Zhang, WP_087408205 and Murthy do not teach where the guide polynucleotide comprises a polynucleotide represented by SEQ ID NO: 127.
Zhang teaches Ortholog specific direct repeats for crRNAs targeting proto-spacer 1 and DNMT1 target 3 comprising TAATTTCTACTCTTGTAGAT (SEQ ID NO, 201) where the Cpf1 derived microorganism direct repeat origin is AsCpf1 [Table 10].
Kim teaches that the crRNA useful in the Cpf1 system containing a Cpf1 protein is represented by the following Formula 3: 5'-n1-n2-A-U-n3-U-C-U-A-C-U-n4-n5-U-U-G-U-A-G-A-U-(Ncpf1)q-3’ [0060]. Kim teaches that n1 is U, A, or G, n2 is A or G, n3 is U, A, or C, n4 is G, C, or A or represents the absence of nucleotide residues, and n5 is A, U, C, or G. [0063]. Kim teaches that Ncpf1 is a targeting sequence region hybridizable with a target region of DNA and is determined depending on the target region of DNA, and q represents an integer number of nucleotides present in the targeting sequence region. Kim teaches available 5'-terminal sequences of the crRNA of Cpf1 protein depending on the microorganism from which Cpf1 was derived to include the Cpf1 derived microorganism AsCpf1 with a crRNA sequence of UAAUUUCUACU-CUUGUAGAU (SEQ ID NO: 7). Kim’s SEQ ID NO: 7 is 100% identical to the instant application SEQ ID NO: 127.
It would be obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the method of Zhang, WP_087408205 and Murthy where the guide polynucleotide comprises a polynucleotide represented by SEQ ID NO: 127. The combination of prior art elements according to known methods to yield predictable results supports can support a conclusion of obviousness. See MPEP 2143(I). One of ordinary skill in the art would have a reasonable expectation of success since both Zhang and Kim each teach a AsCpf1 nucleic acid-guided nuclease system comprising an engineered nucleic acid-guided nuclease and a guide nucleic acid compatible with the nucleic acid-guided nuclease, and a method of modifying target nucleic acids using the system.
Response to Arguments
Applicant’s arguments, see pages 6-7, filed 07/28/2026, with respect to the rejection of under 35 U.S.C. §103(a) as unpatentable over Zhang in view of WP 087408205.1 have been fully considered and are not persuasive in view of the new ground of rejection set forth above. Applicant argues that all presently pending claims now require a split gRNA and that the May 8, 2026 Final Office Action previously identified split-gRNA subject matter as allowable. The Examiner acknowledges that the prior Final stated that, based on the then-applied prior art, Zhang's teaching that Cpf1 does not require tracrRNA did not provide a sufficient reason to employ a split gRNA in Zhang's Cpf1 system. The present rejection, however, is based on a materially different evidentiary record and Murthy explicitly teaches the use of a dual guide that comprises two separate nucleic-acid molecules containing complementary regions that hybridize to form the RNA duplex. Thus, the previous conclusion concerning Zhang alone does not control the present rejection. The deficiency previously identified—lack of a reason to employ a split guide with the Cpf1 system—is now supplied by Murthy's express disclosure and claims.
Applicant's reliance on Zhang's teaching that Cpf1 does not require tracrRNA is likewise not persuasive. A teaching that a component is unnecessary does not necessarily establish that use of the component or a two-molecule guide configuration is inoperative or discouraged in all embodiments. More importantly, Murthy expressly places the dual-molecule guide alternative within claims directed to Cpf1-containing Type V systems. The combined record therefore provides an affirmative suggestion that was absent from the earlier rejection.
Applicant further argues that Hotta and Kim were previously relied upon only for dependent-claim limitations and cannot cure the deficiencies of Zhang and WP_087408205. The Examiner agrees that Hotta and Kim, standing alone, do not provide the newly claimed split-gRNA limitation. The present rejection does not rely upon them to do so. Murthy is relied upon to supply the split/dual-molecule guide architecture. Hotta remains relied upon only for the PAM-site mutation of claim 25, and Kim remains relied upon only for the particular guide sequence recited as one alternative in claim 33.
Applicant also points to the amendment of claim 1 to encompass additional ABW sequences. The amendment does not overcome the rejection of claims 1 and 2 because the claims are drafted in the alternative. It is unnecessary for the prior art to teach a nuclease satisfying every listed ABW alternative. WP_087408205 satisfies the ABW3 branch because the protein is 95% identical to SEQ ID NO:29, thereby satisfying both the ≥85% requirement of claim 1 and the ≥95% requirement of claim 2.
Applicant's arguments are therefore not persuasive with respect to claims 1–2, 21–23, 25 and 33 in view of the new combination of references.
Allowable Subject Matter
The following is a statement of reasons for the indication of allowable subject matter: Zhang nor the prior art does teach a polypeptide sequence having at least 85-99% homology to a polypeptide sequence consisting of SEQ ID NO: 55 (ABW5) or 68 (ABW6). Zhang nor the prior art teach a polypeptide sequence having at least 99% homology to a polypeptide sequence consisting SEQ ID NO: 94 (ABW8), 81 (ABW7), and 42 (ABW4), SEQ ID NO: 29 (ABW3), 107 (ABW9), and SEQ IS NO: 16 (ABW2). Furthermore, the prior does not teach a guide polynucleotide the comprises a polynucleotide by sequence consisting of SEQ ID NO: 120, 126, 118, 119, 121, 122, or 123 or a reason to use these SEQ ID NOs as a guide nucleotide in a nucleic acid-guided nuclease system.
Therefore, claims 3, 8-10, 13, and 15 are allowable.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY N GROOMS whose telephone number is (571)272-3771. The examiner can normally be reached M-F 830-530.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
//TIFFANY NICOLE GROOMS/ Examiner, Art Unit 1637
Prosecution Insights