Prosecution Insights
Last updated: May 29, 2026
Application No. 17/780,002

CONSTRUCTS, COMPOSITIONS AND METHODS THEREOF HAVING IMPROVED GENOME EDITING EFFICIENCY AND SPECIFICITY

Final Rejection §103
Filed
May 25, 2022
Priority
Nov 27, 2019 — provisional 62/941,392 +1 more
Examiner
GROOMS, TIFFANY NICOLE
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Danmarks Tekniske Universitet
OA Round
4 (Final)
59%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
104 granted / 177 resolved
-1.2% vs TC avg
Strong +45% interview lift
Without
With
+45.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
24 currently pending
Career history
217
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
50.7%
+10.7% vs TC avg
§102
6.1%
-33.9% vs TC avg
§112
7.3%
-32.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 177 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status The Amendments and Remarks filed 05 December 2025 are acknowledged and have been entered. Claims 1 and 21 are amended. Claims 4-6, 11-12, 14, 16-20, and 26-32 are cancelled. Claims 1-3, 7-10, 13, 15, 21-25, and 33-34 are pending and are being examined on the merits. Priority The instant application is a 371 PCT of application US2020/061850 filed 11/23/2020 that claims priority to application 69/941,392 filed 11/27/2019. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 7, and 21-23 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019). This claims is modified in view of applicant’s claim amendments. Regarding claims 1-2, and 21, Zhang teaches an engineered, non-naturally occurring CRISPR associated (Cas) (CRISPR-Cas) system (a) comprising one or more Type V CRISPR-Cas polynucleotide sequences comprising a guide RNA which comprises a guide sequence linked to a direct repeat sequence, wherein the guide sequence is capable of hybridizing with a target sequence, or one or more nucleotide sequences encoding the one or more Type V CRISPR-Cas polynucleotide sequences, and (b) a Cpf1 nuclease effector protein, or one or more nucleotide sequences encoding the Cpf1 effector protein; wherein the one or more guide sequences hybridize to said target sequence, said target sequence is 3' of a Protospacer Adjacent Motif (PAM), and said guide RNA forms a complex with the Cpf1 effector protein [0174, 1760-1763]. Zhang teaches that the invention also provides for the effector protein (e.g., a Cpf1) comprising an effector protein (e.g., a Cpf1) from an organism from a genus comprising Lachnospiraceae MC2017 [0037]. Zhang teaches a method of modifying sequences associated with or at a target locus of interest, the method comprising delivering to said sequences associated with or at the locus a non-naturally occurring or engineered composition comprising a Cpf1 loci effector protein and one or more nucleic acid components (such as crRNA, guide RNA, or single guide RNA), wherein the Cpf1 effector protein forms a complex with the one or more nucleic acid components and upon binding of the said complex to the locus of interest the effector protein induces the modification of the sequences associated with or at the target locus of interest [0012, 0200]. Zhang teaches that the target locus of interest may be comprised in a DNA molecule within a human cell [0018]. Zhang does not teach where the Cpf1 effector protein comprises a polypeptide sequence having at least 95% homology to a polypeptide sequence consisting of SEQ ID NO: 29. Zhang does teach that the diversity of Cpf1-family proteins available in the public sequences databases wase exploited [1738]. Zhang teaches that a BLAST search of the WGS database at the NCBI revealed 46 non-redundant Cpf1-family proteins [1738]. Zhang teaches that CRISPR repeats can be identified using PILER-CR and CRISPR-finder and that the spacer sequences can be searched against the NCRI nucleotide database using MEGABLAST [1726-27; 209]. WP_087408205 teaches a type V CRISPR-associated protein Cpf1 protein sequence that is 100% identical to 95% of SEQ ID NO:29, thereby teaching a sequence that is 95% identical to SEQ ID NO: 29. It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the system of Zhang by searching and identifying a guide nucleotide sequence that works with the Cpf1 nuclease effector protein identified by WP_087408205 to facilitate use in the method of Zhang. One of ordinary skill would be motivated to make the modification with a reasonable expectation of success because Zhang teaches the ability to search databases for Cpf1 proteins and usable spacers sequence. Regarding claims 7, Zhang teaches that the system may include a DNA or RNA-targeting guide RNA comprising a CRISPR RNA (crRNA) sequence and a trans-activating CRISPR Cas system RNA (tracrRNA) sequence (i.e., a split gRNA) [0186]. Regarding claims 22-23, Zhang teaches that in the method of modifying a target RNA where an exogenous RNA template (i.e., editing sequence) is integrated, a break is introduced into the DNA or RNA sequence by the nucleic acid-targeting complex, the break is repaired via homologous recombination with an exogenous RNA template such that the template is integrated into the RNA target of a cell, thereby changing the sequence [0222, 949]. Zhang teaches that the template nucleic acid may include sequence which results in a change in sequence of one or more nucleotides of the target sequence [0640-641]. Claims 24 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019), as applied to claims 1 and 21-22, and further in view of Blaskowski (WO 2019/157326 A1, 8/15/2019). The teachings of Zhang and WP_087408205 are discussed above as applied to claim 1 and 21-22, and similarly apply to claim 24. Zhang and WP_087408205 do not teach where the guide nucleic acid and the editing template are provided as a single nucleic acid. Blaskowski teaches CRISPR/Cas9 genome editing and teaches the introducing of polynucleotides using a guide RNA and a corresponding donor polynucleotide (i.e., editing sequence) encoded together on a single plasmid [0148, 0150, 0157]. It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the method as taught and suggested by Zhang and WP_087408205 where the guide nucleic acid and the editing template are provided as a single nucleic acid. The combination of prior art elements according to known methods to yield predictable results supports can support a conclusion of obviousness. See MPEP 2143(I). One of ordinary skill in the art would have a reasonable expectation of success since both Zhang and Blaskowski each teach a method of modifying target nucleic acids by introducing editing polynucleotides into a target polynucleotide using Cas nucleases, guide RNAs and an editing template. Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019), as applied to claims 1 and 21-22, and further in view of Hotta (WO 2019017321 A1, published 01/24/2019). The teachings of Zhang and WP_087408205 are discussed above as applied to claim 1 and 21-22, and similarly apply to claim 25. Zhang and WP_087408205 do not teach where the editing sequence further comprises a mutation in a protospacer adjacent motif (PAM) site. Hotta teaches a method of genome editing efficiency at HLA-A locus using the CRISP-Cas system [Example 16]. Hotta teaches the use of a single-stranded DNA (HLA-ssODN2; i.e., editing sequence) to edit the HLA-A gene on a chromosome [Example 6]. Hotta teach that the DNA donor was designed to have a point mutation (single base mutation) in the PAM sequence and to prevent re-cleavage by the same gRNA after homologous recombination (i.e., genome editing). It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the method as taught and suggested by Zhang and WP_087408205 where the editing sequence further comprises a mutation in a protospacer adjacent motif (PAM) site. One of ordinary skill would be motivated to make the modification for the advantage of preventing re-cleavage by the same gRNA after genome editing. One of ordinary skill in the art would have a reasonable expectation of success since both Zhang and Hotta each teach a method of modifying target nucleic acids by introducing editing polynucleotides into a target polynucleotide using CRISPR-Cas systems and an editing template. Claim 33 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (US 2018/0155716 A1, 6/7/2018) in view of WP_087408205.1 (Accession WP_087408205; type V CRISPR-associated protein Cas12a/Cpf1 [Barnesiella sp. An22]; 10/13/2019), as applied to claim 1, and further in view of Kim (US 20170314016 A1). The teachings of Zhang are discussed above as applied to claim 1, and similarly apply to claim 33. Zhang do not teach where the guide polynucleotide comprises a polynucleotide represented by SEQ ID NO: 127. Zhang teaches Ortholog specific direct repeats for crRNAs targeting proto-spacer 1 and DNMT1 target 3 comprising TAATTTCTACTCTTGTAGAT (SEQ ID NO, 201) where the Cpf1 derived microorganism direct repeat origin is AsCpf1 [Table 10]. Kim teaches that the crRNA useful in the Cpf1 system containing a Cpf1 protein is represented by the following Formula 3: 5'-n1-n2-A-U-n3-U-C-U-A-C-U-n4-n5-U-U-G-U-A-G-A-U-(Ncpf1)q-3’ [0060]. Kim teaches that n1 is U, A, or G, n2 is A or G, n3 is U, A, or C, n4 is G, C, or A or represents the absence of nucleotide residues, and n5 is A, U, C, or G. [0063]. Kim teaches that Ncpf1 is a targeting sequence region hybridizable with a target region of DNA and is determined depending on the target region of DNA, and q represents an integer number of nucleotides present in the targeting sequence region. Kim teaches available 5'-terminal sequences of the crRNA of Cpf1 protein depending on the microorganism from which Cpf1 was derived to include the Cpf1 derived microorganism AsCpf1 with a crRNA sequence of UAAUUUCUACU-CUUGUAGAU (SEQ ID NO: 7). Kim’s SEQ ID NO: 7 is 100% identical to the instant application SEQ ID NO: 127. It would be obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to modify the method of Zhang where the guide polynucleotide comprises a polynucleotide represented by SEQ ID NO: 127. The combination of prior art elements according to known methods to yield predictable results supports can support a conclusion of obviousness. See MPEP 2143(I). One of ordinary skill in the art would have a reasonable expectation of success since both Zhang and Kim each teach a AsCpf1 nucleic acid-guided nuclease system comprising an engineered nucleic acid-guided nuclease and a guide nucleic acid compatible with the nucleic acid-guided nuclease, and a method of modifying target nucleic acids using the system. Response to Arguments Applicant’s arguments, see pages 6-9, filed 08 December 2025, with respect to the rejection of claims 1-2, 5, 7, 21-23, 26, 27, 29 and 34 under 35 U.S.C. §103(a) as unpatentable over Zhang in view of WP 087408205.1 have been fully considered and are not persuasive. Applicant’s argue that there is nothing in WP_ 087408205 that teaches a functional nuclease capable of complexing with a guide nucleic acid to form a functional nucleic acid guided nuclease complex capable of targeting sequences in human cells. Applicant’s argue that WP _087408205 merely provides a predicted amino acid sequence of a hypothetical protein. WP_ 087408205 is a NCBI Reference Sequence named type V CRISPR-associated protein Cas12a/Cpf1, and therefore does not qualify as a hypothetical sequence. The current specification teaches that SEQ ID NO: 29, or ABW3, demonstrates editing of genes in Jurkat cells. Given that WP_ 087408205 is 95% identical to a known functional nuclease, a skilled artisan would be motivated to use WP_ 087408205 with a reasonable expectation of success that this would lead to a functional nucleic acid-guided nuclease system in the method of Zhang and as claimed. In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Applicant’s argue that in view of Zetsche, it is clear that a person skilled in the art would not have had a reasonable expectation of success for modifying Zhang by employing the hypothetical nuclease of WP_ 087408205 and identifying a compatible guide, to arrive at the subject matter of the amended claims. Applicant’s arguments are not persuasive as applicant’s have not provided any sequence analogy of the 16 tested Cpf1 orthologs in comparision to Cpf1 proteins known to be capable of forming functional nucleic-acid guided nuclease complexes in human cells. Furthermore Joyce (priority document teaches 62893893) teaches WP_ 087408205 as SEQ ID NO: 66 and teaches that SEQ ID NO: 66 is a mutant Cas12 polypeptides with enhanced protein function in comparison to the wild-type Cas12 polypeptide [0007-0008]. Allowable Subject Matter The following is a statement of reasons for the indication of allowable subject matter: Zhang nor the prior art does teach a polypeptide sequence having at least 85-99% homology to a polypeptide sequence consisting of SEQ ID NO: 55 (ABW5) or 68 (ABW6). Zhang nor the prior art teach a polypeptide sequence having at least 99% homology to a polypeptide sequence consisting SEQ ID NO: 94 (ABW8), 81 (ABW7), and 42 (ABW4), SEQ ID NO: 29 (ABW3), 107 (ABW9), and SEQ IS NO: 16 (ABW2). Furthermore, the prior does not teach a guide polynucleotide the comprises a polynucleotide by sequence consisting of SEQ ID NO: 120, 126, 118, 119, 121, 122, or 123 or a reason to use these SEQ ID NOs as a guide nucleotide in a nucleic acid-guided nuclease system. Additionally, the giving Zhang’s teaching that in the Cpf1 DNA targeting RNA-guided endonuclease systems described herein, a tracrRNA sequence is not required, a skilled artisan would have not been motivated to use a split gRNA in the system of Zhang. Therefore, claims 3, 8-10, 13, 15 and 34 are allowable. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY N GROOMS whose telephone number is (571)272-3771. The examiner can normally be reached M-F 830-530. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. //TIFFANY NICOLE GROOMS/ Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Show 3 earlier events
Nov 15, 2024
Examiner Interview (Telephonic)
Dec 11, 2024
Request for Continued Examination
Dec 13, 2024
Response after Non-Final Action
Feb 12, 2025
Non-Final Rejection mailed — §103
May 06, 2025
Response Filed
Aug 11, 2025
Non-Final Rejection mailed — §103
Dec 08, 2025
Response Filed
May 08, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12617832
GENETIC ENGNEERING OF B CELL RECEPTORS AND USES THEREOF IN ANTIGEN-INDUCED ANTIBODY SECRETION
5y 1m to grant Granted May 05, 2026
Patent 12577574
ULTRASPECIFIC RIBOREGULATORS HAVING ROBUST SINGLE-NUCLEOTIDE SPECIFICITY AND IN VITRO AND IN VIVO USES THEREOF
2y 10m to grant Granted Mar 17, 2026
Patent 12570966
MUTATED PIGGYBAC TRANSPOSASE
4y 9m to grant Granted Mar 10, 2026
Patent 12565666
METHODS AND COMPOSITIONS FOR MODULATING A GENOME
3y 6m to grant Granted Mar 03, 2026
Patent 12553038
DELIVERY OF THERAPEUTICS IN VIVO VIA A CRISPR-BASED CASCADE SYSTEM
1y 9m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+45.3%)
3y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 177 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month