Prosecution Insights
Last updated: April 19, 2026
Application No. 17/781,797

Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels

Final Rejection §112
Filed
Dec 12, 2022
Examiner
KALLIS, RUSSELL
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Altria Client Services LLC
OA Round
2 (Final)
87%
Grant Probability
Favorable
3-4
OA Rounds
2y 6m
To Grant
95%
With Interview

Examiner Intelligence

Grants 87% — above average
87%
Career Allow Rate
1003 granted / 1153 resolved
+27.0% vs TC avg
Moderate +8% lift
Without
With
+7.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
13 currently pending
Career history
1166
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
13.0%
-27.0% vs TC avg
§102
20.1%
-19.9% vs TC avg
§112
50.2%
+10.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1153 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 151-155 and 158-172 are pending and examined. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d) (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 152 and 163 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 151 recites that the tobacco plant “comprises an endogenous polynucleotide having a nucleic acid sequence encoding a polypeptide having an amino acid sequence of SEQ ID NO: 44”. The specification defines SEQ ID NO: 44 as a polypeptide found in Nicotiana tabacum and that “the endogenous polynucleotide encoding SEQ ID NO: 44” from Nicotiana tabacum comprises sequences SEQ ID NO: 8 and SEQ ID NO: 26, that are reference sequences as defined in the specification in [0043] on page 9 in lines 8-11. Both claims 152 and 163 recite that “the endogenous polynucleotide” (of claim 151) has 95% sequence identity to the polynucleotide sequence of SEQ ID NO: 8 or 26 which are “nucleic acid sequences encoding a polypeptide having the amino acid sequence of SEQ ID NO: 44” recited in claim 151, and are both inherently “an endogenous sequence” as recited in claim 151; and thus the polynucleotide sequence having at least 95% sequence identity to SEQ ID NO: 8 or 26 (recited in claims 152 and 163) is broader in scope than a polynucleotide sequence encoding SEQ ID NO: 44, and claims 152 and 163 fail to further limit claim 151. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Applicant’s Arguments Applicants assert that 37C.F.R. §1.75 clearly asserts that “claims in dependent form shall be construed to include all the limitations of the claim incorporated by reference into the dependent claim.” Since dependent claims 152 and 163 recite the limitations of SEQ ID NO: 8 and 26, then SEQ ID NO: 8 and 26 are relevant features of claim 151 as stated supra. Applicants’ assertion that reciting 95% identity to SEQ ID NO: 8 or 26 is further limiting “the endogenous polynucleotide” encoding SEQ ID NO: 44 of the Nicotiana tabacum plant of claim 151 is not persuasive because SEQ ID NO: 8 and 26 are “an endogenous polynucleotide” that are inherent structural features of the plant of claim 151. Applicants are claiming “the endogenous polynucleotide” having 95% identity to “the endogenous polynucleotide” or itself. Applicants assert that claim 151 recites many different nucleic acid sequences due to the codon degeneracy is not persuasive because claim 151 is limited to “a reference sequence” that is “the endogenous sequence” encoding the polypeptide of SEQ ID NO: 44. Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 151-155 and 158-172 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “non-natural mutation” in claim 151 is a relative term which renders the claim indefinite. The term “non-natural mutation” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Non-natural mutation is not defined with respect to any particular alteration in a reference sequence and is indistinguishable from ‘natural mutation’ because both “natural” and “non-natural” are structurally agnostic to the method by which the mutation arises and either would potentially lead to a modified plant having reductions in activity or expression, or reductions in levels of nicotine relative to a control plant; and thus does not set forth the metes and bounds of the invention sufficient to notify the public of possible infringement. Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 151-155 and 158-172 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are broadly drawn to a modified tobacco plant having any number of unspecified mutations in the polynucleotide encoding the polypeptide of SEQ ID NO: 44 whereby the expression or activity of the polypeptide is reduced or the level of nicotine is decreased and tobacco products thereof. Applicant have claimed modified tobacco plants having any number of mutations in the endogenous gene encoding SEQ ID NO: 44 resulting in a reduction in the expression or activity of said gene. However, Applicants have not described which amino acid residues in SEQ ID NO: 44 that would result in a degree of reduction of gene expression or activity sufficient to reduce alkaloid or nicotine levels or tobacco plants or tobacco products modified thereof. This claim is a “reach-through” claim in which the Applicant has described a starting material and at least one method step, however, they have not described the resulting product; and the genus of products that can be produced by the recited methods and materials is so large that one of skill in the art is not able to envision the members of the genus. (See Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 920-23, 69 USPQ2d 1886, 1890-93 (Fed. Cir. 2004)). Applicants only provide modified tobacco plants having been transformed with RNAi AO-1 and AO-2 constructs that showed reduced expression, alkaloids and nicotine (see figures 5-9). Applicants have not modified the amino acid structure of SEQ ID NO: 44. Applicants assert that Claims 152 and 163 further limit claim 151 by reciting that the nucleic acid sequence is 95% identical to a nucleic acid sequence to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 8 and 26 (page 2 of remarks filed 12/10/2025). The genus of endogenous polynucleotides having 95% sequence identity to SEQ ID NO: 26 encompasses polynucleotide sequences not encoding SEQ ID NO: 44 (see alignment below of endogenous Nicotiana tabacum polynucleotide sequence of SEQ ID NO: 66 from U.S. Patent 12239090 aligned against instant SEQ ID NO: 26). Query SEQ 66 US12239090 vs Subject SEQ26 of 17781797 (95.87% Identity) Range 1: 1 to 1938 Score:3133 bits(3474), Expect:0.0, Identities:1858/1938(96%), Gaps:3/1938(0%), Strand: Plus/Plus Query 1 ATGGCAACTGGTATCGCTTCAGGAAGCGGACAGTTACATTTGAGGAAGCCTGTCTACTGG 60 Sbjct 1 ......................T..................................... 60 Query 61 AGGAGTAGCTATGGAAAAGCTCACTGTCATTCCAATGCGATCCTGAATGGCATGCAAAAC 120 Sbjct 61 .......................G.............T...................... 120 Query 121 CAGATCCCTTGGTCTTATTGGGTTTCCAAATTCTTGCGAGTTCATAGAAGTAACTACTCA 180 Sbjct 121 ........................................................T... 180 Query 181 CAATGTCAAGTGAAAACAAACTGGAAGTCTCACACCGGAACAATCAATTCTTGCCAGAGA 240 Sbjct 181 ..................................G......................... 240 Query 241 GATGGCTCAACTAGGTATTTTGATTTTGCTGTGATTGGTAGTGGAATTGCTGGCCTTAGA 300 Sbjct 241 ....................C.....C..G...........................C.. 300 Query 301 TATGCTCTAGAAGTTGCAAAGCATGGAACTGTAGCTGTGATAACCAAGGCTGAGCCTCAT 360 Sbjct 301 ........T........C..A..........................A........A... 360 Query 361 GAGAGTAACACTAACTATGCTCAAGGTGGTGTAAGTGCTGTGTTCTGCCCTATGGATTCA 420 Sbjct 361 ..........................................C................. 420 Query 421 GTGGAGAGCCACATGCAAGACACAATTGTGGCAGGTGCTTACCTCTGTGATGAGGAGACT 480 Sbjct 421 ....................T........T.............................. 480 Query 481 GTTAGAGTTGTGTGTACCGAAGGACCTGAGAGAATTAGAGAACTGATTGCTATGGGTGCT 540 Sbjct 481 .....................................A...................... 540 Query 541 TCATTCGATCATGGGGAGGACGGGAATCTGCATCTAGCCAGGGAAGGGGGCCACTCCCAT 600 Sbjct 541 ....................T..A.................................... 600 Query 601 CGTCGAATTGTCCATGCTGCTGATATGACTGGCAGAGAGATAGAAAGGGCCCTATTAGAG 660 Sbjct 601 ............................................................ 660 Query 661 GCAGTTTTTAAGCATCCTAATATACATGTGTTTCAACACCATTTTGCTATAGATTTTTTG 720 Sbjct 661 ........................................................G... 720 Query 721 ACCACTCAGGATGGTTCTGACATAATATGTCATGGCGTTGATGCTATAAACACGGAAACG 780 Sbjct 721 ........................G.................A................A 780 Query 781 CAGGAAGTTATAAGATTCATTTCAAAAGTGACTTTGCTGGCATCAGGTGGAGCTGGGCAT 840 Sbjct 781 .....G...................................................... 840 Query 841 ATCTATCCAAGTACTACTAATCCACCGGTTGCAACTGGAGATGGAATGGCTATGGCTCAT 900 Sbjct 841 .C......T..............G.................................... 900 Query 901 CGAGCTCAAGCTGTAATTTCCAACATGGAGTTTGTGCAATTCCATCCAACTGCCTTGGCT 960 Sbjct 901 ....................T.......................C.....C..T...... 960 Query 961 GATGAAGGCCTTCCCAACAGAC---CAAGTGCCAGAGAGAATGCTTTTTTGATAACTGAA 1017 Sbjct 961 ................T.....CAA....AA..........C.................. 1020 Query 1018 GCTGTCAGAGGTGATGGAGGCATCCTTTACAACTTAGATATGGAGAGATTTATGCCAATG 1077 Sbjct 1021 ............................................................ 1080 Query 1078 TATGACAAAAGAGCAGAGCTTGCCCCGAGAGATGTGGTAGCAAGAAGTATAGATGACCAG 1137 Sbjct 1081 .....TG..................................................... 1140 Query 1138 CTCAAAAAGCGTGGCGAAAAGTATGTTCTTCTTGATATCAGTCACAAGCCCAGAGAGAAG 1197 Sbjct 1141 ..............T...........................T........C........ 1200 Query 1198 GTTCTGTCTCATTTTCCTAATATAGCTGCTGAGTGTCTCCGCCATGGGTTAGACATAACA 1257 Sbjct 1201 .....T...................................................... 1260 Query 1258 CAGCAGCCGATTCCGGTGGTTCCTGCTGCTCACTACATGTGTGGTGGAGTTCGTGCTGGA 1317 Sbjct 1261 ..............A...................................C......... 1320 Query 1318 CTTGAGGGTGAGACTAATGTGCAAGGCCTTTATGTGGCAGGTGAAGTTGCATGTACTGGT 1377 Sbjct 1321 ..C..............C.....T..T................................. 1380 Query 1378 TTACATGGTGCTAACCGACTTGCTAGCAACTCGTTGCTTGAAGCACTAGTGTTTGCACGA 1437 Sbjct 1381 ...........G................................................ 1440 Query 1438 AGAGCTGTACAACCTTCAATTGATCACGTGAATGTGTCTAGAATTGATCACTGTGCTTCA 1497 Sbjct 1441 ...........G...............A.......................G........ 1500 Query 1498 AGTTGGTGGCCGCGACCTGTAGCCCCAGTGGTAATAGGAGATACAGTACTTAACAAAGTC 1557 Sbjct 1501 .........T....G........T..CA..T..C...............A.GG....... 1560 Query 1558 ATTCGTCGGACAAGGGAAGTGAGGAAAGAACTACAGTCAATCATGTGGGAATATGTTGGA 1617 Sbjct 1561 ....AC..............A...........G........................... 1620 Query 1618 ATTGTTAGGTCTACCTCAAGACTAACCGCAGCTGAGAAGAGAATCAATGAGTTGGAGTTG 1677 Sbjct 1621 ..............................................GA............ 1680 Query 1678 GAATGGGAAACATACCTATTTCAGCATGGCTGGGAACCAACAATGGTTGGACTAGAGGCT 1737 Sbjct 1681 ...................................................G........ 1740 Query 1738 TGTGAGATGAGGAATCTCTTCTGTTGTGCCAACCTGGTAGTTAGCAGTGCTCTTTCTCGA 1797 Sbjct 1741 ...........................................A................ 1800 Query 1798 CACGAGAGTCGCGGGCTTCATTACACCATTGATTTTCCTCATGTTGTGGAAAGCAAGAGG 1857 Sbjct 1801 ..............T...............................A.........A... 1860 Query 1858 TTGCCAACAATCATTTTTCCTTCACAGCGAAATAGCTCGTGGAGCTCACGGCAATTACAC 1917 Sbjct 1861 ........G...........G.................A........G............ 1920 Query 1918 AGGCAGCAGATATGTTAG 1935 Sbjct 1921 .................. 1938 Applicants further assert that the genus of polynucleotide sequences encoding SEQ ID NO: 44 can be envisioned by one of ordinary skill by means of codon redundancy to obtain variants by back translating from the polypeptide sequence of SEQ ID NO: 44 (see page 2 of remarks filed 12/10/2025). This is not persuasive because the claims are limited to an endogenous sequence that is subject to a species-specific codon bias, which Applicants have not considered in their claim construction and remarks. Therefore, given the lack of written description in the specification with regard to the structural characteristics of the claimed mutant coding sequences and modified tobacco plant, it is evident that Applicant was not in possession of the claimed genus at the time this application was filed. See Written Description guidelines provided in MPEP 2163. Given the claim breadth and lack of guidance as discussed above, the specification does not provide a written description of the genus as broadly claimed. Accordingly, one skilled in the art of tobacco breeding would not have recognized Applicant to have been in possession of the broadly claimed invention at the time of filing. All claims are rejected. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL KALLIS whose telephone number is (571)272-0798. The examiner can normally be reached Monday-Friday 8AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 5712707058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUSSELL KALLIS/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Dec 12, 2022
Application Filed
Sep 06, 2025
Non-Final Rejection — §112
Dec 10, 2025
Response Filed
Mar 12, 2026
Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599085
SOYBEAN VARIETY
2y 5m to grant Granted Apr 14, 2026
Patent 12599096
SOYBEAN CULTIVAR 24360225
2y 5m to grant Granted Apr 14, 2026
Patent 12593794
SOYBEAN CULTIVAR 27080914
2y 5m to grant Granted Apr 07, 2026
Patent 12593801
SOYBEAN CULTIVAR 21031508
2y 5m to grant Granted Apr 07, 2026
Patent 12593802
SOYBEAN CULTIVAR 21120033
2y 5m to grant Granted Apr 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
87%
Grant Probability
95%
With Interview (+7.8%)
2y 6m
Median Time to Grant
Moderate
PTA Risk
Based on 1153 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month