Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
This action is in response to the papers filed September 5, 2025.
Amendments
Applicant's response and amendments, filed September 5, 2025, is acknowledged. Applicant has cancelled Claims 1-2, 4-14, 16, 18-19, 21, 23-28, 30-34, 36, 38-39, 41-45, 47-48, and 50-59, amended Claims 3, 15, 17, 20, 22, 29, 35, 37, 40, 46, and 49, and added new claims, Claims 60-66.
Claims 3, 15, 17, 20, 22, 29, 35, 37, 40, 46, 49, and 60-66 are pending.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on September 5, 2025 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Allowable Subject Matter
1. Claims 20 and 40 recite allowable subject matter.
The following is a statement of reasons for the indication of allowable subject matter:
Claims 20 and 40 recite the nucleotide sequence of SEQ ID NO:10, which appears to be a codon-optimized nucleotide sequence encoding human VPS35 composed of the amino acid sequence of SEQ ID NO:1.
Lucking et al (U.S. 2014/0371098) is considered relevant prior art for having disclosed a cDNA encoding human VPS35 (SEQ ID NO:892; Table A) which is 97% identical to instant SEQ ID NO:10 (upper line), encodes an amino acid sequence that is 100% identical to instant SEQ ID NO:1, and comprises 42 disparate mismatches, examples of which are shown below:
Qy 61 CAGGCTGTGAAGGTCCAGTCATTCCAAATGAAGAGATGCCTGGACAAAAACAAGCTCATG
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Db 61 CAGGCTGTGAAGGTCCAGTCATTCCAAATGAAGAGATGCCTGGACAAAAACAAGCTTATG
Qy 301 GCTGGAAACATTATCCCAAGGCTTTACCTTCTGATCACAGTTGGAGTTGTATATGTCAAG
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Db 301 GCTGGAAACATTATCCCAAGGCTTTACCTTTTGATCACAGTTGGAGTTGTATATGTCAAG
Qy 361 TCATTTCCTCAGTCCAGGAAGGATATTCTGAAAGATTTGGTAGAAATGTGCCGTGGTGTG
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Db 361 TCATTTCCTCAGTCCAGGAAGGATATTTTGAAAGATTTGGTAGAAATGTGCCGTGGTGTG
Qy 541 GATTTCGTACTGCTCAACTTTGCAGAAATGAACAAGCTCTGGGTGCGAATGCAGCATCAG
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 GATTTTGTACTGCTCAACTTTGCAGAAATGAACAAGCTCTGGGTGCGAATGCAGCATCAG
Qy 781 TATCTCATGGAGTGTATTATTCAGGTATTCCCTGATGAATTTCACCTCCAGACTTTGAAT
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Db 781 TATCTCATGGAGTGTATTATTCAGGTTTTCCCTGATGAATTTCACCTCCAGACTTTGAAT
Qy 841 CCTTTCCTTCGGGCCTGTGCTGAGTTACACCAGAATGTAAATGTGAAGAACATAATCATT
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 CCTTTTCTTCGGGCCTGTGCTGAGTTACACCAGAATGTAAATGTGAAGAACATAATCATT
Qy 1201 CTATTGAAAATACCAGTTGACACTTACAACAATATATTAACAGTCTTGAAATTAAAACAT
|| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Db 1201 CTTTTGAAAATACCAGTTGACACTTACAACAATATTTTAACAGTCTTGAAATTAAAACAT
Qy 1261 TTCCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTG
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1261 TTTCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTG
Qy 1321 CTTAGTAATGTTCTGGATTATAACACAGAAATTGTATCTCAAGACCAGGTGGATTCCATA
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Db 1321 CTTAGTAATGTTCTGGATTATAACACAGAAATTGTCTCTCAAGACCAGGTGGATTCCATA
Qy 1501 GAGGACCCTGACCAGCAGTACTTGATATTGAACACAGCACGAAAACATTTCGGAGCTGGT
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Db 1501 GAGGACCCTGACCAGCAGTACTTGATTTTGAACACAGCACGAAAACATTTTGGAGCTGGT
Qy 1801 ACAGTCGCATATGAATTCATGTCCCAGGCATTCTCTCTGTATGAAGATGAAATCAGCGAT
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Db 1801 ACAGTCGCATATGAATTCATGTCCCAGGCATTTTCTCTGTATGAAGATGAAATCAGCGAT
Qy 2341 CGGGAATCACCAGAATCCGAGGGGCCAATTTATGAAGGACTCATCCTTTAA 2391
|||||||||||||||||||||||||||||||||||||| ||||||||||||
Db 2341 CGGGAATCACCAGAATCCGAGGGGCCAATTTATGAAGGTCTCATCCTTTAA 2391
The prior art does not appear to teach or fairly suggest the codon-optimized nucleotide sequence of SEQ ID NO:10.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
2. The prior rejections of Claims 9, 11, and 13 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, are withdrawn in light of Applicant’s cancellation of the claims.
3. The prior rejection of Claims 3, 7-9, 11, 13-14, and 59 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendments to Claim 3 cancelling recitation of “a therapeutically effective amount”.
4. Claims 3, 15, 17, 20, 22, 29, 35, 37, 40, 46, 49, and 60-66 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 3 and 35 have been amended to recite the step of introducing into a neuronal cell at least one vector comprising:
i) a transgene encoding retromer core protein VPS35, and
ii) a transgene encoding retromer core protein VPS26a (Claim 3) or VPS26b (Claim 35) [structure],
wherein, when the one or more vectors are introduced into the neuronal cell:
(a) the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) are increased in the neuronal cell relative to the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell, thereby increasing retromer function [function 1]; and/or
(b) the levels of Sorl1 are increased in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell [function 2], thereby increasing retromer function.
The claims also denote that there is an amount (syn. dosage) of the nucleic acid vectors and/or one or more presently unrecited transcriptional regulatory elements operably linked to the first and second transgenes, respectively, that upon introduction into the neuronal cell, is not, in fact, effective or able to achieve the first and/or second recited functional properties, thereby increasing retromer function.
The breadth of the claims encompasses neuronal cells present in both in vivo/in situ contexts and in vitro cell culture contexts.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The claimed functional properties are dependent upon many different variable parameters, including, but not limited to:
the type of subject [parameter 1] human or non-human animal to be treated;
the type of nucleic acid vector [parameter 2];
the structure and functional properties of the VPS35, VPS26a, and/or VPS26b protein variants [parameter 3];
the structure(s) of regulatory element(s) [parameter 4];
the administration route [parameter 5];
the dosage administered [parameter 6]; and
the phenotypic response to be achieved [parameter 7].
The claims also denote that there is an amount (syn. dosage) of the nucleic acid vectors and/or one or more presently unrecited transcriptional regulatory elements operably linked to the first and second transgenes, respectively, that upon introduction into the neuronal cell, is not, in fact, effective or able to achieve the first and/or second recited functional properties, thereby increasing retromer function.
Parameter 1
The claims are broad for reasonably encompassing an enormous genus of human and non-human animals, including mammals (pg 45, last para).
The claims are broad for encompassing about 1,000,000 species of animals (Kingdoms of Life, waynesword.palomar.edu/trfeb98.htm, last visited April 8, 2021), wherein the mammalian sub-genus reasonably encompasses some 6,400 species (including humans), distributed in about 1,200 genera, about 152 families and about 29 orders (Mammal, en.wikipedia.org/wiki/Mammal, last visited August 31, 2022).
Parameter 2
The claimed methods are recited at a high level of generality for type of nucleic acid vector encoding the therapeutic VPS35, VPS26a, and/or VPS26b proteins, said vectors including, but not limited to plasmids, transposons, bacteriophages, cosmids, chromosomes, artificial chromosomes, viruses (pg 22, last para), dendrimers, nanoparticles, liposomes, exosomes, or other synthetic vesicles (pg 9, para 2).
Parameter 3
The claimed methods are broad for reciting an enormously vast genus of structurally and functionally undisclosed:
VPS35 polypeptide variants; and/or
VPS26a polypeptide variants; and/or
VPS26b polypeptide variants.
The specification discloses (e.g. pg 4, last para) the polypeptide may have as little as 85% identity to a reference SEQ ID NO.
VPS35 SEQ ID NO:2 is 796 amino acids in length.
VPS26a SEQ ID NO:3 is 327 amino acids in length.
VPS26b SEQ ID NO:4 is 336 amino acids in length.
85% identity allows for as many as about 119 and 50 amino acid insertions, deletions, and/or substitutions anywhere within SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively.
90% identity allows for as many as about 80 and 33 amino acid insertions, deletions, and/or substitutions anywhere within SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively.
95% identity allows for as many as about 40 and 17 amino acid insertions, deletions, and/or substitutions anywhere within SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively.
20^120 = about 1x10^156 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
20^80 = about 1x10^104 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
20^50 = about 1x10^65 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
20^40 = about 1x10^52 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
20^30 = about 1x10^30 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
20^20 = about 1x10^26 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
20^10 = about 1x10^13 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants.
Thus, the breadth of the claims reasonably encompasses an enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants that are to have the functional property(ies) of being a retromer core protein capable of associating with endosomal organelles and control trafficking of certain cellular cargo molecules within tubular vesicular carriers to the trans Golgi network (pg 1, last para).
(www.calculator.net/exponent-calculator; last visited April 29, 2025)
Moreira et al (Hot spots—A review of the protein–protein interface determinant amino-acid residues, Proteins 68: 803-812, 2007) is considered relevant prior art for having taught Protein–protein interactions are very complex and can be characterized by their size,
shape, and surface complementarity (e.g. pg 803, Protein-Protein). The hydrophobic and electrostatic interactions they establish, as well as the flexibility of the molecules involved, are very significant.
Moreira et al taught that in a protein–protein interface, a small subset of the buried amino acids typically contribute to the majority of binding affinity as determined by the change in the free energy of binding. Although there is no purely geometric reason, these energetic determinants are compact, centralized regions of residues crucial for protein association (e.g. pg 804, col. 2).
Moreira et al taught that most interfaces are optimal tight-fitting regions characterized by complementary pockets scattered through the central region of the interface, and enriched in structurally conserved residues. These pockets are classified as ‘‘complementary’’ because there is a large complementarity both in shape and in the juxtaposition of hydrophobic and hydrophilic hot spots, with buried charged residues forming salt bridges and hydrophobic residues from one surface fitting into small nooks on the opposite face. Usually, the hot spot of one face packs against the hot spot of the other face establishing a region determinant for complex binding (e.g. pg 806, col. 1). Complementarity is basically affected by the size of the buried surface, alignment of polar and nonpolar residues, number of buried waters, and the packing densities of atoms involved in the protein–protein interface. Packing defects at the protein–protein interface result in these gaps or pockets, and it is unclear whether unfilled pockets contain water molecules or how the dynamics of water molecules entering and escaping these pockets may affect binding stability (e.g. pg 807, col. 2). Moreira et al taught that common methodology to determine hot spot locations on the artisan’s protein of interest, alanine-scanning mutagenesis is slow and labor-intensive (e.g. pg 804, col. 1). Similarly, systematic mutagenesis is very laborious and time-consuming to perform, as individual mutant proteins must be purified and analyzed separately (e.g. pg 808, col. 2).
Ng et al (Predicting the Effects of Amino Acid Substitutions on Protein Function, Annual Review Genomics Human Genetics 7: 61-80, 2006) is considered relevant prior art for having taught that non-synonymous nucleotide changes which introduce amino acid changes in the corresponding protein have the largest impact on human health. Most algorithms to predict amino acid substation consequences of protein function indicate about 25% to 30% of amino acid changes negatively affect protein function (Abstract). Existing prediction tools primarily focus on studying the deleterious effects of single amino acid substitutions through examining amino acid conservation at the position of interest among related sequences, an approach that is not directly applicable to multiple amino acid changes, including insertions or deletions. Ng et al taught that 83% of disease-causing mutations affect protein stability (e.g. pg 63, col. 1), which in this case, would affect the ability of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants that are to necessarily and predictably have the functional property(ies) of being a retromer core protein capable of associating with endosomal organelles and control trafficking of certain cellular cargo molecules within tubular vesicular carriers to the trans Golgi network so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic response to treat, prevent, cure, or reduce severity of a neurodegenerative disease/disorder, inhibition of the disease course, slows disease progress, interrupting or reversing disease progress, delay onset or prevent onset of disease, inhibit/retard/slow some extent of, or may stop, neurodegeneration, prevent or delay occurrence and/or recurrence of neurodegeneration, relieve to some extent one or more symptoms associated with neurodegeneration, and/or improves health status and/or prolongs or increases lifespan, whereby the “effective amount” will depend on the condition to be treated, the severeness of disease, individual parameters of the patient, including age, physiological condition, size and weight, duration of treatment, type of accompanying therapy, specific route of administration, and dose, each of which are variable parameters, in the enormous genus of about 1x10^6 human and non-human subjects.
Parameter 4
The claims are broad for reasonably encompassing an enormous genus of structurally and functionally distinct promoters and enhancers (pg 9, para 3-4).
The Examiner notes that while the claims recite a nucleic acid encoding the VPS35, VPS26a and/or VPS26b polypeptides, the claims do not recite said nucleic acid to further comprise a promoter operably linked to said nucleic acid encoding the VPS35, VPS26a and/or VPS26b polypeptides. Thus, the claims reasonably encompass a “therapeutically effective amount” of a nucleic acid that encodes, but does not express, the VPS35, VPS26a and/or VPS26b polypeptides. See, for example, pg 9, para 3, “In some embodiments (syn. not all)…, the transgene is operably linked to a promoter that induces expression of the transgene…”.
Absent objective evidence to the contrary, it would be remedial for Applicant to amend the independent claim(s) to positively recite a promoter operably linked to the nucleic acid encoding the VPS35, VPS26a and/or VPS26b polypeptides.
Parameter 5
The claimed methods are recited at a high level of generality for the multitude of anatomically distinct administration routes (e.g. pg 12, para 1-3), including, but not limited to, injection, infusion, orally, alimentary, ingestion, inhalation, lavage, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic (e.g. High et al (U.S. 2015/0111955, [0077]).
Parameter 6
The claimed methods are recited at a high level of generality for the nucleic acid dosage that is to be administered, whereby the dosage may vary depending upon the age of the subject, the general condition of the subject, the severity of the condition to be treated, and the mode of administration (pg 45, last para), or the stability of the gene or RNA product, and the level of RNA expression required to achieve a therapeutic effect (pg 46, para 1).
The specification discloses a dose of about 1x10^10 to 1x10^15 rAAV genome copies/subject (pg 46, para 1), and reasonably encompasses as little as 1x10^2 to as much as 1x10^20 vector genomes, or more (e.g. Vetter et al (U.S. 2023/0103708, [0152]).
The claims are broad for encompassing an enormous genus of at least 125 different AAV capsid serotype variants, including but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV.rh10, and BAAV (DiPrimio et al (U.S. 2009/0215879; Table 3).
Parameter 7
The claims recite wherein, when the one or more vectors are introduced into the neuronal cell:
(a) the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) are increased in the neuronal cell relative to the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell, thereby increasing retromer function [function 1]; and/or
(b) the levels of Sorl1 are increased in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell [function 2],
While the specification discloses the ability to express the artisan’s transgene of interest in vitro from rAAV9 viruses (e.g. Examples 2-5), the specification and working examples are silent to in vivo delivery, let alone achieving a real-world, clinically meaningful therapeutic effect, including but not limited to treating, preventing and/or curing, the enormous genus of etiologically and pathologically distinct CNS disorders, including, but not limited to the genus recited in Claim 14, in the enormous genus of human and non-human animal subjects.
Furthermore, the in vitro working examples fail to disclose the actual dosage of AAV vectors administered to the tissue-cultured mouse neurons.
The claims fail to recite, and the specification fails to disclose, a first nucleic acid dosage [parameter 6] of a first nucleic acid vector [parameter 2], e.g. bacteriophage, encoding a first VPS35 polypeptide [parameter 3] of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35 variants, alone and/or in combination with, a second nucleic acid dosage [parameter 6] of a second nucleic acid vector [parameter 2], e.g. artificial chromosome, encoding a first VPS26a polypeptide [parameter 3] of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS26a variants, alone and/or in combination with, a third nucleic acid dosage [parameter 6] of a third nucleic acid vector [parameter 2], e.g. exosome, encoding a first VPS26b polypeptide [parameter 3] of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS26b variants administered via a first, second, and/or third administration route(s) [parameter 5], respectively, e.g. inhalation, subcutaneous, and/or orally, to a first subject [parameter 1], e.g. a rabbit, that is necessarily and predictably able to increase the levels of VPS35 and VPS26a in the neuronal cell relative to the levels of VPS35 and VPS26a when only a transgene encoding either VPS35 or VPS26a has been introduced into the neuronal cell, thereby increasing retromer function [function 1] and/or increased the Sorl1 levels in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a has been introduced into the neuronal cell [function 2] [parameter 7] as opposed to
a second first nucleic acid dosage [parameter 6] of a first nucleic acid vector [parameter 2], e.g. nanoparticle, encoding a first VPS35 polypeptide [parameter 3] of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35 variants, alone and/or in combination with, a second nucleic acid dosage [parameter 6] of a second nucleic acid vector [parameter 2], e.g. artificial chromosome, encoding a first VPS26a polypeptide [parameter 3] of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS26a variants, alone and/or in combination with, a second third nucleic acid dosage [parameter 6] of a third nucleic acid vector [parameter 2], e.g. cosmid, encoding a first VPS26b polypeptide [parameter 3] of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS26b variants administered via a first, second, and/or third administration route(s) [parameter 5], respectively, e.g. intramuscularly, rectally, and/or intraperitoneally, to a second subject [parameter 1], e.g. a cow, that is necessarily and predictably able to increase the levels of VPS35 and VPS26a in the neuronal cell relative to the levels of VPS35 and VPS26a when only a transgene encoding either VPS35 or VPS26a has been introduced into the neuronal cell, thereby increasing retromer function [function 1] and/or increased the Sorl1 levels in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a has been introduced into the neuronal cell [function 2] [parameter 7], for example.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’).
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the initial VPS35, VPS26a, and VPS26b polypeptides comprise the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively, does not tell you anything at all about the structure (amino acid sequences) and functional properties of the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants that are to have the functional property(ies) of being a retromer core protein capable of associating with endosomal organelles and control trafficking of certain cellular cargo molecules within tubular vesicular carriers to the trans Golgi network (pg 1, last para).
Furthermore, the claims fail to recite, and the specification fails to disclose, the nexus between:
the broad genus of structurally and functionally distinct first, second, and third nucleic acid vectors, respectively, including, but not limited to plasmids, transposons, bacteriophages, cosmids, chromosomes, artificial chromosomes, viruses, dendrimers, nanoparticles, liposomes, exosomes, or other synthetic vesicles, including those vectors that encode, but do not express, the VPS35, VPS26a, and/or VPS26b polypeptides;
the enormously vast genus of structurally and functionally undisclosed doses of the first, second, and third nucleic acid vectors, respectively;
the corresponding enormous genus of anatomically distinct administration routes, including, but not limited to delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic; and
the enormous genus of about 1x10^6 different animal species, respectively,
so as to necessarily and predictably achieve increased levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) in the neuronal cell relative to the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell, thereby increasing retromer function [function 1] and/or increased Sorl1 levels in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell [function 2].
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that Applicant seeks to claim for themselves:
the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants that are to have the functional property(ies) of being a retromer core protein capable of associating with endosomal organelles and control trafficking of certain cellular cargo molecules within tubular vesicular carriers to the trans Golgi network (pg 1, last para);
the broad genus of structurally and functionally distinct first, second, and third nucleic acid vectors, respectively, including, but not limited to plasmids, transposons, bacteriophages, cosmids, chromosomes, artificial chromosomes, viruses, dendrimers, nanoparticles, liposomes, exosomes, or other synthetic vesicles, including those vectors that encode, but do not express, the VPS35, VPS26a, and/or VPS26b polypeptides;
the enormously vast genus of structurally and functionally undisclosed doses of the first, second, and third nucleic acid vectors, respectively;
the corresponding enormous genus of anatomically distinct administration routes, including, but not limited to delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic; and
the enormous genus of about 1x10^6 different animal species, respectively,
so as to necessarily and predictably achieve increased levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) in the neuronal cell relative to the levels of VPS35 and VPS26a when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell, thereby increasing retromer function [function 1] and/or increased Sorl1 levels in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell [function 2].
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Accordingly, this limited information is not deemed sufficient to reasonably convey to one skilled in the art that the applicant is in possession of the nexus between:
the enormously vast genus of about 1x10^156, 1x10^104, 1x10^65, 1x10^52, 1x10^30, 1x10^26, and/or 1x10^13 structurally and functionally undisclosed VPS35, VPS26a, and/or VPS26b polypeptide variants that are to have the functional property(ies) of being a retromer core protein capable of associating with endosomal organelles and control trafficking of certain cellular cargo molecules within tubular vesicular carriers to the trans Golgi network (pg 1, last para);
the broad genus of structurally and functionally distinct first, second, and third nucleic acid vectors, respectively, including, but not limited to plasmids, transposons, bacteriophages, cosmids, chromosomes, artificial chromosomes, viruses, dendrimers, nanoparticles, liposomes, exosomes, or other synthetic vesicles, including those vectors that encode, but do not express, the VPS35, VPS26a, and/or VPS26b polypeptides;
the enormously vast genus of structurally and functionally undisclosed doses of the first, second, and third nucleic acid vectors, respectively;
the corresponding enormous genus of anatomically distinct administration routes, including, but not limited to delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic; and
the enormous genus of about 1x10^6 different animal species, respectively,
so as to necessarily and predictably achieve increased levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) in the neuronal cell relative to the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell, thereby increasing retromer function [function 1] and/or increased Sorl1 levels in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell [function 2], at the time the application was filed.
As discussed above, the specification discloses the ability to express the artisan’s transgene of interest in vitro from rAAV9 viruses (e.g. Examples 2-5), the specification and working examples are silent to in vivo delivery, let alone achieving a real-world, clinically meaningful therapeutic effect, including but not limited to treating, preventing and/or curing, the enormous genus of etiologically and pathologically distinct CNS disorders, including, but not limited to the genus recited in Claim 14, in the enormous genus of human and non-human animal subjects.
Furthermore, the in vitro working examples fail to disclose the actual dosage of AAV vectors administered to the tissue-cultured mouse neurons.
Applicant is essentially requiring the ordinary artisans to discover for themselves that which Applicant fails to disclose.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
See further discussion below in the 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, enablement rejection.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claims.
Response to Arguments
Applicant argues that the amended claims render the prior rejection moot.
Applicant’s argument(s) has been fully considered, but is not persuasive. Instant claims remain deficient in the structure(s)/function(s) nexus and/or the method step(s)/function(s) nexus of the claimed limitations, including, but not limited to, elements required for the in vivo embodiments of the claimed methods.
5. Claims 3, 15, 17, 20, 22, 29, 35, 37, 40, 46, 49, and 60-66 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
Claims 3 and 35 have been amended to recite the step of introducing into a neuronal cell at least one vector comprising:
i) a transgene encoding retromer core protein VPS35, and
ii) a transgene encoding retromer core protein VPS26a (Claim 3) or VPS26b (Claim 35) [structure],
wherein, when the one or more vectors are introduced into the neuronal cell:
(a) the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) are increased in the neuronal cell relative to the levels of VPS35 and VPS26a (Claim 3) or VPS26b (Claim 35) when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell, thereby increasing retromer function [function 1]; and/or
(b) the levels of Sorl1 are increased in the neuronal cell, relative to levels of Sorl1 when only a transgene encoding either VPS35 or VPS26a (Claim 3) or VPS26b (Claim 35) has been introduced into the neuronal cell [function 2], thereby increasing retromer function.
The claims also denote that there is an amount (syn. dosage) of the nucleic acid vectors and/or one or more presently unrecited transcriptional regulatory elements operably linked to the first and second transgenes, respectively, that upon introduction into the neuronal cell, is not, in fact, effective or able to achieve the first and/or second recited functional properties, thereby increasing retromer function.
The breadth of the claims encompasses neuronal cells present in both in vivo/in situ contexts and in vitro cell culture contexts.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention. If not, whether an artisan would have required undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make or use the invention based on the content of the disclosure is “undue” (In re Wands, 858 F.2d 731, 737, 8 USPQ2ds 1400, 1404 (Fed. Cir. 1988)). Furthermore, USPTO does not have laboratory facilities to test if an invention will function as claimed when working examples are not disclosed in the specification. Therefore, enablement issues are raised and discussed based on the state of knowledge pertinent to an art at the time of the invention. And thus, skepticism raised in the enablement rejections are those raised in the art by artisans of expertise.
Considering the mode of administration, the specification simply requires administration of the nucleic acid(s) to the subject by any means. The art has demonstrated through numerous publications, delivery of nucleic acid vectors in vivo is highly unpredictable for successful human therapy.
At issue in general are organ barriers, failure to persist, side-effects in other organs, T-cell responses, virus neutralizing antibodies, humoral immunity, normal tropism of the vector to other organs and more. The challenge is to maintain the efficiency of delivery and expression while minimizing any pathogenicity of the virus from which the vector was derived. The inability to develop an adequate means of overcoming obstacles such as humoral; responses and refractory cells limits the successful means by which the nucleic acid can be administered. The physiological art is recognized as unpredictable. (MPEP 2164.03.) In cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws. In cases involving unpredictable factors, such as most chemical reactions and physiological activity, the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved. In this case, the nucleic acid is broadly stated as being administered to a patient. The lack of guidance exacerbates the highly unpredictable field of gene therapy and the method of delivery of polynucleotides is highly unpredictable to date. Gene delivery has been a persistent problem for gene therapy protocols and the route of delivery itself presents an obstacle to be overcome for the application of the vector therapeutically.
Reliance on animal models is not predictive of clinical outcome. This has been complicated by the inability to extrapolate delivery methods in animals with those in humans or higher animals.
Mingozzi and High (Immune responses to AAV vectors: overcoming barriers to successful gene therapy, Blood 122(1): 23-36, 2013) demonstrate that the human findings are not recapitulated from the animal studies (page 26, col 2, “it seemed logical that one could model the human immune response in these animals, but multiple attempts to do so have also failed”). Hence, lessons learned from small animals such as the mice studies could not recapitulate the ability to deliver adequately in humans.
Kattenhorn et al (Adeno-Associated Virus Gene Therapy for Liver Disease, Human Gene Therapy 27(12): 947-961, November 28, 2016) taught concerns for translation lead to extensive analysis of the effects on clinical use. The use of AAV after initial promising results went on hiatus (pg 947, col. 2, “clinical hiatus in the field”) as th