Prosecution Insights
Last updated: April 19, 2026
Application No. 17/782,768

METHOD AND COMPOSITIONS FOR ENGINEERING GRAPEVINE RED BLOTCH VIRUS-RESISTANT GRAPEVINE

Non-Final OA §103§112
Filed
Jun 06, 2022
Examiner
RADOSAVLJEVIC, ALEKSANDAR
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Texas Tech University System
OA Round
3 (Non-Final)
82%
Grant Probability
Favorable
3-4
OA Rounds
2y 11m
To Grant
89%
With Interview

Examiner Intelligence

Grants 82% — above average
82%
Career Allow Rate
87 granted / 106 resolved
+22.1% vs TC avg
Moderate +7% lift
Without
With
+7.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
25 currently pending
Career history
131
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
20.6%
-19.4% vs TC avg
§102
15.3%
-24.7% vs TC avg
§112
42.4%
+2.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 106 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 3 December 2025 has been entered. Status of the Claims Claims 1, 3, 6-8, 10-20, 23-28, 30-31 are pending. Claims 14-20, 23-24, 27-28 and 30-31 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Claims 1, 3, 6-8, 10-13, and 25-26 are examined herein to the extent that they read on the elected species (i.e. SEQ ID NOs: 5, 7 and 8). Claim interpretation For clarity of the record, the Examiner notes that the terms “transformed” and “transgenic” are not interchangeable and do not have the same scope. As interpreted by the Office, a transformed plant or plant cell is any cell or plant that has undergone genetic alteration, including alterations that confer transient expression of a gene/trait, while a transgenic plant is a transformed plant or a plant comprising transformed cells, wherein the genetic alteration has been stably integrated into the genome. As such, all transgenic cells (or plants) are transformed, but not all transformed cells are transgenic. Claim Objections Claim 3 is objected to because of the following informalities: it appears that a conjunction is missing between the recitation of the first alternative and second alternative. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 3, 6-8, 10-13, and 25-26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Independent claims 1 and 12 recite the following limitations: “at least one nucleic acid construct comprising: in order: promoter, a knockdown hairpin polynucleotide comprising at least one of: a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of C2 of GRBV of SEQ ID NO:4, an intron, and a 3' portion of an antisense hairpin of C2 of SEQ ID NO:5, or a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8, and an f1 ori and bacterial ori;” The limitation renders the claim indefinite because it is not clear, from the current wording of the claim, if the claims requires a polynucleotide comprising a) any one of the three elements (i.e. a C2 hairpin, a V2 hairpin, or the two origins of replication) , b) either the first or second element in combination with the third element (i.e. a C2 hairpin with two origins of replication or a V2 hairpin with two origins of replication) or c) either the first element or the second element in combination with the third element (i.e. a C2 hairpin or a V2 hairpin with two origins of replication). Therefore the metes and bounds of claims 1 and 12 are unclear. Dependent claims 3, 6-8, 10, 13, and 25-26 fail to recite any limitations that clarify the metes and bounds of claims 1 and 12 and are therefore rejected on the same grounds. Claim 3 recites the limitation " expression of the suppressor…" in lines 2 and 4. There is insufficient antecedent basis for this limitation in the claim. Claim 3 depends from claim 1. Claim 1 does not recite any limitations drawn to a suppressor. Therefore, it is not clear to which suppressor claim 3 is refereeing and the metes and bounds of the claim cannot be determined. Claim 6 recites the limitation "the transformed grapevine plant cell" in line 1. There is insufficient antecedent basis for this limitation in the claim. Claim 6 depends from claim 1. Claim 1 recites “a transformed plant cell or transgenic grapevine plant”. Claim 1 does not recited any limitations drawn to “a transformed grapevine plant cell”. Thus it is not clear to which transformed grapevine plant cell claim 6 refers. Claim 10 recites the limitation " wherein the suppressor…" in lines 1. There is insufficient antecedent basis for this limitation in the claim. Claim 10 depends from claim 1. Claim 1 does not recite any limitations drawn to a suppressor. Therefore, it is not clear to which suppressor claim 10 is referring and the metes and bounds of the claim cannot be determined. Claim 11 recites the limitation "…the transformed or transgenic grapevine plant of claim 1" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim. Claim 11 depends from claim 1. Claim 1 does not recite any limitations drawn to a transformed grapevine plant. Therefore, it is not clear to which transformed grapevine plant claim 11 is referring and the metes and bounds of the claim cannot be determined. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 7 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 7 depends from clam 1. Claim 1 recites “A transformed plant cell or transgenic grapevine plant…”. Claim 7, which is drawn to the plant of claim 1, recites the limitation “ wherein the grapevine plant comprises one or more transformed or transgenic plant cells, and the transformed or transgenic plant cell is a grapevine cell”. However, the grapevine plant of claim 1 is a transgenic grapevine plant and would thus inherently comprises one or more transformed or transgenic plant cells and these cells would also inherently be a grapevine cells. Thus, claim 7 fails to further limit claim 1. Applicant may cancel the claim, amend the claim to place the claim in proper dependent form, rewrite the claim in independent form, or present a sufficient showing that the dependent claim complies with the statutory requirements. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 3, 6-8, 10-13, and 25-26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicant has amended independent claims 1 and 12 to recite the following new limitations: “in order: promoter, a knockdown hairpin polynucleotide comprising at least one of: a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of C2 of GRBV of SEQ ID NO:4, an intron, and a 3' portion of an antisense hairpin of C2 of SEQ ID NO:5, or a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8, and an f1 ori and bacterial ori”. Under one of the possible interpretations discussed above in the 112(b) rejections, the amended claims are drawn to a transformed plant cell or transgenic grapevine that is resistant to GRBV, comprising a nucleic acid construct comprising a promoter, a knockdown hairpin polynucleotide comprising at least one of a) a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of C2 of GRBV of SEQ ID NO:4, an intron, and a 3' portion of an antisense hairpin of C2 of SEQ ID NO:5 and an f1 ori and bacterial ori, or b) a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8 and an f1 ori and bacterial ori; wherein this construct confers GRBV resistance. The claims are further drawn to methods of producing a GRBV resistant grapevine wherein the method comprises introducing the construct described in the preceding sentence and wherein this construct confers GRBV resistance. These new limitations are new matter because the instant specification fails to provide sufficient written support for them. Applicant describes pHANNIBAL cloning vectors in figures 14 and 16, and in Example 4 (pages 35-36) which comprise a promoter, a knockdown hairpin polynucleotide comprising at least one of a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of C2 of GRBV of SEQ ID NO:4, an intron, and a 3' portion of an antisense hairpin of C2 of SEQ ID NO:5, or a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8, and an f1 ori and bacterial ori. Applicant describes excising a hairpin RNA cassette (comprising either a C2 or V2 hpRNA) as a NotI fragment from the pHANNIBAL cloning vectors, cloning this fragment into the NotI site of the T-DNA binary vector pART27, mobilizing this T-DNA in A. tumefaciens strain EHA105 and transforming plants cells with said A. tumefaciens. The NotI fragments excised from pHANNIBAL cloning vector would not comprise an f1 ori or a bacterial ori, given the position of the NotI restriction sites (see figures 14 and 16). One or ordinary skill in the art would understand that the pART27 binary vector does not comprise an f1 ori. Applicant does not describe any plants comprising a nucleic acid construct which comprises a promoter, a knockdown hairpin polynucleotide comprising at least one of a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of C2 of GRBV of SEQ ID NO:4, an intron, and a 3' portion of an antisense hairpin of C2 of SEQ ID NO:5 and an f1 ori and bacterial ori, or a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8 and an f1 ori and bacterial ori. Applicant does not describe any methods for producing GRBV resistant transgenic grapevine plants which comprises introducing a nucleic acid construct which comprises a promoter, a knockdown hairpin polynucleotide comprising at least one of a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of C2 of GRBV of SEQ ID NO:4, an intron, and a 3' portion of an antisense hairpin of C2 of SEQ ID NO:5 and an f1 ori and bacterial ori, or a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8 and an f1 ori and bacterial ori. In the Remarks filed 3 December 2025, on page 7, Applicant urges that express support for the new amendments can be found in figures 10B, 14, and 16 (see final paragraph). Examiner does not find support for the new amendments in figures 10B, 14, and 16. Figure 10B does not indicate the presence of an f1 ori, but rather shows a pART27 binary vector with an expression cassette for an hpRNA targeting V2. Claims 14 and 16 show cloning vectors, as explained above. They do not provide support for a plant or method as encompassed by the amended claims. Applicant does not disclose any plants comprising the pHANNIBAL cloning vectors as shown in figures 14 and 16 (and described in Example 4), or methods of transforming plants by introducing said pHANNIBAL cloning vectors. Rather, as explained above, the pHANNIBAL vectors were used as intermediary vectors, to generate hpRNA expression cassettes that are then transferred into T-DNA binary vectors for subsequent introduction into plant cells. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 3, 6-8, 11-13, and 25-26 remain rejected under 35 U.S.C. 103 as being unpatentable over Arce Johnson et al (US 20150067916 A1) in view of Yasmeen et al (2016, Molecular Biotechnology 58: 807-820; see Information Disclosure Statement filed 18 Aug 2022), Sudarshana et al (2015, Phytopathology 105:1026-1032; see Information Disclosure Statement filed 18 Aug 2022) and NCBI Accession MK573562 (2019, ncbi.nlm.nih.gov/nuccore/MK573562). In light of Applicant’s amendments, this rejection is modified from the rejection set forth in the Office action mailed 5 August 2025. Applicant' s arguments filed 3 December 2025 have been fully considered but they are not persuasive Under one of the possible interpretations discussed above in the 112(b) rejection, the amended claims are drawn to a transformed plant cell or transgenic grapevine that is resistant to GRBV, comprising a nucleic acid construct comprising a promoter, a knockdown hairpin polynucleotide comprising at least a 5'- portion of a recombinant nucleic acid sequence comprising a hairpin sense sequence of V2 of GRBV of SEQ ID NO:7, an intron, and a 3'- portion of an antisense hairpin sequence of V2 of SEQ ID NO:8; wherein this construct confers GRBV resistance (instant claim 1); the plant of claim 1 wherein the expression of the suppressor is regulated by a 35S promoter (claim 3); the plant of claim 1 wherein the transformed grapevine cells are embryogenic cells in the globular state generated by tissue culture (claim 6); the plant of claim 1, wherein the grapevine plant comprises one or more transformed or transgenic plant cells, and the transformed or transgenic plant cell is a grapevine cell (claim 7); the plant of claim 7, wherein the transformed plant cell or transgenic grapevine plant is of the grapevine variety 110 Richter (claim 8); the plant of claim 1, wherein the suppressor has at least 95% identity to at least one of SEQ ID NOs: 3 or 6 (claim 10); and plant parts or plant materials derived from the transgenic grapevine plant of claim 1 (claim 11). The claims are further drawn to methods of producing a GRBV resistant grapevine wherein the method comprises introducing the nucleic acid construct described in claim 1 and wherein this construct confers GRBV resistance (claim 12); GRBV resistant grapevine plants made by the method of claim 12 (claim 13); a method for producing a GRBV resistant grapevine plant comprising crossing the plant of claim 1 with another grapevine plant (claim 25); the method of claim 25 wherein one of the grapevine plants in non-transgenic and the non-transgenic grapevine variety is Thomson seedless (claim 26). Regarding the recitation of “suppressor” in claims 3, given the indefiniteness of this limitation (as set forth above in the rejection of these claims under 112(b) rejections), the term is interpreted here to read on the “nucleic acid construct” recited in claim 1. Arce Johnson teaches plant cells resistant to grapevine fanleaf virus comprising a nucleic acid construct encoding a hairpin “GLFV silencing construct”, wherein the vector comprises, in order, the CaMV35S promoter, a nucleic acid sequence encoding a GFVL viral protein sequence in sense direction, a PDK intron, the same nucleic acid sequence encoding a GFLV viral protein sequence in antisense direction and the OCS terminator, wherein the construct confers said resistance (Abstract; Figures 1a and 1b; paragraphs 0027-0028, 0045; claims 1 and 4). Acre teaches that said construct was delivered via a pHELLSGATE2 binary vector (paragraph 0045). Arce Johnson teaches that their construct is based on the RNAi mechanism and that the double stranded hpRNA transcribed from their construct is processed by the cell’s endogenous RNAi machinery into siRNA’s that degrade the viral protein (i.e. suppress its expression)(page 3, paragraphs 0016-0018). Arce Johnson teaches making transgenic transforming embryogenic cells in a globular state derived from 110 Richter grapevine rootstock (page 3, paragraph 0030; page 6, paragraph 0048; claim 5). Arce Johnson teaches culturing transformed cells into plantlets (page 6, paragraph 0049). Arce Johnson does not teach a construct for suppressing a V2 protein, grapevines with resistance to GRBV or crossing said plants to produce GRBV resistant progeny. Yasmeen et al teaches a transgenic cotton plant comprising a nucleic acid construct encoding an RNAi construct that silences (i.e. suppresses) a V2 protein of a begomovirus (a type of geminivirus, like GRBV), wherein the construct confers resistance to said begomovirus (Abstract; “Materials and Methods: Gene Construct”; Figures 6-7). Yasmeen teaches that begomovirus V2 is responsible for viral movement in plant cells (page 807, Abstract). Yasmeen further teaches that their results are consistent with other RNAi approaches to transgenic resistance against geminiviruses (page 817, column 1, paragraph 1). Yasmeen also teaches that when viral V2 proteins were expressed in other plants they could act as a suppressor of gene silencing (page 817, column 1, paragraph 1). Sudarshana et al teaches the genome structure and organization of GRBV, including the relative positions of the ORFs of C1-C3 and V1-V3 (Figure 2; page 1028, column 2 in its entirety). Sudarshana et al also teach a number of GRBV isolates with sequenced genome available in GenBank (Table 1). NCBI Accession MK573562 teaches a V2 protein of GRBV with 100% identity to SEQ ID NO: 7: >Grapevine red blotch virus isolate NC-172 V2 protein gene, complete cds Sequence ID: MK573562.1 Length: 557 Range 1: 28 to 543 Score:953 bits(516), Expect:0.0, Identities:516/516(100%), Gaps:0/516(0%), Strand: Plus/Plus Query 1 ATGGTAACACTGAACAAACGGAATCGCGTTCTTCCTGAGTGCGATTCCTGCAGTTCTAGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 28 ATGGTAACACTGAACAAACGGAATCGCGTTCTTCCTGAGTGCGATTCCTGCAGTTCTAGT 87 Query 61 GAAAGTTCTTTGAATGATATTGATATTTGTGGTGATGATGATGGGTTAGGGGATGAGGCT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 88 GAAAGTTCTTTGAATGATATTGATATTTGTGGTGATGATGATGGGTTAGGGGATGAGGCT 147 Query 121 TTAGACGCTGGATCCGTTTATTCGTCGTCACAGAAACTGTTAGTTTCTGTGGCTAAAGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 148 TTAGACGCTGGATCCGTTTATTCGTCGTCACAGAAACTGTTAGTTTCTGTGGCTAAAGAT 207 Query 181 GTTCTTTTAGATGACTGTGATTCAACGATATTGGATATATCGTTGCCTTCTGCTTTATGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 208 GTTCTTTTAGATGACTGTGATTCAACGATATTGGATATATCGTTGCCTTCTGCTTTATGG 267 Query 241 TTTTTGTCGCAAAGATATTTGACTTGTTGTTTGAGGAAAGAATTACTGCCTCTGCCAGGT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 268 TTTTTGTCGCAAAGATATTTGACTTGTTGTTTGAGGAAAGAATTACTGCCTCTGCCAGGT 327 Query 301 ATATCCGAGAAACAGACTGTTTTATTGCGACAGCTGATTAGGCGTGTCGCTCGTCGTCAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 328 ATATCCGAGAAACAGACTGTTTTATTGCGACAGCTGATTAGGCGTGTCGCTCGTCGTCAT 387 Query 361 TGTTTATTTACTTACAAGTGCGAGGAGTGGTTTGAGGGTTGTTTGAAGATAAAGAAGGAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 388 TGTTTATTTACTTACAAGTGCGAGGAGTGGTTTGAGGGTTGTTTGAAGATAAAGAAGGAT 447 Query 421 GGTAATGaaaaaaaGGAGCCGCCAACGGAAGCAGAGAAGAAGGCGCAGGACGACTGGGAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 448 GGTAATGAAAAAAAGGAGCCGCCAACGGAAGCAGAGAAGAAGGCGCAGGACGACTGGGAG 507 Query 481 GAGTTCTGCCGTAAGGCGGCGTGCTCGGCCTCGTAG 516 |||||||||||||||||||||||||||||||||||| Sbjct 508 GAGTTCTGCCGTAAGGCGGCGTGCTCGGCCTCGTAG 543 At the time of filing, it would have obvious to one of ordinary skill in the art to modify the teachings of Arce Johnson et al with the teachings of Yasmeen et al, Sudarshana et al, and NCBI Accession MK573562 to arrive at the instantly claimed invention. One would have been motivated to do so given that Arce Johnson et al teach methods of making virus resistant grapevines using constructs to trigger the plant’s inherent RNAi mechanisms and given that Yasmeen et al teach that that RNAi has been used to confer resistance to geminiviruses in other plants by targeting the V2 protein. It would have been further obvious to target the V2 protein of GRBV given that Sudarshana et al teach that GRBV possesses such a protein and given that NCBI Accession MK573562 teaches the sequence. This sequence would also allow one of ordinary skill in the art to derive the necessary antisense strand. One would be further motivated to combine the teachings of the prior art references because both Acre Johnson et al and Yasmeen et al teach methods of inducing viral resistance in economically important crops. A person of ordinary skill in the art would have had a reasonable expectation of success given that Yasmeen et al successfully conferred resistance to a geminivirus using a silencing construct targeted at V2, a protein that is also present in GRBV and that was known in the prior art at the time of filing. Regarding claims 25 and 26, it would be obvious to one of skill in the art to generate a hybrid plant from a GRBV resistant transgenic grapevine given that the disease is a major economic burden and given that making hybrids is well known and routine in the art. One would have been further motivated to make a cross with the variety Thomson seedless as this one of the mostly commonly grown commercial table grape varieties. Claims 10 remains rejected under 35 U.S.C. 103 as being unpatentable over Arce Johnson et al (US 20150067916 A1) in view Yasmeen et al (2016, Molecular Biotechnology 58: 807-820; see Information Disclosure Statement filed 18 Aug 2022), Sudarshana et al (2015, Phytopathology 105:1026-1032; see Information Disclosure Statement filed 18 Aug 2022) and NCBI Accession MK573562 (2019, ncbi.nlm.nih.gov/nuccore/MK573562) as applied to claim 1 above, and further in view of Wesley et al (2001, The Plant Journal 27: 581—590) and NCBI Accession AJ311872 (2006, ncbi.nlm.nih.gov/nucleotide/AJ311872.1) taken with evidence of Applicant’s instant specification. In light of Applicant’s amendments, this rejection is modified from the rejection set forth in the Office action mailed 5 August 2025. Applicant' s arguments filed 3 December 2025 have been fully considered but they are not persuasive. Claim 10 is drawn to the plant of claim 1, wherein the suppressor has at least 95% identity to at least one of SEQ ID NOs: 3 or 6. The interpretation of claim 1 and the interpretation of the term “suppressor” (claim 10) are the same as the interpretations are set forth above in the rejection of claims 1, 3, 6-8, 11-13, and 25-26 under 35 U.S.C. 103. Regarding claim 10, from Applicant’s admission in the instant specification, instant SEQ ID NO: 6 consists of the 35S promoter, V2 sense sequence (i.e. SEQ ID NO: 7), pdk intron, V2 antisense sequence (i.e. SEQ ID NO: 8), and OCS transcription terminator (paragraph 0111). Applicant further admits excising a hairpin RNA cassette (comprising either a C2 or V2 hpRNA) as a NotI fragment from the pHANNIBAL cloning vectors, cloning this fragment into the NotI site of the T-DNA binary vector pART27, mobilizing this T-DNA in A. tumefaciens strain EHA105 and transforming plants cells with said A. tumefaciens (Example 4, pages 35-36). In other words, SEQ ID NO: 6 encodes a nucleic acid construct encompassed by instant claim 1 and cloned into a pHANNIBAL vector. The teachings of Arce Johnson et al, Yasmeen et al, Sudarshana et al, and NCBI Accession MK573562 as applied to claim 1 are set forth above. While the combined prior art teachings make obvious the plant of claim 1, they do not teach instant SEQ ID NO: 6. Wesley et al, teaches the pHANNIBAL and pHELLSGATE vectors and that they are useful for easily converting a gene of interest into a hpRNA hairpin construct (page 1, Abstract and generally throughout). Wesley et al teaches a map of the pHANNIBAL construct showing that the plasmid comprises, in order, a 35s promoter, a hairpin sense sequence “arm”, a pdk intron, a hairpin antisense sequence “arm”, and the OCS terminator (page 582, Figure 1; page 587, Figure 5 and Table 1). Wesley et al teaches transformed plants comprising an hpRNA hairpin construct that were produced by subcloning NotI fragments from a pHANNIBAL vector into a binary transformation vector prior to the transformation of the plants (page 588, column 2, “Plasmid construction”, “Plant transformation”). Wesley et al teaches that the sequence of the pHANNIBAL vector was deposited as accession AJ311872 (page 587, Figure 5 caption). Alignment of instant SEQ ID NO: 6 and NCBI accession AJ311872 shows 100% sequence identity to the regions comprising the CaMV35s promoter, pdk intron and OCS terminator (see description of features in NCBI accession AJ311872 for identity and coordinates of these elements): Query 1 TCGACGAATTAATTCCAATCCCACAAAAATCTGAGCTTAACAGCACAGTTGCTCCTCTCA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2865 TCGACGAATTAATTCCAATCCCACAAAAATCTGAGCTTAACAGCACAGTTGCTCCTCTCA 2924 Query 61 GAGCAGAATCGGGTATTCAACACCCTCATATCAACTACTACGTTGTGTATAACGGTCCAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2925 GAGCAGAATCGGGTATTCAACACCCTCATATCAACTACTACGTTGTGTATAACGGTCCAC 2984 Query 121 ATGCCGGTATATACGATGACTGGGGTTGTACAAAGGCGGCAACAAACGGCGTTCCCGGAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2985 ATGCCGGTATATACGATGACTGGGGTTGTACAAAGGCGGCAACAAACGGCGTTCCCGGAG 3044 Query 181 TTGCACACAAGAAATTTGCCACTATTACAGAGGCAAGAGCAGCAGCTGACGCGTACACAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3045 TTGCACACAAGAAATTTGCCACTATTACAGAGGCAAGAGCAGCAGCTGACGCGTACACAA 3104 Query 241 CAAGTCAGCAAACAGACAGGTTGAACTTCATCCCCAAAGGAGAAGCTCAACTCAAGCCCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3105 CAAGTCAGCAAACAGACAGGTTGAACTTCATCCCCAAAGGAGAAGCTCAACTCAAGCCCA 3164 Query 301 AGAGCTTTGCTAAGGCCCTAACAAGCCCACCAAAGCAAAAAGCCCACTGGCTCACGCTAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3165 AGAGCTTTGCTAAGGCCCTAACAAGCCCACCAAAGCAAAAAGCCCACTGGCTCACGCTAG 3224 Query 361 GAACCAAAAGGCCCAGCAGTGATCCAGCCCCAAAAGAGATCTCCTTTGCCCCGGAGATTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3225 GAACCAAAAGGCCCAGCAGTGATCCAGCCCCAAAAGAGATCTCCTTTGCCCCGGAGATTA 3284 Query 421 CAATGGACGATTTCCTCTATCTTTACGATCTAGGAAGGAAGTTCGAAGGTGAAGGTGACG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3285 CAATGGACGATTTCCTCTATCTTTACGATCTAGGAAGGAAGTTCGAAGGTGAAGGTGACG 3344 Query 481 ACACTATGTTCACCACTGATAATGAGAAGGTTAGCCTCTTCAATTTCAGAAAGAATGCTG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3345 ACACTATGTTCACCACTGATAATGAGAAGGTTAGCCTCTTCAATTTCAGAAAGAATGCTG 3404 Query 541 ACCCACAGATGGTTAGAGAGGCCTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGTA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3405 ACCCACAGATGGTTAGAGAGGCCTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGTA 3464 Query 601 ACAATCTCCAGGAGATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3465 ACAATCTCCAGGAGATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCA 3524 Query 661 GGACTAATTGCATCAAGAACACAGAGAAAGACATATTTCTCAAGATCAGAAGTACTATTC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3525 GGACTAATTGCATCAAGAACACAGAGAAAGACATATTTCTCAAGATCAGAAGTACTATTC 3584 Query 721 CAGTATGGACGATTCAAGGCTTGCTTCATAAACCAAGGCAAGTAATAGAGATTGGAGTCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3585 CAGTATGGACGATTCAAGGCTTGCTTCATAAACCAAGGCAAGTAATAGAGATTGGAGTCT 3644 Query 781 CTAAAAAGGTAGTTCCTACTGAATCTAAGGCCATGCATGGAGTCTAAGATTCAAATCGAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3645 CTAAAAAGGTAGTTCCTACTGAATCTAAGGCCATGCATGGAGTCTAAGATTCAAATCGAG 3704 Query 841 GATCTAACAGAACTCGCCGTGAAGACTGGCGAACAGTTCATACAGAGTCTTTTACGACTC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3705 GATCTAACAGAACTCGCCGTGAAGACTGGCGAACAGTTCATACAGAGTCTTTTACGACTC 3764 Query 901 AATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACTCTGGTCTACTCCAAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3765 AATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACTCTGGTCTACTCCAAA 3824 Query 961 AATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGATA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3825 AATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGATA 3884 Query 1021 ATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3885 ATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACA 3944 Query 1081 GTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3945 GTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATT 4004 Query 1141 CAAGATCTCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4005 CAAGATCTCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTG 4064 Query 1201 GAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4065 GAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACT 4124 Query 1261 GACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4125 GACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGA 4184 Query 1321 AGTTCATTTCATTTGGAGAGGACACG 1346 |||||||||||||||||||||||||| Sbjct 4185 AGTTCATTTCATTTGGAGAGGACACG 4210 Query 1863 TCTTTTTTCCTTTTAGTATAAAATAGTTAAGTGATGttaattagtatgattataataata 1922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4254 TCTTTTTTCCTTTTAGTATAAAATAGTTAAGTGATGTTAATTAGTATGATTATAATAATA 4313 Query 1923 tagttgttataattgtgaaaaaataatttataaatatattgtttacataaaCAACATAGT 1982 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4314 TAGTTGTTATAATTGTGAAAAAATAATTTATAAATATATTGTTTACATAAACAACATAGT 4373 Query 1983 AATGTaaaaaaaTATGACAAGTGATGTGTAAGACGAAGAAGATAAAAGTTGAGAGTAAGT 2042 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4374 AATGTAAAAAAATATGACAAGTGATGTGTAAGACGAAGAAGATAAAAGTTGAGAGTAAGT 4433 Query 2043 ATATTATTTTTAATGAATTTGATCGAACATGTAAGATGATATACTAGCATTAATATTTGT 2102 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4434 ATATTATTTTTAATGAATTTGATCGAACATGTAAGATGATATACTAGCATTAATATTTGT 4493 Query 2103 TTTAATCATAATAGTAATTCTAGCTGGTTTGATGaattaaatatcaatgataaaatacta 2162 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4494 TTTAATCATAATAGTAATTCTAGCTGGTTTGATGAATTAAATATCAATGATAAAATACTA 4553 Query 2163 tagtaaaaataagaataaataaattaaaataatatttttttatgattaatagtttattat 2222 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4554 TAGTAAAAATAAGAATAAATAAATTAAAATAATATTTTTTTATGATTAATAGTTTATTAT 4613 Query 2223 ataattaaatatctataCCATTACTAAATATTTTAGTTTAAAAGTTAATAAATATTTTGT 2282 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4614 ATAATTAAATATCTATACCATTACTAAATATTTTAGTTTAAAAGTTAATAAATATTTTGT 4673 Query 2283 TAGAAATTCCAATCTGCTTGTAATTTATCAATAAACAAAATATTAAATAACAAGCTAAAG 2342 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4674 TAGAAATTCCAATCTGCTTGTAATTTATCAATAAACAAAATATTAAATAACAAGCTAAAG 4733 Query 2343 TAACAAATAATATCAAACTAATAGAAACAGTAATCTAATGTAACAAAACATAATCTAATG 2402 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4734 TAACAAATAATATCAAACTAATAGAAACAGTAATCTAATGTAACAAAACATAATCTAATG 4793 Query 2403 CTAATATAACAAAGCGCAAGATCTATCATTTTATATAGTATTATTTTCAATCAACATTCT 2462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4794 CTAATATAACAAAGCGCAAGATCTATCATTTTATATAGTATTATTTTCAATCAACATTCT 4853 Query 2463 TATTAATTTCTAAATAATACTTGTAGTTTTATTAACTTCTAAATGGATTGACTATTAATT 2522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4854 TATTAATTTCTAAATAATACTTGTAGTTTTATTAACTTCTAAATGGATTGACTATTAATT 4913 Query 2523 AAATGAATTAGTCGAACATGAATAAACAAGGTAACATGATAGATCATGTCATTGTGTTAT 2582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4914 AAATGAATTAGTCGAACATGAATAAACAAGGTAACATGATAGATCATGTCATTGTGTTAT 4973 Query 2583 CATTGATCTTACATTTGGATTG 2604 |||||||||||||||||||||| Sbjct 4974 CATTGATCTTACATTTGGATTG 4995 Query 3121 CTGCTTTAATGAGATATGCGAGACGCCTATGATCGCATGATATTTGCTTTCAATTCTGTT 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5049 CTGCTTTAATGAGATATGCGAGACGCCTATGATCGCATGATATTTGCTTTCAATTCTGTT 5108 Query 3181 GTGCACGTTGTAAAAAACCTGAGCATGTGTAGCTCAGATCCTTACCGCCGGTTTCGGTTC 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5109 GTGCACGTTGTAAAAAACCTGAGCATGTGTAGCTCAGATCCTTACCGCCGGTTTCGGTTC 5168 Query 3241 ATTCTAATGAATATATCACCCGTTACTATCGTATTTTTATGAATAATATTCTCCGTTCAA 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5169 ATTCTAATGAATATATCACCCGTTACTATCGTATTTTTATGAATAATATTCTCCGTTCAA 5228 Query 3301 TTTACTGATTGTACCCTACTACTTATATGTACAATATTAAAATGAAAACAATATATTGTG 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5229 TTTACTGATTGTACCCTACTACTTATATGTACAATATTAAAATGAAAACAATATATTGTG 5288 Query 3361 CTGAATAGGTTTATAGCGACATCTATGATAGAGCGCCACAATAACAAACAATTGCGTTTT 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5289 CTGAATAGGTTTATAGCGACATCTATGATAGAGCGCCACAATAACAAACAATTGCGTTTT 5348 Query 3421 ATTATTACAAATCCAATTTTaaaaaaaGCGGCAGAACCGGTCAAACCTAAAAGACTGATT 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5349 ATTATTACAAATCCAATTTTAAAAAAAGCGGCAGAACCGGTCAAACCTAAAAGACTGATT 5408 Query 3481 ACATAAATCTTATTCAAATTTCAAAAGGCCCCAGGGGCTAGTATCTACGACACACCGAGC 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5409 ACATAAATCTTATTCAAATTTCAAAAGGCCCCAGGGGCTAGTATCTACGACACACCGAGC 5468 Query 3541 GGCGAACTAATAACGTTCACTGAAGGGAACTCCGGTTCCCCGCCGGCGCGCATGGGTGAG 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5469 GGCGAACTAATAACGTTCACTGAAGGGAACTCCGGTTCCCCGCCGGCGCGCATGGGTGAG 5528 Query 3601 ATTCCTTGAAGTTGAGTATTGGCCGTCCGCTCTACCGAAAGTTACGGGCACCATTCAACC 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5529 ATTCCTTGAAGTTGAGTATTGGCCGTCCGCTCTACCGAAAGTTACGGGCACCATTCAACC 5588 Query 3661 CGGTCCAGCACGGCGGCCGGGTAACCGACTTGCTGCCCCGAGAATTATGCAGCAtttttt 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5589 CGGTCCAGCACGGCGGCCGGGTAACCGACTTGCTGCCCCGAGAATTATGCAGCATTTTTT 5648 Query 3721 tGGTGTATGTGGGCCCCAAATGAAGTGCAGGTCAAACCTTGACAGTGACGACAAATCGTT 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5649 TGGTGTATGTGGGCCCCAAATGAAGTGCAGGTCAAACCTTGACAGTGACGACAAATCGTT 5708 Query 3781 GGGCGGGTCCAGGGCGAATTTTGCGACAACATGTCGAGGCTCAGCAGGACCTGCAGGCAT 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5709 GGGCGGGTCCAGGGCGAATTTTGCGACAACATGTCGAGGCTCAGCAGGACCTGCAGGCAT 5768 Query 3841 GCAAGCTAGCTTACTAGTGATGCATATTCTATAGTGTCACCTAAAT 3886 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5769 GCAAGCTAGCTTACTAGTGATGCATATTCTATAGTGTCACCTAAAT 5814 At the time of filing, it would have been obvious to one of ordinary skill in the art to combine the teachings of Arce Johnson et al, Yasmeen et al, Sudarshana et al, and NCBI Accession MK573562 (as applied to claim 1) with the teachings of Wesley et al and NCBI Accession AJ311872 to substitute the pHELLSGATE vector with a pHANNIBAL vector to produce a GRBV resistant grapevine comprising SEQ ID NO: 6 as doing so would constitute an obvious substitution of equivalents and a matter of design choice. One would be motivated to do with a reasonable expectation of success given the high skill level in the art and the teachings of Wesley that pHANNIBAL vectors are useful for producing hpRNA constructs (see above). Response to Applicant’s arguments: Applicant argues, on pages 8 of the Remarks (paragraphs 1-3), that one would not have a reasonable expectation of success that the combined teachings of Acre Johnson et al and Yasmeen would be effective against GRBV. Applicant’s urges that Acre Johnson et al’s teachings are directed to a different virus, GRLV, which has a different mode of transmission and different symptoms as compared to GRBV and lacks a V2 protein, and target a different type of protein. Applicant further argues that Yasmeen teaches a begomovirus, not a GRBV, that begomoviruses have different vectors and different symptoms as compared to GRBV and that many begomoviruses do not have a V2 protein. Applicant argues that teachings applied to one V2 protein would lead to a reasonable expectation of success of against a V2 protein from a different virus. Applicant continues that these deficiencies are not remedied by the teachings of Sudarshana and NCBI Accession MK573562 because these merely teach the genome of GRBV and because Acre Johnson et al and Yasmeen et al are directed to different viruses. Applicant argues on the Remarks on page 8 -9 (bridging paragraph) that it is not predictable which of the proteins of GRBV would function as a viral suppressor of plant defense mechanisms because of several of the tested constructs only those comprising C2 or V2 possess silencing suppression activity. Applicant argues, on pages 9 (entire) and 10 (paragraph 1-2) that the specification provides evidence that only C2 and V2 possess silencing suppression activity and cite the instant specification and Weligodage et al, 2023, Heliyon 9(3):e14528 in support. Applicant argues, on page 10 (paragraph 2-3) and page 11 (paragraph 1) that RNA-seq experiments revealed novel a V1:V3 spliced ORF, that among fusion proteins only the V0:V2 fusion protein that functions as a viral suppressor of RNA silencing and that is "a novel spliced protein that effected viral suppression, as claimed herein”. Applicant cites the instant specification and Weligodage et al, 2023, Heliyon 9(3):e14528 in support. These arguments are not found persuasive. As a first matter, in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Acre Johnson is relied upon to provide teachings directed to the use of RNAi methods to suppress viruses in grapevine. Yasmeen et al provides a nexus between RNAi, geminiviruses, and V2 proteins, in this case the V2 protein of a cotton leaf-curl virus, which like the V2 of GRBV is also a putative movement protein (Yasmeen et al, page 807, Abstract; cited above in 103 rejection) . It is immaterial to the question of obviousness that these two references are drawn to different viruses; one would be motivated to combine the teachings of these two references as they are both drawn to the use of hpRNA moderated RNAi to induce viral resistance in crop plants. Contrary to Applicant’s assertion, the teachings of Yasmeen et al demonstrates that a technique that is applied to one group of viruses can be effective against another, related, group of viruses. Yasmeen provides teachings that the V2 proteins of other monopartite geminiviruses act as viral suppressors of gene silencing and that the targeting of geminivirus V2 proteins to inhibit silencing suppression leads to asymptomatic plants in the face of viral challenge (page 817, column 1, paragraph 1; cited above in 103 rejection). Examiner notes, that the virus taught by Yasmeen et al is monopartite. Regarding the differences in symptoms and vectors between the viruses taught by Acre Johnson et al and Yasmeen et al, this would have no effect on the suitability of the combined prior art teachings as the teachings are drawn to targeting genomic components, not the vectors or symptoms. As a final matter, Acre Johnson et al and Yasmeen et al are not relied upon alone to form the basis of the 35 U.S.C. rejection; the rejection also relies on the teachings of Sudarshana and NCBI Accession MK573562. Sudarshana et al teaches the genome structure and organization of GRBV, including the relative positions of the ORFs of C1-C3 and V1-V3. NCBI Accession MK573562 provides the sequence of instant SEQ ID NO: 5, the V2 protein of GRBV as claimed by Applicant. The similarity between the V2 protein of Yasmeen et al and the V2 protein of GRBV, which is taught by NCBI Accession MK573562, is immaterial to the question of obviousness here, because all three provide teachings directed to V2 proteins and all of the required elements are taught by the combined the prior art references. One of skill in the art would be able to design an RNAi construct targeting the V2 protein of GRBV based on the sequence taught by teaching of NCBI Accession MK573562. It is also of no consequence that the only proteins of GRBV which function as silencing suppressors are C2 and V2 (2 out of 6 possible ORFs tested) as the combined prior art references provide all the necessary teachings to specifically target V2. One of ordinary skill in the art would be motivated, as explained above to apply the combined teachings of Acre Johnson et al and Yasmeen et al to the V2 of GRBV with a reasonable expectation of success, given that the structure of the genome of GRBV is taught in the prior art and given that the sequence of the target, the V2 protein, is also taught in the prior art. Regarding the arguments drawn to the a novel V1:V3 spliced ORF and that among fusion proteins only the V0:V2 fusion protein that functions as a viral suppressor of RNA silencing and that is "a novel spliced protein that effected viral suppression, as claimed in the herein” Applicant provides Figure 2 and 3a of specification and provides figures 3-5, and cites Weligodage et al, 2023, Heliyon 9(3):e14528 in support. This is not persuasive. As a first, matter, it is not clear where figures 3-5 originate, it does not appear to correspond to data presented in either the specification or Weligodage et al and applicant has provided no other citation. Contrary to the assertion in Applicant’s Remarks neither the specification nor Weligodage et al provide any teachings whatsoever regarding the function of novel fusion proteins and neither describes any experiments in which the silencing suppression abilities of any fusions ORFs were tested. There does not appear to be any other evidence in the record supporting these arguments. In light of this, these statements appear to be arguments of counsel. Attorney arguments cannot take the place of evidence. MPEP 716.01(c)II states The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965). Examples of attorney statements which are not evidence and which must be supported by an appropriate affidavit or declaration include statements regarding unexpected results, commercial success, solution of a long-felt need, inoperability of the prior art, invention before the date of the reference, and allegations that the author(s) of the prior art derived the disclosed subject matter from the inventor or at least one joint inventor. Additionally, again contrary to Applicant’s assertion, there are no claims drawn to a V0:V2 fusion protein that effects viral suppression. All the claimed limitations of the rejected claims are obvious in light of the combined prior art teaching, as set forth above. Even if these issues are set aside, however, Applicant has not persuasively argued why the finding of this novel fusion protein would lead to a finding that one of skill in the art would not have had a reasonable expectation of success in combining the prior art references to target a V2 protein of GRBV to induce resistance in a grapevine plant, given the teachings of the prior art references cited in the 35 U.S.C. rejections above. As evidenced by Applicant’s specification, targeting the V2 protein of GRBV does in fact provide resistance to GRBV, just as targeting the V2 protein of CLCuKoV-Bur, as taught by Yasmeen et al and which is also a geminivirus and comprises a V2 protein believed to be associated with viral movement, provides resistance to that virus. For these reasons, the rejections are maintained. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALEKSANDAR RADOSAVLJEVIC/ Examiner, Art Unit 1662 /BRENT T PAGE/ Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Jun 06, 2022
Application Filed
Jan 02, 2025
Examiner Interview (Telephonic)
Jan 23, 2025
Non-Final Rejection — §103, §112
May 05, 2025
Response Filed
Aug 01, 2025
Final Rejection — §103, §112
Oct 06, 2025
Response after Non-Final Action
Dec 03, 2025
Request for Continued Examination
Dec 09, 2025
Response after Non-Final Action
Mar 07, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600977
PLANTS AND METHODS FOR PRODUCING 2-PYRONE-4, 6-DICARBOXYLIC ACID (PDC)
2y 5m to grant Granted Apr 14, 2026
Patent 12599079
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010446
2y 5m to grant Granted Apr 14, 2026
Patent 12599088
SOYBEAN CULTIVAR 24180206
2y 5m to grant Granted Apr 14, 2026
Patent 12599103
Tomato Hybrid SVTM9041 and Parents Thereof
2y 5m to grant Granted Apr 14, 2026
Patent 12588681
COMPOSITIONS, KITS AND METHODS FOR WEED CONTROL
2y 5m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
82%
Grant Probability
89%
With Interview (+7.0%)
2y 11m
Median Time to Grant
High
PTA Risk
Based on 106 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month