DETAILED ACTION
Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant's election with traverse of Group II claims 54-58 and 62 in the reply filed on 10/17/2025 is acknowledged. The traversal is on the ground(s) that the present application is a 371 national stage filing and “claims to different categories of invention will be considered to have unity of invention …” This is not found persuasive because there is not a “special” technical feature because the elected claims/(restricted claims included DNA vaccine) are directed to a DNA vaccine : See, instant specification para [009] [0034], [0044]-[0047], [055], [114], [116], [125]-[126], [129], [154], [156]-[157], [160]- [161], and [168].
Withdrawal of Restriction for Group III (claims 59-61 and 63)
Upon search for the prior arts for the elected Group II and finding the prior arts for restricted group III, the claims 59-61 and 63 are also examined on merit as recited below. The restriction for Group III claims 59-61 and 63 is withdrawn.
The restriction is modified as above and the requirement for restriction for Group I claims 48-53 is still deemed proper and is therefore made FINAL.
Election/Restrictions: Election by Original Presentation (New)
3. Newly submitted claims 59-61, and 63 are methods drawn to an invention that is independent or distinct from the invention originally claimed for the following reasons:
The claims 59-61, and 63 are drawn to the methods of treating HPV associated cancer in a subject. Prior to the amendment the claims 59-61, and 63 were drawn to “use” and were rejected under 35 U.S.C. 101 in the office action mailed on 02/03/2026.
Since applicants have received an action on the merits for the originally presented invention, this invention has been constructively elected by original presentation for prosecution on the merits. Accordingly, claim 59-61, and 63 are withdrawn from consideration as being directed to a non-elected invention. See 37 CFR 1.142(b) and MPEP § 821.03.
The New Groups of Invention are as below:
Group I: Claims 48-53 drawn to a method of producing (a method of making).
Group II: Claims 54, 56-58, and 62 drawn to a composition.
Group III: Claims 59-61 and 63 drawn to a method treatment.
To preserve a right to petition, the reply to this action must distinctly and specifically point out supposed errors in the restriction requirement. Otherwise, the election shall be treated as a final election without traverse. Traversal must be timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are subsequently added, applicant must indicate which of the subsequently added claims are readable upon the elected invention.
Should applicants traverse on the ground that the inventions are not patentably distinct, applicant should submit evidence or identify such evidence now of record showing the inventions to be obvious variants or clearly admit on the record that this is the case. In either instance, if the examiner finds one of the inventions unpatentable over the prior art, the evidence or admission may be used in a rejection under 35 U.S.C. 103 or pre-AIA 35 U.S.C. 103(a) of the other invention.
Status of Claims (modified)
4. Claims 48-54 and 56-63 as per amended claim listing filed on 07/06/2026 are pending.
5. Claims 48-53 (Group I) non-elected inventions are withdrawn from consideration due to restriction.
6. Claims 59-61, and 63 (Group III) are withdrawn for the rationale as provided in the lack of unity of record. It is noted that applicant should have included “withdrawn” as a claim modifier (in addition to amended).
7. Claim 55 is cancelled by the applicant.
8. Claims 54, 56-58, and 62 (Group II) as amended by the applicant are under examination in this office action.
Priority
9. This application is a United States National Phase Patent Application of International Patent Application Number PCT/BR2020/050516, filed on December 7, 2020, which claims the benefit of priority to BR Application No. 10-2019-025802-0, filed December 6, 2019.
Information Disclosure Statement
10. The information disclosure statement (IDS) submitted on 07/07/2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Withdrawn Claim Objections
11. Withdrawn objection to claims 54-55, 57, 58, 61, 62-63 in view of amended claim listing filed on 07/06/2026.
Withdrawn Objection to the Specification
12. Withdrawn objection to the specification in view of amendment to the specification filed on 07/06/2026.
Withdrawn Claim Rejections - 35 USC § 112
13. Withdrawn rejection of claims 54-63 under 35 U.S.C. 112(b) in view of amendments filed on 07/06/2026.
Withdrawn Claim Rejections - 35 USC § 101
14. Withdrawn rejection of claims 59-61 and 63 under 35 U.S.C. 101 in view of amendment filed on 07/06/2026.
Withdrawn Claim Rejections - 35 USC § 103
15. Withdrawn rejection of claims 54-61, and 63 under 35 USC § 103 in view of amendment of claims filed on 07/06/2026.
Claim Rejections - 35 USC § 112 (New)
16. The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 59-61, and 63 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 59 is directed to a method of treating an HPV-associated cancer in a subject, comprising administering to the subject an effective amount of the hybrid protein of claim 56. Claim 56 indirectly depends on claim 54. Claim 59 requires limitations from both claims 54 and 56.
In addition, the newly amended and submitted claims 59-61, and 63 are methods claims directed to an invention that is independent or distinct from the invention originally claimed.
Prior to the amendment, the claims 59-61, and 63 were directed to “use” and were rejected under 35 U.S.C. 101 in the office action mailed on 02/03/2026.
Since applicants have received an action on the merits for the originally presented invention, this invention has been constructively elected by original presentation for prosecution on the merits. Accordingly, claim 59-61 and 63 are withdrawn from consideration as being directed to a non-elected invention, a newly created Group III drawn to a method. Therefore, the limitations of claims 54 and 56 on immunogenic composition are not accessible to incorporate in the new method claims 59-61 and 63. See modified Election/Restrictions above.
Applicants may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Allowable Subject Matter
17. The following is a statement of reasons for the indication of allowable subject matter:
The amended claims 54, 56-58, and 62 directed to a composition under examination are free of prior art because the SEQ ID NO: 1 claimed in instant claim 1 is free of prior art as below. Bertelsen et al 2018 teaches SEQ ID NO: 2 that has Query Match 56.3% and Best Local Similarity 91.0% with instant claimed SEQ ID NO: 1 (less than required 100% identity as claimed in claim 54) as recited below.
Bertelsen et al 2018 (US20180362591A1 (12/20/2018) is directed to Virus-like particle with efficient epitope display comprising Human papillomavirus polypeptide and disclosed SEQ ID NO: 2 that has Query Match 56.3% and Best Local Similarity 91.0% with instant claimed SEQ ID NO: 1 as recited below.
Qy 4 CAGCTGTATAAAACCTGTAAACAGGCAGGTACATGTCCGCCGGATATTATTCCGAAAGTT 63
||||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Db 22 CAGCTGTATAAAACCTGTAAACAGGCAGGCACCTGTCCGCCTGATATCATTCCGAAAGTT 81
Qy 64 GGTGGTA 70
| ||||
Db 82 GAAGGTA 88
Response to Arguments
18. Applicant’s arguments, see, Applicant Arguments/Remarks Made in an Amendment, filed on 07/06/2026, with respect to the rejection(s) of claims 54 and 56-63 under 35 USC 103 obviousness rejection have been fully considered. The arguments are persuasive for the amended claims 54, 56-58, and 62 directed to a composition because the newly claimed SEQ ID NO: 1 in an independent claim 54 is free of prior art and the claims 56-58, and 62 depends on base claim 54 and therefore, the rejection has been withdrawn.
However, upon further consideration, a new ground of rejection is made in view of amendment of claims 59-61, and 63 because the amended claims are drawn to an invention that is independent or distinct from the invention originally claimed. The newly amended claims 59-61, and 63 are drawn to the methods of treating HPV associated cancer in a subject. See, office action above for modified Election/Restriction See 37 CFR 1.142(b) and MPEP § 821.03, and rejection of claims 59-61, and 63 under 35 U.S.C. 112(d).
Conclusion
19. No claim is allowed.
20. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
21. A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672
/BENNETT M CELSA/Primary Examiner, Art Unit 1600