DETAILED ACTION
Non-Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant's election with traverse of Group II claims 54-58 and 62 in the reply filed on 10/17/2025 is acknowledged. The traversal is on the ground(s) that the present application is a 371 national stage filing and “claims to different categories of invention will be considered to have unity of invention …” This is not found persuasive because there is not a “special” technical feature because the elected claims/(restricted claims included DNA vaccine) are directed to a DNA vaccine : See, instant specification para [009] [0034], [0044]-[0047], [055], [114], [116], [125]-[126], [129], [154], [156]-[157], [160]- [161], and [168].
Withdrawal of Restriction for Group III (claims 59-61 and 63)
Upon search for the prior arts for the elected Group II and finding the prior arts for restricted group III, the claims 59-61 and 63 are also examined on merit as recited below. The restriction for Group III claims 59-61 and 63 is withdrawn.
The restriction is modified as above and the requirement for restriction for Group I claims 48-53 is still deemed proper and is therefore made FINAL.
Status of Claims
3. It is noted for the record, that the 01/04/2023 amendment was signed but did not recite Reg No. below the signature of “J Gibson Lanier”. However, the ADS filed on 06/06/2022 recites both the Reg No. and the signature of “J Gibson Lanier”. Accordingly, the amendment was entered.
4. Claims 48-63 as filed on 01/04/2023 are pending.
5. Claims 48-53 (Group I) are withdrawn from consideration due to restriction.
6. Claims 54-63 are under examination in this office action.
Priority
7. This application is a United States National Phase Patent Application of International Patent Application Number PCT/BR2020/050516, filed on December 7, 2020, which claims the benefit of priority to BR Application No. 10-2019-025802-0, filed December 6, 2019.
Claim Objections
8. Cllaims 58 and 62 are objected to because of the following informalities: The claim recites “immune composition” that implies the composition is immune. It is recommended that Applicant revise the claim to recite “immunogenic composition” for more clarity.
9. Claims 57, 61, and 63 are objected for reciting plural “claims” in line 1. Appropriate correction is required.
10. The claim 54 recites “optimized sequence”. It is not clear what optimization the sequences comprise? Whether it is a codon optimization and to what species the codon is optimized to? (e.g. human, mammal, avian, bacteria, yeast, plant).
11. Claims 54-55: The instant claims 54-55 recites “established in” and it is objected because it read as introducing redundancy. Applicant may delete “established in” without changing / affecting the scope of the claims 54-55 and dependent claims.
Objection to the Specification
12. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on page 3-6, 41-42, and elsewhere in the specification.
Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
13. Specification (date filed 05/11/2023) page 32 para [00105] recites a peptide sequence of E6 protein without identified by a SEQ ID NO. Therefore, the specification is objected. Applicants is required to recite the SEQ ID NO for the peptide from the sequence listing on file or if necessary provide an updated sequence listing and computer readable form to conform to the SEQUENCE rule requirements.
Claim Rejections - 35 USC § 112
14. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 54-63 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The Claim 54 limitation “3 “linker” sequences is indefinite since this term is not defined in the specification and the claim is drawn to nucleotide sequence and not encoded peptide sequence. Accordingly, the scope is unclear as to whether the linking sequence is 3 nucleotides or if it encompasses encoding (nine) nucleotide sequence corresponding to 3 amino acids.
In claims 58 and 62, the phrase “preferably” renders the claims indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05 (d).
See MPEP § 2173.05 (d). Description of examples or preferences is properly set forth in the specification rather than the claims. If stated in the claims, examples and preferences may lead to confusion over the intended scope of a claim.
Claim 57 (dependent claims 60 and 62-63) contains the trademark/trade name pcDNA 3.3 (lines 3-4) and pUC (line 5). Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a plasmid vector for expression in mammalian cell (reads on pcDNA 3.3) and a DNA cloning vector (reads on pUC) and, accordingly, the identification/description is indefinite.
In claims 54-63: the term “characterized by … comprising” is indefinite in scope since the "characterized by” is interpreted as synonymous with "comprising", "including," or "containing". See, MPEP 2111.03. As such, the metes and bounds of a double transition phrase i.e. “comprising … comprising” is unclear in scope. It is recommended to cancel “characterized by” to overcome this issue.
The ambiguous scope of “use claims” 59-61 and 63 renders these claims indefinite since there are two conflicting interpretations, since the claim encompasses a composition with an “intended result (or use)” or a “method” if subsequently amended to contain an active method step. For compact prosecution and for purposes of prior art, both interpretations will be considered.
Claim Rejections - 35 USC § 101
15. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 59-61 and 63: The instant claims 59-61 and 63 are rejected under 35 USC § 101 because the claimed invention is directed to “use” of the hybrid protein, as defined by claim 56 (claim 59), “use” of the expression vector, as defined by claim 57 (claim 60), “use” according to claim 61 (claim 59), and “use” according to claim 60 (claim 63), however, since the claims do not set forth any steps involved in the method of use or process of use, it is unclear what method or process the claims encompass. A claim is indefinite where it merely recites a use without any active, positive steps delimiting how this use is actually practiced.
The instant claims 59-61 and 63 are rejected under 35 U.S.C. 101 because the claimed recitation of a “use”, without setting forth any steps involved in the process, results in an improper definition of a process, i.e., results in a claim which is not a proper process claim under 35 U.S.C. 101. See for example Ex parte Dunki, 153 USPQ 678 (Bd.App. 1967) and Clinical Products, Ltd. v. Brenner, 255 F. Supp. 131, 149 USPQ 475 (D.D.C. 1966).
"Use" claims are non-statutory under 35 U.S.C. 101. Therefore, claim claims 59-61 and 63 have been withdrawn from further consideration as being drawn to non-statutory subject matter.
Claim Interpretation
16. The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art.
Claim 54: The instant claims 54 recites “comprising” that is open ended. Therefore, the instant claim 54 is interpreted to comprise an additional optimized nucleic acid sequence (e.g. HPV-16 E7 gene or fragment thereof or a TNF cytokine encoding gene) in addition to the claimed optimized nucleic acid sequence of L2 gene (SEQ ID NO: 3) (codon optimized L2 gene sequence) and E6 gene (SEQ ID NO: 4) (codon optimized E6 gene sequence) linked by 3 linker sequences.
Claims 55, and 57: The instant claim 55 is interpreted to comprise the claim 54 recited L2 and E6 nucleic acid sequences joined by a linker as SEQ ID NO: 1. The instant claim 57 is interpreted to be directed to a mammalian expression vector pcDNA3.3. comprising L2E6 nucleic acid sequence of claim 54 under the control of a CMV promoter for expression in a mammalian cell (a human cell) that can be used as a DNA vaccine or a construct to produce a hybrid L2E6 protein. The claim 62 is interpreted to be directed to an immune composition nucleic acid comprising the nucleic acid vector of claim 57 and an adjuvant, the composition my optionally comprise HPV VLP and the composition my optionally comprise HPV VLP that is administered to a subject as an immunogen by using syringe and needles, electroporation or tattooing or oral route.
Claims 56, and 58: The instant claims 56 is interpreted to be directed to a hybrid protein encoded by nucleic acid as recited in claim 54. The claim 58 is interpreted to be directed to an immune composition comprising the hybrid protein of claim 56 and an adjuvant, the composition my optionally comprise HPV VLP that is administered to a subject as an immunogen by using syringe and needles, electroporation or tattooing or oral route.
The claim 54 recite “comprising” and therefore nucleic acid sequence of the claimed “L2 gene” and “E6” gene can comprise a complete L2 and E6 gene encoding nucleotide sequence or a smaller fragment of the claimed SEQ ID NO: 3 and SEQ ID NO: 4.
The use claims 59-61 and 63: See 35 U.S.C. 112(b) rejection as recited above.
Claim Rejections - 35 USC § 103
17. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
18. The instant claims 54-57 are rejected under 35 U.S.C. 103 as being unpatentable over de Jong et al 2002 (Vaccine 20, 2002, p. 3456–3464), and further in view of Hitzeroth et al 2009 (Vaccine 27 (2009) 6432–6434), Gan et al 2014 (PLOS One, 2014, vol 9, issue 9, e108892), Zhao et al 2018 (Frontiers in Immunology, 2018, 9, article 932), Ella et al 2018 (US10058605B2, 08/28/2018), Burny et al 2018 (WO2018060288A1, 04/05/2018), Muller et al 2002 (WO2002038769A2, 05/16/2002), Cheung et al 2004 (Vaccine 23 (2004) 629–638) and Graham et al 2017 (Clinical Science (2017) 131 2201–2221).
Claims 54-57: The instant claims 54-57 are directed to an immunogenic composition comprising a codon optimized nucleic acid sequence encoding a hybrid protein of HPV-16 comprising an immunogenic fragment of L2 gene and E6 gene linked via a linker sequence. The codon optimized nucleic acid sequence of the L2 gene (SEQ ID NO: 3) and E6 gene (SEQ ID NO:4) is linked by a linker sequence and cloned into a pcDNA 3.3 mammalian expression vector for administering in a subject as a DNA immunogen/vaccine or to express the hybrid protein in human cells for further purification and administer as a hybrid protein immunogen/vaccine to a subject. The immunogen(s) are formulated in a pharmaceutically acceptable vehicles, carriers and can optionally comprise an adjuvant and administered by i/muscular route or i/dermal route or oral route. The use claims 59-61 and 63 are interpreted to be directed to a method of prophylactic or therapeutic administration (intra-muscular or intra-dermal or oral route) of the immunogen or the vaccine in a subject to induce cellular and humoral immune response against HPV infection (prophylactic purpose) or a cellular immune response comprising TNF against tumor (therapeutic purpose).
Claims 54-57: de Jong et al 2002 is in the art and teaches a composition comprising Human Papillomavirus (HPV) type 16 L2, E6 and E7 gene construct (nucleic acid sequences of three different gene L2, E6 and E7) as a fusion construct (HPV16 L2E7E6) for expression as a single fusion protein HPV16 L2E7E6 that is expressed in bacterial cells (prokaryotic expression plasmid vector) and used as an immunogenic composition and a phase I vaccine trial in the subjects (See, abstract, page 3457 col 1 methods section 2.1, entire article).
de Jong et al 2002 teaches the entire L2 and E6 genes that comprise the instant claimed L2 and E6 gene fragments but does not teach only the instant claimed fragments of L2 (SEQ ID NO: 3) and E6 gene (SEQ ID NO: 4) nucleic acid sequences linked by 3 “Linker” sequences. de Jong et al 2002 does not teach optimization (human codon optimization) of the nucleotide sequences. de Jong et al 2002 does not teach a mammalian expression plasmid vector (pcDNA 3.3) comprising L2E6 gene sequences as claimed in L2 (SEQ ID NO: 3) and E6 gene (SEQ ID NO: 4).
Hitzeroth et al 2009 is in the art and teaches HPV-16 L2 gene that has human codon optimized nucleic acid sequences cloned in a mammalian expression plasmid vector and expression of the L2 gene in human HEK-293 cells (See, page 6432, abstract, methods, Fig 1).
Gan et al 2014 is in the art and teaches HPV-16 E6E7 fusion gene that has human codon optimized nucleic acid sequences cloned in a mammalian expression plasmid vector and expression of the E6E7 fusion gene in human HEK-293 cells (See, abstract, page 2 methods Construction of HPV16 E6 and E7 fusion DNA vaccine, Fig 1, page 3 Fig 2).
Zhao et al 2018 is in the molecular biology and virology analogous art and teaches expression of recombinant proteins linked by nucleotide sequences encoding a (Gly4Ser)3 linker to separate two domains of the protein that are separated to ensure correct protein folding and function (See, page 4 Fig 1 legend, page 6 Results col 1).
Ella et al 2018 (US10058605B2) is in the art and teaches nucleotide sequence of L2 gene (as recited in SEQ ID NO: 5) of HPV 16 that shows best local similarity of 84.7% with instant claim 54 SEQ ID NO: 3. It is to be noted that the instant claim SEQ ID NO: 3 is an optimized sequence (human codon optimized as per the instant specification para [0058]). The amino acid sequence encoded by the L2 gene nucleotide sequence of Ella et al 2018 (US10058605B2) comprises the amino acid sequence encoded by the corresponding nucleotide sequence as claimed in the instant SEQ ID NO: 3.
Query Match 74.3%; Score 44.6; Length 1572;
Best Local Similarity 84.7%;
Matches 50; Conservative 0; Mismatches 9; Indels 0; Gaps 0;
Qy 1 CAGCTGTATAAAACTTGTAAGCAGGCCGGTACGTGCCCCCCAGATATCATTCCAAAGGT 59
||| ||||||||||||| ||||| || ||||| ||||| ||||| || || ||||||||
Db 13 CAGTTGTATAAAACTTGCAAGCAAGCTGGTACTTGCCCACCAGACATTATCCCAAAGGT 71
Burny et al 2018 (WO2018060288A1, 04/05/2018) teaches the nucleotide sequence of E6 gene (as recited in SEQ ID NO: 117) of HPV 16 that shows best local similarity of 95.7% with instant claim 54 SEQ ID NO: 4 that is human codon optimized.
Query Match 89.2%; Score 21.4; Length 2808;
Best Local Similarity 95.7%;
Matches 22; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 TATGATTTCGCCTTCAGGGACCT 23
||||| |||||||||||||||||
Db 2512 TATGACTTCGCCTTCAGGGACCT 2534
Muller et al 2002 (WO2002038769A2) teaches human codon optimization of HPV16 L2 gene for expression in human cells using pCMV expression plasmid vector under control of CMV promoter for simple recombinant production of HPV 16-L2 capsid proteins or fragments thereof in high yields, without having to use viral vectors. The capsid proteins are used for producing vaccines (See, abstract, Example 2, claim 6).
Cheung et al 2004 is in the art and teaches a plasmid encoding papillomavirus Type 16 (HPV16) DNA constructed with codon optimization improved the immunogenicity against HPV infection (See, abstract, entire article).
The molecular biology techniques on nucleic acid sequence PCR amplification, human codon optimization of nucleic acid sequences using commercially available or free open source available software algorithim and cloning using restriction enzyme sites in a mammalian expression plasmid vector (e.g. pcDNA 3.3), purification of endotoxin free plasmid for transfection in human HEK 293 cells for HPV 16 L2E6 protein production and purification, or for use of the plasmid as a DNA vaccine is routine practice and is within the skills of the ordinary in view of the applied prior arts.
It would have been obvious to modify the teachings of the prior art de Jong et al 2002
with additional teachings of Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002 and Cheung et al 2004 as applied to claim 54 as recited supra to obtain the human codon optimized constructs and arrive the claimed nucleic acid sequence recited in SEQ ID NO: 1 of instant claim 55, to encode the hybrid L2E6 protein of claim 56 and to arrive at the invention of instant claims 55-57.
Graham et al 2017 is in the art teaches HPV-16 is the most prevalent worldwide and the major cause of HPV-associated cancers (See, abstract) making obvious the need for an efficacious vaccine.
It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the prior art teachings of de Jong et al 2002
with additional teachings of Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Cheung et al 2004 and Graham et al 2017 to arrive at the inventions of claims 54-57. One of the ordinary skills would have been motivated to develop the HPV-16 L2E6 fusion gene construct comprising mammalian expression plasmid vector or hybrid fusion protein L2E6 for immunization of subjects for prophylactic or therapeutics for human subjects, and additionally use of the hybrid fusion protein L2E6 for serological assays to study the immune response and for commercial success of the vaccine(s) or immunogen(s). There would be a reasonable expectation of success given the applied prior art teachings in the art to render the claims 54-57 obvious as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions of claims 54-57. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
19. The instant claim 58 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of de Jong et al 2002 (Vaccine 20, 2002, p. 3456–3464), Hitzeroth et al 2009 (Vaccine 27 (2009) 6432–6434), Gan et al 2014 (PLOS One, 2014, vol 9, issue 9, e108892), Zhao et al 2018 (Frontiers in Immunology, 2018, 9, article 932), Ella et al 2018 (US10058605B2, 08/28/2018), Burny et al 2018 (WO2018060288A1, 04/05/2018), Muller et al 2002 (WO2002038769A2, 05/16/2002), Cheung et al 2004 (Vaccine 23 (2004) 629–638), and Graham et al 2017 (Clinical Science (2017) 131 2201–2221), as applied to claims 54-57 above and further in view of Huber et al 2017 (PLoS One. 2017 Jan 5;12(1):e0169533), and Chen et al 2008 (Cancer Immunol Immunother. 2008 Apr;57(4):517-30).
Claim 58: The combined teachings of de Jong et al 2002, Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Cheung et al 2004 and Graham et al 2017 teaches claim 56 as recited supra. However, does not teach added limitations of claim 58.
Huber et al 2017 is in the art and teaches the added limitations of instant claim 58 on HPV-16 VLP vaccine, adjuvant, immunogenic composition VLP, immunization of subjects (See, abstract, methods, entire article).
Huber et al 2017 does not teach cationic lipid adjuvant.
Chen et al 2008 is in the art and teaches HPV-16 E7 polypeptide vaccine vaccination comprising cationic lipid adjuvant as a simple but effective cancer vaccine consisting of an antigen and a cationic lipid (See, abstract, methods, entire article).
It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of de Jong et al 2002, Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Cheung et al 2004, Graham et al 2017 with additional teachings of Huber et al 2017, and Chen et al 2008 to arrive at the inventions of claim 58. One of the ordinary skills would have been motivated to develop the HPV-16 L2E6 fusion protein and HPV-16 L2E6 fusion protein VLPs combined with adjuvant for immunization of subjects for efficacious prophylactic or therapeutics for human subjects, and additionally use of the hybrid fusion protein L2E6 VLPs for serological assays to study the immune response and for commercial success of the VLP vaccine(s) or immunogen(s). There would be a reasonable expectation of success given the applied prior art teachings in the art to render the claim 58 obvious as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions of claim 58. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
20. The instant claim 62 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of de Jong et al 2002 (Vaccine 20, 2002, p. 3456–3464), Hitzeroth et al 2009 (Vaccine 27 (2009) 6432–6434), Gan et al 2014 (PLOS One, 2014, vol 9, issue 9, e108892), Zhao et al 2018 (Frontiers in Immunology, 2018, 9, article 932), Ella et al 2018 (US10058605B2, 08/28/2018), Burny et al 2018 (WO2018060288A1, 04/05/2018), Muller et al 2002 (WO2002038769A2, 05/16/2002), Cheung et al 2004 (Vaccine 23 (2004) 629–638), Graham et al 2017 (Clinical Science (2017) 131 2201–2221) as applied to claims 54-57 above and further in view of Cui et al 2005 (Cancer Immunol Immunother. 2005 Dec;54(12):1180-90).
Claim 62: The combined teachings of de Jong et al 2002, Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Cheung et al 2004 and Graham et al 2017 teaches claim 57 as recited supra. However, does not teach added limitations of claim 62.
Cui et al 2005 is in the art and teaches additional limitations of instant claim 62, an immune composition characterized by comprising the vector, pharmaceutically acceptable vehicles, excipients and carriers, and optionally comprises vaccine adjuvants, particularly cationic lipids and HPV Virus-like particles (VLPs), wherein the composition comprises dosage forms administered intramuscularly and intradermally, preferably administered with syringes and needles, by electroporation, bioinjectors without needles, or by techniques like DNA tattooing, or orally (See, abstract, methods, entire article).
It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of de Jong et al 2002, Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Graham et al 2017 with additional teachings of Cui et al 2005 to arrive at the inventions of claim 62. One of the ordinary skills would have been motivated to develop the HPV-16 L2E6 DNA vector vaccine combined with adjuvant for immunization of subjects for efficacious prophylactic or therapeutics for human subjects. There would be a reasonable expectation of success given the applied prior art teachings in the art to render the claim 62 obvious as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions of claim 62. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
21. The instant claims 59-61, and 63 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of de Jong et al 2002 (Vaccine 20, 2002, p. 3456–3464), Hitzeroth et al 2009 (Vaccine 27 (2009) 6432–6434), Gan et al 2014 (PLOS One, 2014, vol 9, issue 9, e108892), Zhao et al 2018 (Frontiers in Immunology, 2018, 9, article 932), Ella et al 2018 (US10058605B2, 08/28/2018), Burny et al 2018 (WO2018060288A1, 04/05/2018), Muller et al 2002 (WO2002038769A2, 05/16/2002), Cheung et al 2004 (Vaccine 23 (2004) 629–638) and Graham et al 2017 (Clinical Science (2017) 131 2201–2221) as applied to claims 54-57 above and further in view of Cui et al 2005 (Cancer Immunol Immunother. 2005 Dec;54(12):1180-90), Huber et al 2017 (PLoS One. 2017 Jan 5;12(1): e0169533), Chen et al 2008 (Cancer Immunol Immunother. 2008 Apr;57(4):517-30), Karanam et al 2009 (Vaccine 27 (2009) 1040–1049),
Yan et al 2009 (Vaccine 27 (2009) 431–440), Haga et al 2017 (Papillomavirus Res. 2017 Jun;3:1-6), Gambhira et al 2006 (Cancer Res. 2006 Dec 1;66(23):11120-4).
Claims 59-61, and 63: The instant claims 59-61, and 63 are “use” claims. For examination purpose the claims are interpreted as immunogenic composition claims intended to produce the claimed prophylactic and therapeutic effects in the subject.
The combined teachings of de Jong et al 2002, Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Cheung et al 2004, and Graham et al 2017 teaches claim 54-57 as recited supra. The combined prior arts and additionally cited prior arts as recited below teach added limitations of claims 59-61, and 63 as below:
de Jong et al 2002 is in the art and teaches TA-CIN is a vaccine that comprises the human papillomavirus (HPV) type 16 L2, E6 and E7 as a single fusion protein. In a mouse model, TA-CIN effectively prevented outgrowth of HPV16-positive tumour cells. To assess the safety and immunogenicity of TA-CIN, a dose escalating (26, 128, 533 micro g), double blind and placebo-controlled phase I study was conducted in 40 healthy volunteers. TA-CIN was administered without adjuvant by intramuscular injection on weeks 0, 4 and 8. No serious adverse events of the vaccination were reported during the study. Both IgG antibodies and proliferative responses against TA-CIN were elicited at all three doses. The vaccine induced HPV16 specific antibodies as well as E6 and/or E7 specific T-cell responses in the majority of subjects. More importantly, T-cell immune response against the HPV16 E6 and E7 oncoproteins was detected by IFN gamma ELISPOT in 8/11 evaluable subjects vaccinated with the 533 micro g dose (See, abstract, figures, entire article).
Karanam et al 2009 teaches vaccination with HPV16 L2E6E7 fusion protein combined with an adjuvant elicits protective humoral and cell-mediated immunity (See, abstract, methods, results, figures, entire article).
Gambhira et al 2006 teaches vaccination of healthy volunteers with human papillomavirus type 16 L2E7E6 fusion protein induces serum antibody that neutralizes across papillomavirus species. A fusion protein comprising HPV16 L2, E6, and E7 (HPV-16 L2E6E7) is a candidate combination preventive and therapeutic HPV vaccine. The L1- and L2-specific and neutralizing serum antibody titers and peripheral blood mononucleocyte antigen-specific proliferative responses generated by vaccination thrice at monthly intervals with HPV16 L2E7E6 were compared in two studies: a phase I randomized double-blind placebo-controlled dose escalation trial in 40 healthy volunteers and a phase II trial of HPV16 L2E7E6 at the maximum dose in 29 women with high-grade anogenital intraepithelial neoplasia (AGIN). Vaccination of healthy volunteers induced L2-specific serum antibodies that were detected 1 month after the final vaccination (P(binomial) < 0.001). There was a significant trend to seroconversion for HPV16 and HPV18 neutralizing antibodies with increasing vaccine dose (P = 0.006 and P = 0.03, respectively). Seroconversion for HPV18 neutralizing antibodies showed a significant positive trend with increasing dose (P = 0.03) and was associated with seroconversion for HPV16 neutralizing antibodies (P(exact) = 0.04). The antigen-specific proliferative response of vaccinated healthy volunteers also showed a significant trend with increasing vaccine dose (P = 0.04). However, AGIN patients responded less effectively to vaccination than healthy patients for induction of HPV16 L2-specific antibody (P < 0.001) and proliferative responses (P < 0.001). Vaccination of healthy volunteers thrice with 533-mug HPV16 L2E7E6 at monthly intervals induced L2-specific serum antibodies that neutralized across papillomavirus species. Responses in AGIN patients were infrequent (See, abstract, methods, figures, entire article). Importantly, antibody responses to L2 are broadly cross-neutralizing and therefore, L2 could potentially provide protection against a broad spectrum of oncogenic HPVs (See, introduction, page 11120, col 2, para 2). HPV E6 and E7 are expressed in all HPV-infected cells and are required for maintenance of a transformed phenotype. Vaccination of mice with HPV16 L2E7E6 fusion protein in adjuvant induces the rejection of a murine model of cervical cancer (See, introduction, page 11120, col 2, para 3).
Gan et al 2014 is in the art and teaches preventive anti-HPV vaccines are effective against HPV infection but not against existing HPV-associated diseases, including cervical cancer and other malignant diseases. To improve anti-tumor effects of therapeutic vaccine, we fused cytotoxic T-lymphocyte antigen 4 (CTLA-4) with HPV16 E7 and E6 as a fusion therapeutic DNA vaccine (pCTLA4-E7E6). pCTLA4-E7E6 induced significantly higher anti-E7E6 specific antibodies and relatively stronger specific CTL responses than the nonfusion DNA vaccine pE7E6 in C57BL/6 mice bearing with TC-1 tumors. pCTLA4-E7E6 showed relatively stronger anti-tumor effects than pE7E6 in therapeutic immunization. These results suggest that fusing CTLA-4 with E7E6 is a useful strategy to develop therapeutic HPV DNA vaccines. In addition, fusing the C-terminal of E7 with the N-terminal of E6 impaired the functions of both E7 and E6 (See, abstract).
Yan et al 2009 is in the art and teaches induction of antitumor immunity in vivo following delivery of a novel HPV-16 DNA vaccine encoding an E6/E7 fusion antigen and expressing the fusion protein under the control of cytomegalovirus immediate-early promoter. Prophylactic administration of this vaccine resulted in 100% protection against HPV E6 and E7-expressing tumors. Therapeutic studies indicated that vaccination with pConE6E7 prevented or delayed the growth of tumors (See, abstract, methods, figures, results, entire article).
Haga et al 2017 is in the art and teaches cytokines mediate important immunoregulatory functions, and changes in their relative levels play key roles in the immune response to pathogens. TNF-alpha is a major pro-inflammatory cytokine that is implicated in several infectious diseases and cancer. The level of expression of TNF-alpha has been suggested to be involved in the elimination of HPV or development of HPV-related cancers (See, abstract, page 1, col 2, para 2).
It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings as applied to claims 54-57 with additional teachings on method of administration of the claimed immunogenic composition of claims 56-57 to a subject to induce prophylactic and therapeutic humoral and cellular immune responses in the subject against HPV 16 cancers. The additional teachings of de Jong et al 2002, Hitzeroth et al 2009, Gan et al 2014, Zhao et al 2018, Ella et al 2018, Burny et al 2018, Muller et al 2002, Cheung et al 2004, Graham et al 2017, Cui et al 2005, Huber et al 2017, Chen et al 2008, Karanam et al 2009, Yan et al 2009, Haga et al 2017, Gambhira et al 2006 as recited supra are incorporated above to arrive at the inventions of claims 59-61, and 63. One of the ordinary skills would have been motivated to develop the use claims for including incorporating adjuvant intended enhanced prophylactic and therapeutic effects by the induced antibody, T cell immune responses, TNF response in the subjects against L2, E6 proteins of the HPV-16 virus and HPV cancers for commercial success. There would be a reasonable expectation of success given the applied prior art teachings in the art to render the claims 59-61, and 63 obvious as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions of claims 59-61, and 63. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
22. Relevant Prior Arts:
Gupta SK, Singh A, Srivastava M, Gupta SK, Akhoon BA. In silico DNA vaccine designing against human papillomavirus (HPV) causing cervical cancer. Vaccine. 2009 Dec 10;28(1):120-31.
Wu et al 2019. Translation affects mRNA stability in a codon-dependent manner in human cells. eLife 8:e45396.
Conclusion
23. No claim is allowed.
24. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/ Examiner, Art Unit 1672
/BENNETT M CELSA/ Primary Examiner, Art Unit 1600