DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Effective Filing Date
The present application, filed on June 8, 2022, is a 371 of PCT/CN2020/092900, filed on May 28, 2020, and claims the benefit of foreign priority to CHINA 201911330414.X, filed on December 20, 2019.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on April 9, 2026 has been entered.
Claim Status/Action Summary
This action is in response to the papers filed on April 9, 2026.
Claim 1 is pending in the present application. Claims 2-11 were canceled in the response.
Claim 1 is under examination.
Applicant is reminded that no new matter may be added to the application.
Any objections and rejections not reiterated below are hereby withdrawn.
The 112(a) written description rejection has been withdrawn in view of the amendment to the claims now requiring “the Y-type universal adapter consists of SEQ ID NO: 99 and SEQ ID NO: 100”
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
The sequence disclosures are located:
In claim 1 and page 12 of the specification, “CCTACACGACGCTCTTCCGATCTAGCAGTTCCTGCTTGCCATG (SEQ ID NO: 58)” does not match “SEQ ID NO: 58” in the sequence listing and CRF.
SEQ ID NO: 58 in the sequence listing is the sequence: “GACGCTCTTCCGATCTAGCAGTTCCTGCTTGCCATG”.
Upon inspection, the SEQ ID NO: 58 in the sequence disclosure appears to be a truncation of the corresponding sequence in the specification and the claims, wherein the final 7 nucleotides at the 5’ end are omitted in the sequence disclosure and CRF relative to the sequence in the specification and the claims.
Specific deficiency – This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
37 CFR 1.822(c)(5-6) requires:
(5) A nucleotide sequence shall be represented, only by a single strand, in the 5 to 3 direction, from left to right.
(6) The enumeration of nucleotide bases shall start at the first base of the sequence with number 1. The enumeration shall be continuous through the whole sequence in the direction 5 to 3. The enumeration shall appear in the right margin, next to the line containing the one-letter codes for the bases and giving the number of the last base of that line.
In the present disclosure (drawings Fig. 2, claim 1, sequence listing, and CRF), SEQ ID NO: 100 is represented in the 3’ to 5’ direction, from left to right (compare figure 2 below to SEQ ID NO: 100).
Claim 1: “GAGAGCGATTGTTCGAGTCGATTACTCTGCCCAGATGA (SEQ ID NO: 100)”
PNG
media_image1.png
250
723
media_image1.png
Greyscale
This representation is acceptable in the Figures, but is of improper form in the sequence disclosure and CRF. Accordingly, the sequence listing of SEQ ID NO: 100 is not in compliance with the requirements of 37 CFR 1.821 - 1.825.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claim 1 is rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
Claim 1 recites apparently contradictory language “detection… at 46… SNP sites… wherein the 46 sites comprise” which may be reasonably interpreted in at least the following ways: 1) the claim requires detecting exactly 46 SNP sites that are the 46 SNP sites recited by the claim, 2) the claim requires detecting at least 46 SNP sites comprising the 46 SNP sites recited by the claim, 3) the claim requires detecting exactly 46 SNP sites that may be the specific combination of 46 SNP sites recited by the claim or may comprise a different combination of 46 SNPs, 4) the claim requires detecting exactly 46 SNP sites that are the 46 SNP sites recited by the claim using only the 46 primer pairs recited by the claim, or 5) the claim requires detecting exactly 46 SNP sites that are the 46 SNP sites recited by the claim using primers that are designed for a combination of 46 SNP sites, wherein the SEQ 1-96 are exemplary primers for the 46 SNP sites.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 1 recites the broad recitations: (i) “the 46 SNP sites comprise”, (ii) “the method comprises: (1) designing forward-strand probes and reverse-strand probes for 46 SNP sites:” and the claim also recites “…detection of gene rare mutation at 46 single nucleotide polymorphism (SNP) sites” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Put differently, it is unclear whether the claim language limits the method only to detection of mutation at the 46 SNP sites recited in the claim using only the primers referred to in the step “designing forward-strand probes and reverse-strand probes for 46 SNP sites:” followed by a table of specific primer pairs identified by specific SEQ ID NOs for each of 46 SNPs identified by dbSNP reference numbers “rs#####”, or whether the “comprising” language is meant to encompass embodiments wherein different combinations of 46 SNPs are detected, or even embodiments wherein more than 46 SNPs are detected.
As described in the objection to the sequence disclosures, claim 1 recites a “SEQ ID NO: 58” that is not identical to the SEQ ID NO: 58 in the sequence listing, CRF, and specification. It is noted that the claimed sequence differs from the sequence in the rest of the application in that the sequence recited by the claims omits the terminal 7 nucleotides at the 5’ end of the polynucleotide.
It is unclear which version of SEQ ID NO: 58 is required by the claim.
Claim 1 recites “SEQ ID NO: 100: GAGA…AGTGA” without including any polarity indicators (i.e. 5’, 3’ ). The ordinary artisan, reading the language of the claim, would assume the polynucleotide sequence is presented in the conventional manner (left to right, 5’ to 3’). However, as evidenced by figure 2, this sequence appears to be represented in an inverse orientation (left to right, 3’ to 5’). There is no language in the claim that would inform one having skill in the art that this oligonucleotide is not represented in the conventional manner (i.e. left to right, 5’ to 3’). Although only one version of the ambiguous polynucleotide sequence is described in the specification, it is not proper to import this limitation from the specification into the claims. See MPEP 2111.01: "Though understanding the claim language may be aided by explanations contained in the written description, it is important not to import into a claim limitations that are not part of the claim. For example, a particular embodiment appearing in the written description may not be read into a claim when the claim language is broader than the embodiment.".
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over Zimmermann et al., US 2013/0123120 A1 (published May 16, 2013) in view of Jensen et al., WO 2018136881 A1 (published July 26, 2018), Illumina A, “MiSeq System Custom Primers Guide” Document # 15041638 v01 (February 2016), Illumina B, “Illumina Adapter Sequences” Document # 1000000002694 v01 (February 2016), Rychlik, “A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing, and in vitro amplification of DNA” Nucleic Acids Research Vol. 17, No. 21, pp 8543-8551 (1989), Buck “Design Strategies and Performance of Custom DNA Sequencing Primers” BioTechniques, 27:3, 528-536 (1999), and Chen et al., “gencore: An Efficient Tool to Generate Consensus Reads for Error Suppressing and Duplicate Removing of NGS data”, bioRxiv 501502; doi: https://doi.org/10.1101/501502 (Published September 6, 2019).
Regarding claim 1, Zimmermann et al. teach high throughput, highly multiplex methods for detecting allele frequencies of targeted genetic variants (Zimmermann et al., paragraph 0008). Zimmermann et al. teach that said methods comprise designing gene-specific probes, constructing a genomic library, amplifying the genomic library by so-called “hemi-nested” PCR reactions wherein a product is amplified from each strand of a library molecule comprising a genetic variant of interest using a gene-specific primer wherein the 5’ end of the gene specific primer has a universal adapter sequence, and a primer specific to the universal adapter sequence on the target library molecule (Zimmermann et al., figure 9).
PNG
media_image2.png
609
630
media_image2.png
Greyscale
Zimmermann et al. further teach sequencing the hemi-nested PCR products, performing genome alignment, and analyzing the sequencing data (i.e. counting a sequencing depth of each allele) to calculate the allele frequency (i.e. mutation/allele proportion) at a given target locus (i.e. “X” in figure 9) (Zimmermann et al., paragraph 0605-0612).
Zimmermann et al. further teach alternative nesting workflows comprising “one-sided mini-PCR” wherein target loci are amplified using a pair of primers comprising one or a set of forward primers and a tag-specific (i.e. universal) reverse primer or one or a set of reverse primers and a tag-specific (i.e. universal) forward primer (Zimmermann et al., paragraph 0251).
Finally, Zimmermann et al. teach performing such multiplex PCR and sequencing protocols in triplicate (i.e. for 3 DNA samples) (Zimmermann et al., paragraph 0604).
Zimmermann et al. does not teach grouping/aligning sequences with the same start and end coordinates and filtering bases occurring with less than 10% frequency among sequences with the same start and end coordinates at a target site (i.e. filtering sequencing/PCR errors).
However, Chen et al. teach a publicly available sequence analysis tool “gencore” that groups reads with the same start and end coordinates by “position clustering”, subsequently filtering clusters with fewer supporting reads than a user-defined threshold, scoring each position in the cluster based on the frequency of a given base at that position, and generating a consensus sequence for the cluster of reads with the same start and end coordinates (Chen et al., Figure 1 and pages 7-8). Chen et al. further teaches gencore is particularly useful for reducing sequencing errors when detecting low-frequency mutations in cancer sequencing data such as in liquid biopsies because the detection of such low-frequency variants can be seriously affected by PCR and sequencing errors (Chen et al., page 9, line 197- page 10, line 204). Finally, Chen et al. teach that gencore filters out PCR/sequencing errors that occur at random positions in a minority of reads with the same start and end coordinates (Chen et al., Figure 4).
PNG
media_image3.png
280
662
media_image3.png
Greyscale
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have combined: (A) The molecular techniques taught by Zimmermann et al. comprising preparing a genomic sequencing library and amplifying targeted loci comprising a particular variant of interest by so-called “hemi-nested” PCR resulting in two clusters of PCR products with the same start and end positions comprising: a universal adapter sequence, genomic DNA, a position of interest “X”, genomic DNA, the target-specific primer binding site, and a universal adapter sequence with (B) the sequence analysis method taught by Chen et al. comprising aligning/clustering sequencing reads with the same start and end coordinates, filtering “random” PCR/sequencing errors based on their inconsistency among a cluster of presumed PCR duplicates, and scoring the proportion of each nucleotide at each position along the consensus generated from said cluster (i.e. reporting a sequencing depth/mutation proportion of each observed variant/allele).
The ordinary artisan would have been motivated to combine the analytical techniques taught by Chen et al. with the multiplexed, “hemi-nested” PCR amplification molecular techniques taught by Zimmermann et al. because of the teaching of Chen et al. that said analysis is particularly important for determining the frequency of low-frequency variants in applications such as liquid biopsy of cancer from samples such as blood, urine, or malignant effusion wherein the minor allele fraction of important variants can be much lower than 1%. Chen et al. further teaches that at such low-frequencies, the detection of these true mutations/variants can be seriously affected by sequencing/PCR errors, thus necessitating their filtration from deep-sequencing data. The ordinary artisan would have been reasonably confident that the analytical methods taught by Chen et al. would have improved the sensitivity of the molecular methods taught by Zimmermann et al. because they are both specifically intended to detect and quantify the frequency of sequence variants in complex populations of nucleic acid molecules (such as the fraction of fetal DNA in maternal blood or the fraction of cancer DNA in blood).
Regarding the requirement for the specific nucleotide sequences SEQ ID NO: 1-98 (the gene-specific forward and reverse primers), SEQ ID NO: 93-94 (the forward and reverse universal primers, respectively), the outer nesting primer “UNIPCRF” (SEQ ID NO: 95), and indexing primers “UDIR0001”, “UDIR0002”, and “UDIR0003” (SEQ ID NO: 96, 97, and 98), each of these sequences are disclosed by Illumina B (see multiple sequence alignments below).
To summarize the alignments that follow,
Illumina B discloses “TruSeq DNA Methylation index PCR primer” which is 100% identical to the library molecule portion “5’-UDIR-forward universal primer-”
Illumina B discloses “TruSeq Universal Adapter”, the reverse complement of which is 100% identical to the library molecule portion 5’-Target Specific Reverse Primer (“cctacacgacgctcttccgatct” common to all target specific primers SEQ ID NO: 1-98)-UNIPCRF (SEQ ID NO: 95)
For Library rev: 5’-UDIR[index]UDIR-FwUniPrimer-Yadapt-/targetSequence/-TargetSpecificRevPrimer-UNIPCRF-3’:
OligoID SEQUENCE position in lib
claim CAAGCAGAAGACGGCATACGAGAT[index] lib24
96 CAAGCAGAAGACGGCATACGAGAT[index]
Y CAAGCAGAAGACGGCATACGAGAT[index]
claim GTGACTGGAGTTCAGACGTGTGCT lib48
Y GTGACTGGAGTTCAGACGTGTGCT
96 GTGACTGGAGTTCAGACGTG
93 TCAGACGTGTGCT
claim CTTCCGATCTCAAGAACGGAATGT lib73
Y CTTCCGATCT
99 CAAGAACGGAATGT
93 CTTCCGATCTCAAGAACGGAATGT
claim GTACTTGCATGAGACGGGTCTACTT-[INSERT+targetSequenceNearSNP]- lib98
99 GTACTTGCATGAGACGGGTCTACTT-[INSERT+targetSequenceNearSNP]-
93 GTACTTGC
rSNP’ -[TargetSequenceNearSNP]’-
claim AGATCGGAAGAGCGTCGTGTAGGGA lib123
Z’ AGATCGGAAGAGCGTCGTGTAGGGA
rSNP’ AGATCGGAAGAGCGTCGTGTAGG
95’ GTCGTGTAGGGA
claim AAGAGTGTAGATCTCGGTGGTCGCC lib148
Z’ AAGAGTGTAGATCTCGGTGGTCGCC
95’ AAGAGTGTAGATCTCGGTGGTCGCC
claim GTATCATT lib156
Z’ GTATCATT
95’ GTATCATT
rSNP=reverse complement of 5’ end of target specific primer
93= “forward universal primer” seq 93
Y= TruSeq DNA Methylation index PCR primer
Z’=reverse complement of TruSeq Universal Adapter
99= SEQID NO 99
95’=unipcrf REV COMP (reverse complement of seq 95)
96=UDIR[generic], exemplified by seqid no 96
To summarize the alignments that follow,
Illumina B discloses “TruSeq Universal Adapter” which is 100% identical to the library molecule portion “5’-UNICPRF-Target Specific Reverse Primer (“cctacacgacgctcttccgatct” common to all target specific primers SEQ ID NO: 1-98)
Illumina B discloses “TruSeq DNA Methylation index PCR primer”, the reverse complement of which is 100% identical to the library molecule portion “-reverse universal primer-UDIR-3’ ”
For Library fwd: 5’-UNIPCRF-TargetSpecificFwPrimer-/targetSequence/-Yadapt-RevUniPrimer-UDIR[index]UDIR-3’
OligoID SEQUENCE position in lib
claim AATGATACGGCGACCACCGAGATC lib24
Z AATGATACGGCGACCACCGAGATC
95 AATGATACGGCGACCACCGAGATC
claim TACACTCTTTCCCTACACGACGCT lib48
Z TACACTCTTTCCCTACACGACGCT
95 TACACTCTTTCCCTACACGAC
SNP CCTACACGACGCT
claim CTTCCGATCT-[TargetSequenceNearSNP+INSERT]- lib58
Z CTTCCGATCT-[TargetSequenceNearSNP+INSERT]-
SNP CTTCCGATCT-[TargetSequenceNearSNP]
claim AGTAGACCCGTGTCATTAGCTGAG lib82
r100 AGTAGACCCGTGTCATTAGCTGAG
94’ TAGCTGAG
claim CTTGTTAGCGAGAGAGATCGGAAG lib106
r100 CTTGTTAGCGAGAG
94’ CTTGTTAGCGAGAGAGATCGGAAG
Y’ AGATCGGAAG
claim AGCACACGTCTGAACTCCAGTCAC[Index] lib130
94’ AGCACACGTCTGA
Y’ AGCACACGTCTGAACTCCAGTCAC[index]
96’ CACGTCTGAACTCCAGTCAC[index]
claim ATCTCGTATGCCGTCTTCTGCTTG lib154
Y’ ATCTCGTATGCCGTCTTCTGCTTG
96’ ATCTCGTATGCCGTCTTCTGCTTG
3’
Z = TruSeq Universal adaptor
SNP= 5’ end of target specific primer
r100=reverse seq 100 (not reverse complement)
94’ = REV complement of “reverse universal adaptor” (rev complement of seq 94)
Y’= rev complement of “TruSeq DNA Methylation index PCR primer”
95=unipcrf (seq 95)
96’=UDIR reverse complement [generic] exemplified by seq id no 96
Illumina B does not disclose the portions of the target-specific forward and reverse primers (SEQ ID NO: 1-98) that hybridize to nucleic acid sequences near the specified SNPs.
However, each of these SNPs are identified by a SNPdb identifier, “rs”, are mapped onto the human genome (hg38), and the exact sequences of the target-specific portion of the target-specific primers SEQ ID NO: 1-98 are each naturally occurring sequences selected from the known sequence of hg38.
There does not appear to be a particular reason cited by the disclosure for the combination of these 46 SNPs beyond apparent applications to identifying particular individuals within a population (i.e. haplotype analysis). Zimmermann et al. teach methods comprising co-amplifying thousands of SNPs from genomic DNA using so-called hemi-, semi-, and mini- PCR methods using gene-specific primers that comprise binding sites for universal primers and universal primers that bind to adapter sequences ligated to said genomic DNA.
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have selected any number of SNPs having low frequency in a particular population for the purpose of haplotype analysis (e.g. identifying an individual from a nucleic acid sample), particularly in the field of forensic analysis. Furthermore, the ordinary artisan would have been motivated to select an arbitrarily large number of SNPs (especially unlinked SNPs spread across multiple chromosomes) having low frequency in a population to arbitrarily increase the resolution and/or confidence in assigning a particular sample to a particular individual.
Regarding the selection of naturally occurring polynucleotide sequences that function as primers based on known nucleic acid sequences, Rychlik teaches is it routine and predictable to make primers for DNA amplification wherein primers are designed to a known oligonucleotide sequence. Rychlik teaches criteria to design/choose suitable primers for DNA amplification (see whole document and Abstract). Furthermore, Buck expressly provides evidence of the equivalence of primers. Specifically, Buck invited primer submissions from a number of labs (39) (Pg. 532, column 3), with 69 different primers being submitted (pg. 530, column 1). Buck also tested 95 primers spaced at 3 nucleotide intervals along the entire sequence at issue, thereby testing more than 1/3 of all possible 18-mer primers on the 300 base pair sequence (pg 530, column 1). When Buck tested each of the primers selected by the methods of the different labs, Buck found that every single primer worked (pg. 533, column 1). Further, every single control primer functioned as well (pg. 533, column 1). Buck expressly states, “The results of the empirical sequencing analysis were surprising in that nearly all of the primer yielded data of extremely high quality (pg. 535, column 2).” Therefore, Buck provides direct evidence that all primers would be expected to function, and in particular, all primers selected according to the ordinary criteria. This clearly shows that every primer would have a reasonable expectation of success.
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the methods taught by Zimmermann et al. and Chen et al. with the well-known and commercially available sequences of Illumina B for high-throughput, “next-generation” sequencing libraries ( TruSeq Universal Adapter and TruSeq DNA Methylation index PCR primer) as described in the multiple sequence alignments above.
Illumina B does not appear to disclose the sequence of the particular Y-type universal adapter consisting of SEQ ID NO: 99 and 100.
However, Jensen et al. teach methods for barcoding of template molecules comprising ligation of nonrandom oligonucleotide adapter sequences provided in a “Y-shape”, wherein the polynucleotides that comprise the Y-adapter comprise sequencing adapter polynucleotides (e.g. Illumina adapter sequences or other sequencing adapter sequences) and universal sequences for amplification primer binding (Jensen et al., page 12, line 28-34, see also, figure 11).
As is apparent from the multiple alignments above, the claimed Y-adapter sequence consists of a single stranded region that is a universal primer binding sequence (see, for example, 94’ and Y’ above) and a double stranded region that comprises a ligatable-end. Jensen et al. teach that the double stranded portion of Y-adapters may be customized to comprise Illumina adapter sequences, other adapter sequences, and/or barcode sequences unique to the Y-adapter (Jensen et al., page 12, line 28-34, see also, figure 11).
Furthermore, Illumina A teaches that high-throughput sequencers are readily adapted to utilize custom sequencing primers.
Therefore, absent unexpected results, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have substituted the Illumina Y-adaptors taught by Illumina B, with any sequence according to the formulas taught by Jensen et al., wherein a Y-adaptor minimally consists of an unpaired (i.e. single stranded) universal primer binding site and a double stranded region comprising a ligatable end because Jensen et al. demonstrate that different Y-adaptor sequences are interchangeable equivalents in methods for constructing nucleic acid sequencing libraries.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ZACHARY MARK TURPIN whose telephone number is (703)756-5917. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Z.M.T./Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Prosecution Insights