DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Applicant’s submission filed 31 December 2025 has been entered. Claims 1, 6, 13-15, 23, 25, 41, 43-44, 47-48, 56, 58, and 60-62 are pending. Claims 1, 6, and 25 have been amended, while claims 3-4, 7, 9-10, and 29 have been cancelled without prejudice or disclaimer and claims 60-62 have been newly added. Therefore, prosecution on the merits continues for claims 1, 6, 13-15, 23, and 60-62 as being drawn to the elected invention, with claims 25, 41, 43-44, 47-48, 56, and 58 withdrawn for reading on the non-elected invention(s). All arguments have been fully considered with the status of each prior ground of rejection set forth below.
Status of Prior Rejections/Response to Arguments
RE: Objection to the Specification
The substitute Specification filed 31 December 2025 is acknowledged and entered into the application filed. With that, the substitute Specification removes the reference to colors within Figures 16C and 17C, thus obviating the objection of record.
Therefore, the objection is withdrawn.
RE: Rejection of claims 1, 3-4, 6, 13-15, and 23 under 35 USC 102(a)(1) and 35 USC 102(a)(2) over Fraietta et al
The cancellation of claims 3-4 renders the rejection moot for those claims. For the remaining
claims, Applicant has amended independent claim 1 to require the engineered immune cell to comprise a polynucleotide encoding an interferon γ targeting guide RNA and a polynucleotide encoding an endogenous T cell receptor targeting guide RNA. It is of note that the amendment incorporates the limitation from previous claim 4, as well as presents a new limitation, thus obviating the rejection of record.
Therefore, the rejection is withdrawn.
However, Applicant’s remarks are addressed in so far as they apply to the claims as currently written:
Applicant has traversed the rejection, asserting in Page 7 of the Remarks filed 31 December 2025 that Fraietta et al fail to disclose “an endogenous T cell receptor targeting guide RNA”. In response, the Examiner respectfully submits that Fraietta et al disclose that the T cell can be further engineered such that it does not express one or more subunits that comprise a functional TCR (Page 220). Fraietta et al further disclose that a CRISPR system can be utilized to engineer the T cell (Pages 220-222). Therefore, the ordinary artisan would recognize that the engineered CAR-T cells of Fraietta et al can be further engineered to comprise a guide RNA targeting an endogenous T cell receptor.
New Grounds of Rejection
Claim Objections
Claims 23 and 62 are objected to because of the following informalities:
Regarding claims 23 and 62: The instant claims are objected to for their inconsistent recitation of the term “T cell” within the claim language. More specifically, instant claim 23 recites the term as “T-cell”, whereas instant claim 62 recites it as “T cell”. Applicant must amend the claim language such that the recitations of the term are consistent throughout the entire set.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 6, 13-15, 23, and 60-62 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 1, 6, 13-15, 23, and 60-62: Independent claim 1 recites the limitation “… an endogenous T cell receptor (TRAC) targeting guide RNA” in Line 5. The scope of the claim is indefinite, as it is unclear if the parenthetical language is required by the claim, or is instead optional. Therefore, since the recitation of the parenthetical language is being treated as exemplary language, the metes and bounds of the claim cannot be determined.
Instant claims 6, 13-15, 23, and 60-62 are included within the rejection because they are dependent upon the rejected claim and fail to correct the insufficiencies of the rejected claim, thus rendering them indefinite as well.
Appropriate correction is required.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 6, 13-15, 23, and 61-62 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Cooper et al (WO 2019/232425 A1, of record on IDS filed 28 July 2025). Cooper et al has a publication date of 05 December 2019.
Cooper et al disclose methods of gene editing – or endogenous suppression – of cytokines, chemokines, and/or transcription factors secreted from chimeric antigen receptor (CAR)-T cells for the mitigation of cytokine release syndrome and/or CAR-T associated neuropathy, as well as the CAR-T cells thereof (Abstract).
As such, Cooper et al disclose the engineering of a CAR-T cell via a CRISPR/Cas9 system, wherein the CAR-T cell comprises a Cas9 nuclease, as well as guide RNAs targeting (i) an interferon γ gene and (ii) an endogenous TRAC gene (Paragraphs [003], [022]-[028], [034], [046], [0102]-[0108], [0116]-[0117], [0120]-[0122], [0129], [0161], [0168]-[0169], [0172], [0174], [0179], [0223], [0266], [0272], [0303], [0305]-[0309], [0318], [0326], [0340]; Tables 8, 10-11; Examples 2, 6-7, 9; Figure 1).
Cooper et al further disclose that the CAR comprises an extracellular antigen-binding domain that is a scFv specific for CD19, a transmembrane domain, and an intracellular domain (Paragraphs [0136], [0140], [0156]-[0160], [0166], [0285], [0287], [0314]; Table 11).
Accordingly, Cooper et al anticipate that claims as follows:
Regarding claims 1, 23, and 62: Cooper et al disclose a CAR-T cell (claims 23, 62) comprising guide RNAs targeting (i) an interferon γ gene and (ii) an endogenous TRAC gene. This therefore reads on the engineered immune cell of instant claim 1.
Regarding claim 6: Following the discussion of claim 1, Cooper et al further disclose that the CAR-T cell is engineered via a CRISPR/Cas9 system, wherein the CAR-T cell further comprises a Cas9 nuclease. This therefore reads on the engineered immune cell of the instant claim.
Regarding claims 13-15 and 61: Following the discussion of claim 1, Cooper et al further disclose that the CAR comprises an extracellular antigen-binding domain that is a scFv (claim 14) specific for CD19 (claims 15, 61), a transmembrane domain, and an intracellular signaling domain. This therefore reads on the engineered immune cell of instant claim 13.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 6, 13-15, 23, and 60-62 are rejected under 35 U.S.C. 103 as being unpatentable over Cooper et al (WO 2019/232425 A1, of record on IDS filed 28 July 2025) in view of Guccione et al (US 2020/0377883 A1).
The discussion of Cooper et al regarding claim 1 can be observed above and is relied upon
herein, the content of which is incorporated in its entirety. Cooper et al anticipate claims 1, 6, 13-15, 23, and 61-62. Guccione et al is considered prior art under 35 USC 102(a)(2), with an effective filing date of 27 June 2017.
Regarding claim 60: As aforementioned in the discussion of claim 1, Cooper et al disclose a CAR-T cell comprising a guide RNA sequence that targets an interferon γ gene.
Cooper et al do not disclose that the interferon γ targeting guide RNA sequence comprises the nucleotide sequence of instant SEQ ID NO: 1 or instant SEQ ID NO: 2, as required by instant claim 60.
Guccione et al, however, disclose antisense oligonucleotides for modulating the function of a T cell, including antisense oligonucleotides that hybridize to interferon γ (Abstract; Paragraphs [0014], [0024]). As such, Guccione et al disclose antisense oligonucleotides targeting exons 2 or 3 of interferon γ, wherein such an antisense oligonucleotide has the sequence set forth in SEQ ID NO: 8431 (Paragraphs [0014], [0026], [0030], [0108]-[0113]). It is of note that SEQ ID NO: 8431 of Guccione et al has 100% identity to instant SEQ ID NO: 2. See sequence alignment below.
Therefore, it would have been prima facie obvious to have substituted the interferon γ guide RNA sequence of Cooper et al with the interferon γ antisense oligonucleotide of Guccione et al, as doing so would have been a simple substitution of one interferon γ oligonucleotide for another. See MPEP § 2143(I)(B). One of ordinary skill before the effective filing date of the invention would have recognized that the two interferon γ oligonucleotides are functionally comparable, as both affect the function of the interferon γ gene within a T cell, and thus would have been able to substitute the interferon γ oligonucleotides with predictable results.
Consequently, Cooper et al as modified by Guccione et al render obvious a CAR-T cell comprising a guide RNA sequence that targets the interferon γ gene having the nucleotide sequence as set forth in SEQ ID NO: 8431 of Guccione et al. As SEQ ID NO: 8431 of Guccione et al and instant SEQ ID NO: 2 have 100% sequence identity, this therefore renders obvious the engineered immune cell of the instant claim.
Query Match 100.0%; Score 20; Length 20; Mismatches 0; Gaps 0;
Qy 1 TGAAGTAAAAGGAGACAATT 20 (INSTANT SEQ ID NO: 2)
:||||:||||||||||||::
Db 1 UGAAGUAAAAGGAGACAAUU 20 (GUCCIONE ET AL SEQ ID NO: 8431)
Claims 1, 6, 13-15, 23, and 61-62 are rejected under 35 U.S.C. 103 as being unpatentable over Fraietta et al (WO 2018/175733 A1, of record on IDS filed 13 September 2022).
Fraietta et al is considered prior art under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2).
Regarding claims 1, 6, 23, and 62: Fraietta et al disclose CAR-T cells with altered expression
and/or function of one or more genes associated with Tet2 (Abstract).
As such, Fraietta et al disclose a CAR-T cell that has a reduced interferon γ expression, wherein the reduced interferon γ expression is due to the suppression of the interferon γ gene via a CRISPR/Cas9 system (Pages 1-2, 43, 72-75, 80-85). Accordingly, Fraietta et disclose that the CAR-T cell comprises a guide RNA sequence that targets the interferon γ gene, as well as a Cas9 nuclease (Pages 82-85, 148-149, 213).
Fraietta et al further disclose that the CAR-T cell can be further engineered via a CRISPR system such that it does not express one or more subunits that comprise a functional TCR (Pages 220-222).
Fraietta et al do not explicitly disclose that the CAR-T cell comprises a guide RNA targeting an endogenous T cell receptor, as required by instant claim 1.
However, it would have been prima facie obvious to have modified the CAR-T cell of Fraietta et al such that it comprises a guide RNA sequence that targets the interferon γ gene as well as a guide RNA sequence that targets an endogenous T cell receptor gene. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to create a CAR-T cell that will not elicit an adverse immune reaction in a host (Page 220), and would have had a reasonable expectation of success given that the disclosure of Fraietta et al teaches the use of guide RNAs within the CRISPR/Cas9 system for the suppression or knockout of genes (Pages 80-85, 220-222). See MPEP § 2143(I)(G).
Consequently, Fraietta et al render obvious a CAR-T cell (claims 23, 62) comprising a Cas9 nuclease (claim 6), and guide RNA sequences that target (i) interferon γ gene and (ii) an endogenous T cell receptor gene. This therefore renders obvious the engineered immune cell of instant claim 1.
Regarding claims 13-15 and 61: Following the discussion of claim 1, Fraietta et al further disclose that the CAR comprises an extracellular antigen-binding domain that is a scFv (claim 14) specific for CD19 (claims 15, 61), a transmembrane domain, and an intracellular signaling domain (Pages 25-27, 37-38, 149-151, 159-194, 206-208, 234, 272). This therefore reads on the engineered immune cell of instant claim 13.
Claims 1, 6, 13-15, 23, and 60-62 are rejected under 35 U.S.C. 103 as being unpatentable over Fraietta et al (WO 2018/175733 A1, of record on IDS filed 13 September 2022) in view of Guccione et al (US 2020/0377883 A1).
The discussion of Fraietta et al regarding claim 1 can be observed above and is relied upon
herein, the content of which is incorporated in its entirety. Fraietta et al render obvious claims 1, 6, 13-15, 23, and 61-62. Guccione et al is considered prior art under 35 USC 102(a)(2), with an effective filing date of 27 June 2017.
Regarding claim 60: As aforementioned in the discussion of claim 1, Fraietta et al disclose a CAR-T cell comprising a guide RNA sequence that targets an interferon γ gene.
Fraietta et al further disclose that the guide RNA sequences target exons 2 or 3 of the genes (Pages 5-6, 10).
Fraietta et al do not disclose that the interferon γ targeting guide RNA sequence comprises the nucleotide sequence of instant SEQ ID NO: 1 or instant SEQ ID NO: 2, as required by instant claim 60.
Guccione et al, however, disclose antisense oligonucleotides for modulating the function of a T cell, including antisense oligonucleotides that hybridize to interferon γ (Abstract; Paragraphs [0014], [0024]). As such, Guccione et al disclose antisense oligonucleotides targeting exons 2 or 3 of interferon γ, wherein such an antisense oligonucleotide has the sequence set forth in SEQ ID NO: 8431 (Paragraphs [0014], [0026], [0030], [0108]-[0113]). It is of note that SEQ ID NO: 8431 of Guccione et al has 100% identity to instant SEQ ID NO: 2. See sequence alignment below.
Therefore, it would have been prima facie obvious to have substituted the interferon γ guide RNA sequence of Fraietta et al with the interferon γ antisense oligonucleotide of Guccione et al, as doing so would have been a simple substitution of one interferon γ oligonucleotide for another. See MPEP § 2143(I)(B). One of ordinary skill before the effective filing date of the invention would have recognized that the two interferon γ oligonucleotides are functionally comparable, as both affect the function of exons 2 or 3 of the interferon γ gene within a T cell, and thus would have been able to substitute the interferon γ oligonucleotides with predictable results.
Consequently, Fraietta et al as modified by Guccione et al render obvious a CAR-T cell comprising a guide RNA sequence that targets the interferon γ gene having the nucleotide sequence as set forth in SEQ ID NO: 8431 of Guccione et al. As SEQ ID NO: 8431 of Guccione et al and instant SEQ ID NO: 2 have 100% sequence identity, this therefore renders obvious the engineered immune cell of the instant claim.
Query Match 100.0%; Score 20; Length 20; Mismatches 0; Gaps 0;
Qy 1 TGAAGTAAAAGGAGACAATT 20 (INSTANT SEQ ID NO: 2)
:||||:||||||||||||::
Db 1 UGAAGUAAAAGGAGACAAUU 20 (GUCCIONE ET AL SEQ ID NO: 8431)
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALYSSA G WESTON/Examiner, Art Unit 1633
/CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633