Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 35 and 49-51 are cancelled by the Applicant.
Claims 30-34 and 36-48 are pending and being examined.
All previous objections and rejections not set forth below have been withdrawn in view
of applicant’s amendments to the claims.
Claim Rejections - 35 USC § 112 and § 102
Response to Applicants’ arguments: Amendments made to the claims filed in Applicant’s response submitted on 06/24/2025 overcame the rejections of record under 35 USC § 112 and § 102.
Claim Rejections - 35 USC § 103
Claims 30-34 and 36-37 are rejected under 35 U.S.C. 103 as being unpatentable over Cardon et al. (Brassica rapa hairy root based expression system leads to the production of highly homogenous and reproducible profiles of recombinant human alpha-L-iduronidase, 2019, Plant Biotech. J., 17:505–516; first published on 30th July 2018) in view of Felberbaum R.S. (The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors, 2015, Biotechnol. J., 10:702–714) and Lamprecht et al. (Production of Human papilloma virus pseudovirions in plants and their use in pseudovirion-based neutralisation assays in mammalian cells, 2016, Sci. Rep. 6:20431). Due to Applicant’s amendments, the rejection is modified from the rejection set forth on pages 4-14 in the Office action dated 2/25/2025.
Claim 30 is drawn to a method for producing a recombinant adeno-associated virus (AAV) viral vector comprising AAV rep and cap genes from hairy roots of a plant belonging to Brassicaceae family.
Cardon et al. teaches a method to produce recombinant human alpha-L-iduronidase in a hairy root based expression system in Barassica rapa using the bacterial strain Rhizobium rhizogenes (page 512, left column, para 2). Cardon et al. also describes the benefits to produce mammalian proteins in hairy roots in a plant as compared to other expression systems which may encounter issues comprising inability to produce and/or secrete functional complex proteins (e.g. bacterial systems), existence of a risk of viral transmission and toxic molecules (e.g. bacterial systems, mammalian cells), societal (and/or legal) rejection (e.g. GMO plants in fields), or high production costs (e.g. mammalian cells) ((page 1, left column, para 4 (Introduction)).
However, Cardon et al. does not teach producing mammalian viral vector by expression AAV rep and cap proteins.
Lamprecht et al. teaches expression of a mammalian viral gene from human papilloma virus (HPV) encoding L1 and L2 capsid proteins in transgenic plants. It also teaches spontaneous virus like particle (VLP) assembly by plant-produced HPV proteins (page 2, para 4). It describes HPV VLPs produced by co-expression of L1 and L2 would package non-papillomaviral DNA in vitro, with similar efficiency to packaging of the papillomaviral genomic DNA (page 2, para 1).
Felberbaum teaches producing viral vectors using single baculovirus expression system (BEVS) expressing AAV rep and cap proteins (page 707, right column, para 1, line 10-13).
Before the effective filing date of the claimed invention, it would have been obvious to
one of ordinary skill in the art to modify the method to produce function mammalian viral vectors by expressing AAV cap (coat/capsid) proteins and replication (rep) proteins, as taught by Felberbaum, in a plant-based expression system as taught by Lamprecht et al. which would include hairy root culture of Brassica rapa as taught by Cardon et al. to simplify the production process, to reduce production cost, and/or to increase the scale of production to meet growing demand for therapeutic use comprising gene therapy where recombinant AAV vectors and VLPs can be used.
Before the effective filing date, an ordinary skilled artisan would have been motivated to produce mammalian viral vectors by expressing AAV rep and cap proteins, in Brassica hairy root expression system to avail the benefits of producing mammalian proteins in hairy roots comprising reducing the risk of viral transmission, reducing contamination with toxic molecules, and/or reducing production costs.
Regarding claims 31-32, Cardon et al. describes Brassica rapa hairy root-based expression platform (abstract).
Regarding claims 33-34, Cardon et al. describes transforming the plant using R. rhizogenes. A person skilled in the art would acknowledge that R. rhizogenes contains rol genes which are implicated in hairy root development in plants1.
Regarding claims 36-37, Cardon et al. describes using the 35S Cauliflower Mosaic Virus (35S CaMV) promoter (page 17, left column, para 3, line 11-12) to express the viral genes in Brassica rapa hairy root cells. Cauliflower Mosaic Virus (CaMV) is a plant virus that specifically infects brassica plants, including crops like cauliflower.
Claims 38-41, 43, 45-46 are rejected under 35 U.S.C. 103 as being unpatentable over Cardon et al. (Brassica rapa hairy root based expression system leads to the production of highly homogenous and reproducible profiles of recombinant human alpha-L-iduronidase, 2019, Plant Biotech. J., 17:505–516; first published on 30th July 2018) in view of Felberbaum R.S. (The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors, 2015, Biotechnol. J., 10:702–714) and Lamprecht et al. (Production of Human papilloma virus pseudovirions in plants and their use in pseudovirion-based neutralisation assays in mammalian cells, 2016, Sci. Rep. 6:20431) as applied to claims 30-34 and 36-37 above, and further in view of Earley et al. (Adeno-associated Virus (AAV) Assembly-Activating Protein Is Not an Essential Requirement for Capsid Assembly of AAV Serotypes 4, 5, and 11, 2017, J. Virol., 91: e01980-16).
Cardon et al. in view of Felberbaum R.S. and Lamprecht et al. describe a method for producing a recombinant adeno-associated virus (AAV) viral vector comprising AAV rep and cap genes from hairy roots of a plant belonging to Brassicaceae family, as discussed above. Felberbaum R.S. describes producing VLPs (recombinant AAV, rAAV) expressing the three different expression cassettes comprising: major AAV replication enzymes Rep52 and Rep 78; cap (viral coat/capsid) proteins; and a gene of interest (page 2, left column last para and right column first para).
However, Cardon et al. in view of Felberbaum R.S. and Lamprecht et al. do not describe one or more expression cassettes comprising VP1, VP2, VP3, and AAP (Assembly Activating Protein).
Earley et al. teaches that AAV genome contains two genes, rep and cap (page 2, para 2). The cap gene produces the three structural (coat or capsid) proteins- VP1, VP2, and VP3 (page 2, para 2). A third protein, named Assembly Activating Protein (AAP), is produced due to frame-shift mutation in cap gene open reading frame (page 2, para 2). Earley et al. discusses biological functions of different AAPs, and its distinct role in capsid assembly processes for AAV serotypes 1 to 12 (page 6, para 1 line 8-9). Earley et al. also describes that presence of specific AAP is needed for capsid assembly( which is a crucial step for producing viral vectors or VLPs) for specific AAV serotype, in human HEK293 cells (page 3, Fig. 1). It is prudent to mention here that the Applicant uses AAP from AAV serotype 8 (spec, page 33, line 7).
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to express all the three coat proteins (VP1, VP2, and VP3) and the major replication proteins (Rep78 and Rep 52), as describes by Felberbaum R.S., along with a suitable AAP protein, as described by Earley et al., in a brassica hairy root expression system, as described by Cardon et al. Expressing VPI, VP2, VP3, Rep78, and Rep52 proteins are sufficient to produce functional AAV viral vectors, as described by Felberbaum R.S. Co-expressing an AAP protein would depend on experimental design choice based on capsid proteins from a specific AAV serotype. Capsid proteins (VP1, VP2, and VP3) of AAV serotype 8 need an AAP protein for proper virion assembly and packaging; and (besides AAP8) the function can be accomplished by AAP2 as well (Earley et al., page 2, para 3, line 16-19) to produce a recombinant viral vector.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to express all the three coat proteins (VP1, VP2, and VP3), the major replication proteins (Rep78 and Rep 52), and a suitable AAP protein, in a brassica hairy root expression system to produce a recombinant mammalian AAV viral vector. The plant hairy root expressed viral vectors would reduce the risk of viral transmission in the mammalian host, reduce the risk of contamination with toxic molecules, and/or significantly reduce production cost.
Regarding claim 39, Cardon et al. describes using the 35S Cauliflower Mosaic Virus (35S CaMV) promoter (page 17, left column, para 3, line 11-12) to express the viral genes in Brassica rapa hairy root cells. Cauliflower Mosaic Virus (CaMV) is constitutive promoter widely used in the art.
Regarding claims 40-41, Earley et al. describes the appropriate capsid stoichiometry at
a VP1/VP2/VP3 ratio need to be approximately 1:1:10 (page 2, para 2, line 7-8) for successful capsid assembly. It implies that successful production of VLP depends on about 10 times more production of VP3 as compared to either VP1 or VP2. Earley et al. also describes using a stronger promoter (enhanced-promoter, CMV-IE) to increase AAP production (page 3, para 2, line 3-7) to achieve successful viral vector assembly. It is known in the art that NOS is a weaker promoter compared to 35S CaMV2. It would have been obvious to an ordinarily skilled artisan to use a weaker promoter like NOS for VP1 and VP2 while using a stronger promoter like 35S CaMV for VP3 and AAP coding sequences to maintain capsid stoichiometry while achieving successful viral vector assembly.
Cardon et al. teaches a CaMV 35S promoter (page 512, left column, para 3). The CaMV 35S promoter, as part of pRD400 vector used by Cardon et al., is having 91% homology with SEQ ID NO: 13, as shown below.
RESULT 1
US-17-785-422-13
Best Local Similarity 91.0%; Query Match 4.5%; Score 614.6; Length 1329;
Matches 680; Conservative 0; Mismatches 29; Indels 38; Gaps 1;
Qy 6791 CTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCA 6850
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||
Db 564 CTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCA 623
Qy 6851 ACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCAT 6910
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Db 624 ACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCAT 683
Qy 6911 CGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAA 6970
| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Db 684 CAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAA 743
Qy 6971 GGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAG 7030
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 744 GGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAG 803
Qy 7031 GAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGA 7090
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 804 GAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGA 863
Qy 7091 CATCTCCACTGACGTAAGGGATGACGCACAATCCCACCCCTACTCCAAAAATGTCAAAGA 7150
|||||||||||||||||||||||||||||||||||| || ||
Db 864 TATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAA----------- 912
Qy 7151 TACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAAA 7210
|||||||||||||||||||||||| ||||||||
Db 913 ---------------------------TGAGACTTTTCAACAAAGGGTAATATCGGGAAA 945
Qy 7211 CCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGA 7270
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Db 946 CCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGA 1005
Qy 7271 AGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTC 7330
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||
Db 1006 AGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTC 1065
Qy 7331 TGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGA 7390
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1066 TGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGA 1125
Qy 7391 CGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGA 7450
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Db 1126 CGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGA 1185
Qy 7451 TGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCA 7510
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1186 TGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCA 1245
Qy 7511 TTTGGAGAGGACAGCCCAAGCTTAAAA 7537
|||||||||||| | | || | |
Db 1246 TTTGGAGAGGACTCCGGTATTTTTACA 1272
Regarding claims 43 and 45, Cardon et al. teaches using a CaMV 35S promoter along with Tobacco Mosaic Virus (TMV) omega translational enhancer (page 512, left column, para 3). Im et al. (Partial Purification of Adeno-Associated Virus Rep78, Rep52, and Rep4O and Their Biochemical Characterization, 1992, J. Virol., 66:1119-1128) teaches that Rep52 protein is in greater abundance compared to Rep78 protein (page 1, abstract). It is obvious to an ordinarily skilled artisan to use Tobacco Mosaic Virus Omega (TMVQ) enhancer for more abundant VP3 protein when all the three capsid proteins viz. VP1, VP2, and VP3 are expressed using any specific promoter to get successful capsid assembly, as discussed above. The same obviousness is valid for using Tobacco Mosaic Virus Omega (TMVQ) enhancer for Rep52 (due to higher abundance), but not Rep78, while a specific promoter control the expression of both the Rep proteins.
Regarding claim 46, Lamprecht et al. teaches expression of codon-optimized human L1 and L2 genes in tobacco plants (page 2, para 8). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to express codon optimized the AAV proteins for VLP production in the hairy root culture of Brassica rapa as described above. Optimization of codons for expressing mammalian proteins, including the AAV proteins, is a standard practice in the art to enhance efficiency of production of heterologous proteins in plant expression systems including hairy root expression system.
Claims 42 and 44 are rejected under 35 U.S.C. 103 as being unpatentable over Cardon et al. (Brassica rapa hairy root based expression system leads to the production of highly homogenous and reproducible profiles of recombinant human alpha-L-iduronidase, 2019, Plant Biotech. J., 17:505–516), Felberbaum R.S. (The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors, 2015, Biotechnol. J., 10:702–714), Lamprecht et al. (Production of Human papilloma virus pseudovirions in plants and their use in pseudovirion-based neutralisation assays in mammalian cells, 2016, Sci. Rep. 6:20431) and Earley et al. (Adeno-associated Virus (AAV) Assembly-Activating Protein Is Not an Essential Requirement for Capsid Assembly of AAV Serotypes 4, 5, and 11, 2017, J. Virol., 91: e01980-16) as applied to claims 38-41, 43, 45-46 above, and further in view of Bilas et al. (Cis-regulatory elements used to control gene expression in plants, 2016, Plant Cell Tiss Organ Cult., 127:269–287).
Claims 42 and 44 depend on claim 38. Claim 42 is drawn to an A1cA promoter controlling expression of VP1, VP2, VP3, and AAP while claim 44 is drawn to expressing Rep52 and Rep78 under the control of A1cA promoter.
Cardon et al., Felberbaum R.S., Lamprecht et al., and Earley et al. describe expressing the AAV coat proteins (VP1, VP2, and VP3), the major replication proteins (Rep78 and Rep 52), and an AAP protein, in a brassica hairy root expression system to produce a recombinant mammalian AAV viral vector, as discussed above.
However, Cardon et al., Felberbaum R.S., Lamprecht et al., and Earley et al. do not describe any A1cA promoter.
Bilas et al. describes the alcohol inducible promoter A1cA (page 274, right column, para 4; and page 282, table 1). It also describes that using ethanol-inducible AlcA ensures high sensitivity and efficiency as expression of the transgene starts immediately after inducer application and is dose-dependent (page 274, right column, para 4).
Before the effective filing date of the claimed invention, it would have been obvious to
one of ordinary skill in the art to express VP1, VP2, VP3, AAP, Rep52, and Rep78 proteins under the control of ethanol inducible A1cA promoter, as described by Bilas et al., with a realistic goal to ensure high sensitivity and does dependent efficient expression of these proteins. Using different doses starting with a lower concentration of the inducer (ethanol), the ordinarily skilled artisan would have been able to monitor assembly of viral vectors at different level of expression of the proteins in the host cell in the hairy roots.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to express VP1, VP2, VP3, AAP, Rep52, and Rep78 proteins under the control of ethanol inducible A1cA promoter to ensure high sensitivity and does dependent efficient expression of these proteins for producing AAV viral vectors. Using different doses starting with a lower concentration of the inducer (ethanol), the ordinarily skilled artisan would have been able to monitor assembly of viral vectors at different level of expression of the proteins in the host cell in the hairy roots.
Claims 47-48 are rejected under 35 U.S.C. 103 as being unpatentable over Cardon et al. (Brassica rapa hairy root based expression system leads to the production of highly homogenous and reproducible profiles of recombinant human alpha-L-iduronidase, 2019, Plant Biotech. J., 17:505–516; first published on 30th July 2018) in view of Felberbaum R.S. (The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors, 2015, Biotechnol. J., 10:702–714) and Lamprecht et al. (Production of Human papilloma virus pseudovirions in plants and their use in pseudovirion-based neutralisation assays in mammalian cells, 2016, Sci. Rep. 6:20431) as applied to claims 30-34 and 36-37, and further in view of Saydam et al. (Construction and Packaging of Herpes Simplex Virus/Adeno-Associated Virus (HSV/AAV) Hybrid Amplicon Vectors, 2012, Cold Spring Harbor Protoc., doi:10.1101/pdb.prot068114).
Claims 47-48 are drawn to a method for producing a recombinant AAV viral vector comprising genes encoding proteins needed for production of the said vector in a hairy root culture of a plant belonging to the Brassicaceae family wherein the plant is also transformed with another vector providing the adenoviral helper functions and a gene encoding a product of interest flanked by two AAV-ITR sequences.
Cardon et al. in view of Felberbaum R.S. and Lamprecht et al. describe a method for producing a recombinant adeno-associated virus (AAV) viral vector comprising AAV rep and cap genes from hairy roots of a plant belonging to Brassicaceae family, as discussed above.
However, Cardon et al. in view of Felberbaum R.S. and Lamprecht et al. do not describe adenoviral helper functions or a vector comprising a gene encoding a product of interest flanked by two AAV- ITR sequences.
Saydam et al. teaches that the wild-type AAV genome is a linear, single-stranded DNA of 4680 nucleotides containing 145-nucleotide long inverted terminal repeats (ITRs) at both ends that flank two clusters of genes, rep and cap (page 355, last para, line 1-2). The ITRs contain the origin of DNA replication and the packaging signal (page 355, last para, last line). It also describes the unique ability of adeno-associated virus (AAV) to integrate its genome into a specific site on human chromosome 19 (page 356, para 1). The AAV rep protein (Rep 78 or Rep68) and ITRs flanking the AAV genome or a transgene are sufficient for this process (abstract; page 356, pare 1, line 2-3). In the presence of AAV Rep78 (or Rep68) protein, a transgene cassette flanked by AAV-ITR sequences (page 356, para 2) would integrate the transgene in a specific site in human chromosome 19 and provide stable transgene expression in human cells (page 356, para 2, line 3-5).
Before the effective filing date of the claimed invention, it would have been obvious to
one of ordinary skill in the art to clone a mammalian/human viral transgene encoding a product of interest (protein or RNA) flanked by AAV ITR sequences in a plant expression cassette, as described by Saydam et al. The transgene of interest would have been successfully packaged in the viral vector after capsid protein assembly in the plant. Once the plant produced viral vector or VLP gets inside the mammalian host cell, the transgene would stably integrate into the mammalian/human genome (in presence of AAV Rep78 protein) resulting in a stable long-term expression of the product of interest.
Before the effective filing date, one of ordinary skill in the art would have been motivated to do so to have a long-term stable production of viral proteins in the hairy root based expression system to produce viral vectors which can be used to produce therapeutic proteins in the mammalian host and/or vaccines against specific mammalian viral diseases.
Response to Applicant’s Arguments
The argument set forth in the Applicant’s reply on 6/17/2025 to the rejection of claims
under 35 U.S.C. 103 has been fully considered but is not found persuasive. The applicant argued that references (Cardon et al., Felberbaum R.S., Earley et al., and Lamprecht et al.) cited by the Examiner do not explicitly describe production of AAV cap and rep proteins in a plant belonging to Brassicaceae family (page 9, para 7-10). The Applicant also indicates that the method of producing heterologous proteins in N. benthamiana (Solanaceae) is unrelated to Brassicaceae species (e.g., Brassica rapa) and, thus, may not work (page 10, para 1).
The Examiner disagrees. For example, Cardon et al. provides the evidence that brassica hairy root is a well-known expression system for successfully producing functionally active heterologous mammalian/human proteins. Felberbaum R.S. shows that expressing AAV Rep and Cap proteins can successfully assemble the capsid proteins to produce recombinant AAV vectors, albeit in insect cells. Similarly, Earley et al. shows that co-expressing specific AAP proteins from specific AAV serotype would enable successful capsid protein assembly producing recombinant AAV vectors, albeit in human HEK 293 cells. On the other hand, Lamprecht et al. shows successful production of pseudovirions or VLPs for Human papillomavirus in plant expression system.
The Applicant does not provide evidence to support the opinion that the method of any of the sited references would not work in the context of the present invention. The Examiner acknowledges that there are differences including post-translational modifications of mammalian proteins compared to those in plants. However, as mentioned in the Office action, there are numerous examples of successful production of biologically active mammalian proteins in various plant expression systems in many plants including Brassica spp. and Nicotiana spp. There is no apparent reason to think that a biologically active mammalian protein successfully expressed in Nicotiana sp. cannot be produced in Brassica or, more specifically, in Brassica hairy root.
Earley et al. acknowledges the unpredictability of AAV capsid assembly. However, the Examiner cited a few references showing that AAV capsid proteins are successfully assembled in various expression systems. The Applicant does not provide any specific evidence showing the same AAV capsid proteins would not do be able to produce rAAV or VLP when expressed in plant based expression systems.
Applicant’s opinion cannot take the place of evidence (MPEP 716.01(c)(II), 2145(I)).
Conclusion
All claims are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Shubo (Joe) Zhou can be reached at 571-272-0724. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/ Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/ Primary Examiner, Art Unit 1663
1 Trovato et al. (From A. rhizogenes RolD to Plant P5CS: Exploiting Proline to Control Plant Development, 2018, Plants, 7:108) provides the evidence that Rol genes are present in Rhizobium rhizogenes conferring the hairy root trait (page 1, para 1, line 1-3).
2Sanders et al. (Comparison of cauliflower mosaic virus 35S and nopaline synthase promoters in transgenic
Plants, 1987, Nucleic Acids Research, 15:1543-1558) provides the evidence that NOS is weak promoter compared to 35S CaMV promoter.
Prosecution Insights