Prosecution Insights
Last updated: April 19, 2026
Application No. 17/785,565

ANTISENSE NUCLEIC ACID ENABLING EXON SKIPPING

Non-Final OA §101§102§103§DP
Filed
Jun 15, 2022
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
National Center Of Neurology And Psychiatry
OA Round
1 (Non-Final)
52%
Grant Probability
Moderate
1-2
OA Rounds
2y 12m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
25 granted / 48 resolved
-7.9% vs TC avg
Strong +73% interview lift
Without
With
+73.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 12m
Avg Prosecution
47 currently pending
Career history
95
Total Applications
across all art units

Statute-Specific Performance

§101
8.0%
-32.0% vs TC avg
§103
27.9%
-12.1% vs TC avg
§102
14.9%
-25.1% vs TC avg
§112
30.0%
-10.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 48 resolved cases

Office Action

§101 §102 §103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s response and amendments to the claims filed November 7, 2025 are acknowledged. Claims 27 was amended, and claim 47 was introduced. Claims 1-28, 30-31, 34-36, 39, and 41-47 are pending. Restriction/Election New claim 47 is directed to Group III described in the restriction requirement mailed September 16, 2025. Applicant’s election of Group III (claims 27-28, 30-31, and 47) with traverse in the reply filed November 7, 2022 is acknowledged. The traversal is on the grounds that “[t]he Office has not rejected any claim in the present application under 35 U.S.C. §§ 102 and/or 103 over Aartsma-Rus.” Applicant alleges that the Office “cannot fulfill its obligations under the PCT without considering the cited art in a corresponding rejection under 35 U.S.C. §§ 102 and/or 103 in the first Office Action on the merits.” Applicant also reminds the Office of rejoinder practice when all claims drawn to an elected invention are allowable. These arguments are not found persuasive. The Examiner is not required to reject any claim in the present application under 35 U.S.C. §§ 102 and/or 103 in order to make a proper lack of unity requirement under § 1.475 in a national stage application. The requirement mailed September 16, 2025 “(1) list[ed] the different groups of claims and (2) explain[ed] why each group lacks unity with each other group (i.e., why there is no single general inventive concept)” as described in MPEP 1893.03(d). There is no apparent deficiency in the lack of unity requirement in the prior action. Examiner also acknowledges that when all of the claims drawn to the elected invention are allowable, any non-elected invention(s) requiring all of the limitations of an allowable claim will be rejoined. However, for the reasons described in the following paragraphs, no claims are allowable. The requirement is still deemed proper and is therefore made FINAL. Accordingly, claims 1-26, 34-36, 39, and 41-46 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Claims 27-28, 30-31, and 47 are under examination hereinafter. Priority Applicant’s priority claims to Application Nos. JP2019-229763 and PCT/JP2020/047340 are acknowledged. Claims 27-28, 30-31, and 47 find support in Application No. JP2019-229763. The effective filing date of the claims under examination is December 19, 2019. Specification The specification is objected to because of the following informalities: The use of terms which are trade names or marks used in commerce has been noted in this application, e.g., “Oligofectamine,” “Lipofectin,” Lipofectamine,” “Lipofectamine 2000,” and “GeneSilencer” (at least pg. 201). Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Appropriate correction is required. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 27-28, 30-31, and 47 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, natural phenomenon, or an abstract idea) without significantly more. The claims recite “A pharmaceutical composition comprising an antisense oligomer or a pharmaceutically acceptable salt thereof, or hydrate thereof which causes simultaneous skipping of any two or more numerically consecutive exons selected from the group consisting of the 45th exon to the 55th exon in human dystrophin pre-mRNA….” This judicial exception is not integrated into a practical application and does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception for the reasons that follow. Step 1 – Is the Claim to a Process, Machine, Manufacture, or Composition of Matter? YES The claims are directed to a pharmaceutical composition, which is a composition of matter. The claims are directed to a statutory category. Step 2A, Prong One – Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES Laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. MPEP 2106.04(c) outlines the markedly different characteristics analysis. Claim 27 is directed to a “pharmaceutical composition,” wherein the term “pharmaceutical” is interpreted as an intended use for the composition which does not structurally limit the claim because the body of the claim recites a structurally complete invention. The composition comprises “an antisense oligomer or a pharmaceutically acceptable salt thereof, or hydrate thereof which causes simultaneous skipping of any two or more numerically consecutive exons selected from the group consisting of the 45th exon to the 55th exon in human dystrophin pre-mRNA,” wherein the antisense oligomer comprises “a base sequence of at least one region selected from the group consisting of regions R1 to R24” as recited in claim 27. The skilled artisan would understand that the function of an antisense oligomer is a property resulting from its structure (i.e., sequence). The function recited in claim 27 (i.e., “causes simultaneous skipping of any two or more numerically consecutive exons…”), therefore, is interpreted as a property resulting from the recited structural limitations. Claim 28 further comprise a “suppressor antisense oligomer or a pharmaceutically acceptable salt thereof, or hydrate thereof,” which “suppresses single skipping of any one exon selected from the group consisting of the 45th exon to the 55th exon in human dystrophin pre-mRNA.” The term “suppressor” is understood to refer to an intended use for the second antisense oligomer. The suppressor antisense oligomer comprises a base sequence complementary to one of (a)-(c) as recited in claim 28. As stated above, the skilled artisan would understand that the function of an antisense oligomer, including an antisense oligomer intended to be used as a “suppressor,” is a property resulting from its structure (i.e., sequence). The function recited in claim 28 (i.e., “suppresses single skipping of any one exon…”), therefore, is interpreted as a property resulting from the recited structural limitations. Claim 30 further limits the antisense oligomer to “consisting of SEQ ID NO: 75,” and the suppressor antisense oligomer to “consisting of SEQ ID NO: 260,” “261,” or “263.” Claim 31 further comprises “a pharmaceutically acceptable carrier,” which is interpreted as a substance capable of carrying a composition to cells, tissues, etc. (“a carrier to promote delivery of the oligomer to muscle tissues. Such a carrier is not particularly limited as far as it is pharmaceutically acceptable,” [0176]). The skilled artisan would interpret carriers as encompassing various lipid compositions, sugar solutions, aqueous solutions, etc., known in the art. For example, saline solution. Claim 47 further limits the antisense oligomer to “consisting of SEQ ID NO: 75” or “73,” and the suppressor antisense oligomer to “consisting of SEQ ID NO: 262” or “260.” MPEP 2106.04 II(A) states that although the selected counterpart should be in its natural state, Examiners should take care not to confuse the counterpart with other material that may occur naturally with, or adjacent to, the counterpart. For example, assume that Applicant claims a single-stranded piece of DNA (a primer) having a nucleotide sequence derived from the sense strand of naturally occurring nucleic acid C. Although nucleic acid C occurs in nature as a double-stranded molecule having a sense and an antisense strand, the closest natural counterpart for the claimed nucleic acid is the sense strand of C only. In the instant case, although human genomic DNA is in the form of chromosomes in the nucleoplasm of a human cell in its natural state, the closest natural counterpart for the claimed compositions are specific portions of the human genomic DNA comprised in the nucleoplasm of a human cell. The nucleoplasm is a mixture of two or more elements, which meets the scope of a “composition.” The nucleoplasm comprises portions of human genomic DNA consisting of SEQ ID NOs: 73, 75, and 260-263. See attached alignments between SEQ ID NOs: 73, 75, and 260-263 and GenBank (“DMD – dystrophin, Homo sapiens,” https://www.ncbi.nlm.nih.gov/datasets/gene/1756/, accessed 28 January 2026) in Appendix I. As described above, the functions of the antisense oligomer and suppressor antisense oligomer are understood to result from their structure. The portions of the genomic DNA consisting of the SEQ ID NOs, would, therefore, have the functions recited for the antisense oligomer and suppressor antisense oligomer. The nucleoplasm also comprises aqueous solution which would be considered “a pharmaceutically acceptable carrier,” i.e., it is sufficient to “carry” genomic DNA in its natural state, and it is present in tissue in its natural state (“pharmaceutically acceptable”). In view of the foregoing, the pharmaceutical compositions of claims 27-28, 30-31, and 47 are not markedly different from the naturally occurring counterpart, and recite product of nature judicial exceptions. Step 2A, Prong Two – Does the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application? NO The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. As described above, the limitations of claims 27-28, 30-31, and 47 are present in the naturally occurring counterpart. The claims do not recite any additional elements that would integrate the natural products into a practical application. Step 2B – Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). The limitations of claims 27-28, 30-31, and 47 are present in the naturally occurring counterpart. The claims do not recite any additional elements which would amount to significantly more than the judicial exceptions. Claim Rejections - 35 USC § 102 – De Kimpe The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 27 and 31 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Regarding claims 27 and 31, De Kimpe teaches an antisense oligomer (SEQ ID NO: 109, drawings, pg. 20/28) which comprises a base sequence complementary to a base sequence of a region R2, which is set forth in instant SEQ ID NO: 234 based on the specification (Table 10, pg. 244). See attached alignment in Appendix II. The antisense oligomer of De Kimpe is also 100% identical to instant SEQ ID NO: 75, which corresponds to “PMO No. 75” in the specification (Table 11, pg. 249). See Fig. A below. FIGURE A TGTCAAACGGCGACGGGTTACGGTA nts 635-611 of R2, instant SEQ ID NO: 234 ACAGUUUGCCGCUGCCCAAUGCCAU De Kimpe, SEQ ID NO: 109 ACAGTTTGCCGCTGCCCAATGCCAT PMO No. 75, instant SEQ ID NO: 75 As described in paragraph 9 above, the function recited in claim 27 (i.e., “causes simultaneous skipping of any two or more numerically consecutive exons…”) is interpreted as a property resulting from the recited structural limitations. De Kimpe’s antisense oligomer meets the structural limitations of the instant claims, and is, therefore, presumed to have the recited functions flowing therefrom. Indeed, the instant application shows that PMO No. 75, to which De Kimpe’s antisense oligomer is 100% identical, has the recited function (see results for “PMO No. 75” in at least Fig. 1; [0019]). De Kimpe teaches pharmaceutical compositions comprising the antisense oligomer, wherein the composition further comprises a pharmaceutically acceptable carrier (“a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient. Examples of suitable carriers and adjuvants are well known in the art and for instance comprise a saline solution,” pg. 13; “pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, for inhibiting inclusion of an exon of a dystrophin pre-mRNA into mRNA produced from splicing of said pre-mRNA…” pg. 28-29; “the invention also encompasses a pharmaceutically acceptable composition comprising a compound as defined herein… and further comprising at least one excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery,” pg. 48; claims “4.” and “7.” pgs. 82-83). Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – De Kimpe The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 28 is rejected under 35 U.S.C. 103 as being unpatentable over De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009) as applied to claims 27 and 31 above. The teachings of De Kimpe are described above and applied hereinafter as to claims 27 and 31 therein. Regarding the “suppressor antisense oligomer,” as described in paragraph 9 above, the term “suppressor” is understood to refer to an intended use for the second antisense oligomer. The skilled artisan would understand that the function of an antisense oligomer, including an antisense oligomer intended to be used as a “suppressor,” is a property resulting from its structure (i.e., sequence). The function recited in claim 28 (i.e., “suppresses single skipping of any one exon selected …”), therefore, is interpreted as a property resulting from the recited structural limitations, i.e., one of (a)-(c). De Kimpe teaches that the antisense oligomers are designed to restore the reading frame of dystrophin pre-mRNA and generate at least partially functional dystrophin protein in DMD patients (pg. 2). De Kimpe teaches that the symptoms of DMD would be expected to be sufficiently alleviated once the DMD patient has been provided with functional dystrophin (pg. 2-3). De Kimpe teaches that mutations underlying DMD are numerous, which “requires the generation of a large number of different pharmaceuticals as for different mutations different exons need to be skipped” (pg. 44). De Kimpe teaches combinations of an antisense oligomer with “at least one other oligonucleotide, or functional equivalent thereof, that is capable of inhibiting inclusion of another dystrophin exon into dystrophin mRNA” (pg. 42). De Kimpe teaches that this approach prevents “inclusion of two or more exons of dystrophin pre-mRNA,” and promotes “double- or multi-exon skipping” (pg. 42). De Kimpe teaches that multi-skipping is advantageous because “more than one exon can be skipped with a single pharmaceutical,” which is “practically very useful in that only a limited number of pharmaceuticals need to be generated for treating many different DMD or particular, severe BMD mutations” (pg. 44). De Kimpe teaches that a combination of an oligomer targeting exon 45 and an oligomer targeting exon 51 promotes multi-skipping of exons 45 to 51 in dystophin pre-mRNA (pg. 42). De Kimpe teaches that the antisense oligomer consisting of SEQ ID NO: 109 is designed to skip exon 45 of the dystrophin (DMD) gene (“DMD Gene Exon 45,” Fig. 9; “Various oligonucleotides directed against the indicated exons of the dystrophin (DMD)-gene,” pg. 56). De Kimpe also teaches an antisense oligomer, “PRO051” which induces exon 51 skipping (pg. 61-67). PRO051 comprises a base sequence complementary to “any one base sequence” (i.e., any two or more consecutive nucleotides) of instant SEQ ID NO: 379 as shown in Fig. B below (underlined). FIGURE B AGAAC instant SEQ ID NO: 379 UCUUUACGGUAGAAGGAACU De Kimpe, PRO051 (reverse) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared a composition comprising an antisense oligomer taught by De Kimpe which targets exon 45, with a second antisense oligomer taught by De Kimpe which targets exon 51. It would have amounted to a simple combination of two known antisense oligomers in a composition, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in combining the antisense oligomers because the structure of the oligomers was known, and as evidenced by De Kimpe, means to synthesize antisense oligomers and prepare compositions comprising combinations of the oligomers were known. The skilled artisan would know that the function of an antisense oligomer is a property of its structure. Because the structure of the oligomers is unchanged by the combination, the skilled artisan would have had a reasonable expectation that the antisense oligomers would retain exon 45 and 51 targeting functions when combined in a composition. The skilled artisan would have recognized that a multi-skipping composition designed to skip exons 45-51 would have the practical advantages discussed by De Kimpe, and therefore, would have been motivated to prepare the composition. Claim Rejections - 35 USC § 103 – De Kimpe in view of Zhang Claims 30 and 47 are rejected under 35 U.S.C. 103 as being unpatentable over De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009) as applied to claims 27-28 and 31 above, and in further view of Zhang (Zhang et al., WO 2019/200185 A1, published 17 October 2019). The teachings of De Kimpe are described above and applied hereinafter as to claims 27-28 and 31 therein. As described therein, De Kimpe teaches an antisense oligomer consisting of SEQ ID NO: 75. See Fig. A above. De Kimpe teaches combinations of antisense oligomers, which promote multi-skipping of dystrophin pre-mRNA. De Kimpe does not teach that the sequence of the second “suppressor” antisense oligomer consists of SEQ ID NO: 260, 261, 262, or 263, as encompassed by claims 30 and 47, respectively. Zhang is also concerned with antisense oligomer compositions designed to promote single and multi-skipping of dystrophin pre-mRNA (Abstract; Figs. 1-3; [0083]; [0085]; [00840]-[00873]). Zhang illustrates that antisense oligomers have various levels of efficacy in promoting single or multi-exon skipping. See, for example, paragraphs [00784], and [00858]-[00861] which describe results for exon 45 targeting antisense oligomers in single and multi-exon skipping. Zhang teaches combinations of antisense oligomers, including combinations in which two or more antisense oligomers target the same exon (“two or more oligonucleotides in a combination are all (primarily) for skipping of the same exon, and their combination provides enhanced skipping of such exon, in some embodiments, significantly more than the addition of their separate effects” ([00855]; “two or more oligonucleotides targeting a particular exon… provides skipping levels significantly higher than the addition of the skilling level of each oligonucleotide individually…,” [00868]). Zhang teaches that combinations of oligonucleotides which target the same exon can provide significantly increased levels of exon skipping ([00855]; [00868]). Zhang teaches antisense oligomers designed to target exon 45 ([00782]). Zhang teaches exon 45-targeting antisense oligomers comprising instant SEQ ID NOs: 260, 261, and 263 (“WV-9770,” “WV-9769,” and “WV-9767”). Zhang’s oligomers comprise one additional 5’ or 3’ nucleotide relative to the instant SEQ ID NOs. Zhang also teaches an antisense oligomer with substantial identity to instant SEQ ID NO: 262 (“WV-9768”). WV-9768 is missing the 3’ most nucleotide and comprises two additional 5’ nucleotides relative to instant SEQ ID NO: 262. See Fig. C below. FIGURE C TTTTCATTCCTATTAGATCTGTCG instant SEQ ID NO: 260 UUUUCAUUCCUAUUAGAUCUGUCGC Zhang, WV-9770 AAATGTTTTCATTCCTATTAGATC instant SEQ ID NO: 261 AAAUGUUUUCAUUCCUAUUAGAUCU Zhang, WV-9769 CTAAAATGTTTTCATTCCTATTAG instant SEQ ID NO: 262 UGCUAAAAUGUUUUCAUUCCUAUUA Zhang, WV-9768 AGTCTGCTAAAATGTTTTCATTCC instant SEQ ID NO: 263 AAGUCUGCUAAAAUGUUUUCAUUCC Zhang, WV-9767 The skilled artisan would recognize that each of Zhang’s antisense oligomers overlap to target the same region of exon 45 (bolded, Fig. D). Instant SEQ ID NOs: 260-263 also target the same region as Zhang’s antisense oligomers. See Fig. D below. Zhang teaches that the antisense oligomers may be 20-25 bases, e.g., 24 bases ([00600]; [00811]). FIGURE D AAGUCUGCUAAAAUGUUUUCAUUCC Zhang, WV-9767 UGCUAAAAUGUUUUCAUUCCUAUUA Zhang, WV-9769 AAAUGUUUUCAUUCCUAUUAGAUCU Zhang, WV-9768 UUUUCAUUCCUAUUAGAUCUGUCGC Zhang, WV-9770 AAGUCUGCUAAAAUGUUUUCAUUCCUAUUAGAUCUGUCGC TTTTCATTCCTATTAGATCTGTCG instant SEQ ID NO: 260 AAATGTTTTCATTCCTATTAGATC instant SEQ ID NO: 261 CTAAAATGTTTTCATTCCTATTAG instant SEQ ID NO: 262 AGTCTGCTAAAATGTTTTCATTCC instant SEQ ID NO: 263 Regarding the sequences required of claims 30 and 47, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have designed antisense oligomers 24-nts in length which consist of instant SEQ ID NOs: 260, 261, 262, and 263 based on the teachings of Zhang. It would have amounted to applying known design parameters to known antisense oligomers targeting a known target region of exon 45 of dystrophin pre-mRNA, by known means to yield predictable results. As shown in Fig. C above, in order to arrive at instant SEQ ID NOs: 260-261, and 263, the skilled artisan need only modify Zhang’s known antisense oligomers from 25-nts to 24-nts. 24-nts was a known, acceptable antisense oligomer length based on Zhang. In order to arrive at instant SEQ ID NO: 262, the skilled artisan need only shift the target region of one of Zhang’s known antisense oligomers by one nucleotide and apply a known, acceptable oligomer length thereto, i.e., 24-nts. The skilled artisan could have easily done so, because as shown in Fig. D, the target sequence was known and substantially overlapped with each of Zhang’s other antisense oligomers. The skilled artisan would have predicted that the resulting antisense oligomers would function in targeting exon 45 because they would remain substantially identical to the known, exon 45 targeting antisense oligomers of Zhang. The skilled artisan would have been motivated to design antisense oligomers substantially identical to Zhang’s in an effort to identify the most effective antisense oligomers for skipping of at least exon 45 in dystrophin pre-mRNA. Regarding the combination of the sequences rendered obvious above with instant SEQ ID NO: 75 taught by De Kimpe, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared a composition comprising an antisense oligomer consisting of instant SEQ ID NO: 75, with a second antisense oligomer rendered obvious above over Zhang. It would have amounted to combining two antisense oligomers designed to target exon 45 in a composition, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in combining the antisense oligomers because the structures of the oligomers were known or obvious over the prior art as described immediately above, and, as evidenced by De Kimpe, means to synthesize antisense oligomers and prepare compositions comprising combinations of oligomers were known. The skilled artisan would know that the function of an antisense oligomer is a property of its structure. Because the structure of the oligomers is unchanged by the combination, the skilled artisan would have had a reasonable expectation that the antisense oligomers would retain exon 45 targeting functions when combined in a composition. The skilled artisan would have been motivated to prepare a composition comprising two exon 45 targeting antisense oligomers based on Zhang, which teaches that combinations of oligonucleotides which target the same exon can provide significantly increased levels of exon skipping. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. As described above, the function recited for the antisense oligomer in claim 27 are interpreted as a property resulting from the recited structural limitations. The antisense oligomers claimed in the following patents and co-pending applications meet the structural limitations of the instant claims, and are, therefore, presumed to have the recited functions flowing therefrom hereinafter. The function recited for the suppressor antisense oligomer in claim 28 is also interpreted as a property resulting from the recited structural limitations hereinafter. U.S. Patent No. 9,079,934 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 9,079,934 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 7 recites “A pharmaceutical composition for the treatment of muscular dystrophy, comprising as an active, ingredient the antisense oligomer according to claim 1, or a pharmaceutically acceptable salt or hydrate thereof,” wherein the antisense oligomer “causes skipping of the 53rd exon in the human dystrophin gene, consist[s] of the nucleotide sequence of SEQ ID NO: 35, wherein the antisense oligomer is an oligonucleotide having the sugar moiety and/or the phosphate-binding region of at least one nucleotide constituting the oligonucleotide modified, or a morpholino oligomer.” The patented antisense oligomer comprises a base sequence complementary to region R18 as set forth in instant SEQ ID NO: 250 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 9,079,934 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51. It would have amounted to a simple combination of two known antisense oligomers in a composition, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in combining the antisense oligomers because the structure of the oligomers was known, and as evidenced by De Kimpe, means to synthesize antisense oligomers and prepare compositions comprising combinations of oligomers were known. The skilled artisan would know that the function of an antisense oligomer is a property of its structure. Because the structure of the oligomers is unchanged by the combination, the skilled artisan would have had a reasonable expectation that the antisense oligomers would retain their respective exon targeting functions when combined in a composition. The skilled artisan would have recognized that a multi-skipping composition would have the practical advantages discussed by De Kimpe, and therefore, would have been motivated to prepare the composition. U.S. Patent No. 9,708,361 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 9,708,361 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 7 recites “A pharmaceutical composition for the treatment of muscular dystrophy, comprising as an active, ingredient the antisense oligomer according to claim 1, or a pharmaceutically acceptable salt or hydrate thereof,” wherein the antisense oligomer “causes skipping of the 53rd exon in the human dystrophin gene, consisting of the nucleotide sequence of SEQ ID NO: 57, wherein the antisense oligomer is an oligonucleotide in which the sugar moiety and/or the phosphate-binding region of at least one nucleotide constituting the oligonucleotide is modified, or a morpholino oligomer.” The patented antisense oligomer comprises a base sequence complementary to region R18 as set forth in instant SEQ ID NO: 250 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 9,708,361 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 9,988,629 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 6-7 of U.S. Patent No. 9,988,629 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 6 recites “A pharmaceutical composition for the treatment of muscular dystrophy, comprising as an active ingredient the antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to claim 1,” wherein the antisense oligomer “compris[es] the nucleobase sequence of SEQ ID NO: 1 or 2….” The antisense oligomer corresponding to SEQ ID NO: 2 comprises a base sequence complementary to region R15 as set forth in instant SEQ ID NO: 247 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 6-7 of U.S. Patent No. 9,988,629 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 45. It would have amounted to a simple combination of two known antisense oligomers in a composition, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in combining the antisense oligomers because the structure of the oligomers was known, and as evidenced by De Kimpe, means to synthesize antisense oligomers and prepare compositions comprising combinations of the oligomers were known. The skilled artisan would know that the function of an antisense oligomer is a property of its structure. Because the structure of the oligomers is unchanged by the combination, the skilled artisan would have had a reasonable expectation that the antisense oligomers would retain their respective exon targeting functions when combined in a composition. The skilled artisan would have recognized that a multi-skipping composition would have the practical advantages discussed by De Kimpe, and therefore, would have been motivated to prepare the composition. U.S. Patent No. 10,144,931 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 9-10 of U.S. Patent No. 10,144,931 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 9 recites “ A pharmaceutical composition for treatment of muscular dystrophy, which comprises an antisense oligomer consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 25, 30, 33, 79, and 80, or pharmaceutically acceptable salt or hydrate thereof as an active ingredient.” The antisense oligomer corresponding to SEQ ID NO: 25 comprises a base sequence complementary to region R2 as set forth in instant SEQ ID NO: 234 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 9-10 of U.S. Patent No. 10,144,931 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,329,319 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 6-7 of U.S. Patent No. 10,329,319 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 6 recites “A pharmaceutical composition for the treatment of muscular dystrophy, comprising as an active ingredient the antisense oligomer according to claim 1, or a pharmaceutically acceptable salt or hydrate thereof,” wherein the antisense oligomer “consist[s] of any one nucleotide sequence selected from the group consisting of SEQ ID NOS: 8, 15, 32, 34, and 36….” The antisense oligomer corresponding to SEQ ID NO: 8 comprises a base sequence complementary to region R18 as set forth in instant SEQ ID NO: 250 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 6-7 of U.S. Patent No. 10,329,319 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,407,461 B2 Claims 27-28, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 10,407,461 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claims 1-2 recite a “PMO[] antisense oligomer… consisting of a 25-mer oligomer that is 100% complementary to the target sequence 5′-GAACACCUUCAGAACCGGAGGCAAC-3′ (SEQ ID NO: 124).” The recited target sequence comprises 100% identity to region R18 as set forth in instant SEQ ID NO: 250 (Table 10), and thus the antisense oligomer 100% complementary thereto meets the instant claim limitations. See attached alignment in Appendix III. The patented claims do not recite a “pharmaceutical composition” comprising the antisense oligomer, further comprising a pharmaceutically acceptable carrier. The teachings of De Kimpe are described above and applied hereinafter. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the patented antisense oligomer in a composition as taught by De Kimpe. It would have amounted to combining a known antisense oligomer with a known carrier by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success given that compositions and carriers for antisense oligomers were well known in the art as evidenced by De Kimpe. The skilled artisan would have been motivated to prepare a composition so that the patented oligomer could be delivered to cells and/or subjects. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,487,106 B2 Claims 27-28, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 10,487,106 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claims 1-2 recite a “PMO[] consisting of a 25-mer antisense oligomer that is 100% complementary, according to Watson-Crick base pairing to the 36th to the 60th nucleotides from the 5’ end of the 53rd exon in a human dystrophin pre-mRNA, wherein the 53rd exon in said human dystrophin pre-mRNA consists of… SEQ ID NO: 1…” The region to which the patented antisense oligomer must be 100% complementary overlaps with region R18 as described in claim 27 (“region R18… which consists of a base sequence of 400 bases in the upstream direction of from the 3’ end of the 52nd intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 53rd exon in the human dystrophin pre-mRNA”). The patented antisense oligomer, therefore, reads on instant claim 27. The patented claims do not recite a “pharmaceutical composition” comprising the antisense oligomer, further comprising a pharmaceutically acceptable carrier. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of combining the patented antisense oligomer in a composition as taught by De Kimpe is described above in paragraph 43 and applied here. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,647,741 B2 Claims 27-28, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-10 of U.S. Patent No. 10,647,741 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claims 1-6 recite methods of using a “PMO[] consisting of a 25-mer antisense oligomer that is 100% complementary to the 36th to the 60th nucleotides from the 5’ end of the 53rd exon in a human dystrophin pre-mRNA, wherein the 53rd exon in said human dystrophin pre-mRNA consists of… SEQ ID NO: 1…” The region to which the patented antisense oligomer must be 100% complementary overlaps with region R18 as described in claim 27 (“region R18… which consists of a base sequence of 400 bases in the upstream direction of from the 3’ end of the 52nd intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 53rd exon in the human dystrophin pre-mRNA”). The patented antisense oligomer, therefore, reads on instant claim 27. Patented claims 7-10 recite methods of using a “PMO[] consisting of a 25-mer oligomer that is 100% complementary to the target sequence 5′-GAACACCUUCAGAACCGGAGGCAAC-3′ (SEQ ID NO: 124).” The recited target sequence comprises 100% identity to region R18 as set forth in instant SEQ ID NO: 250 (Table 10), and thus the antisense oligomer 100% complementary thereto meets the instant claim limitations. See attached alignment in Appendix III. The patented claims do not recite a “pharmaceutical composition” comprising the antisense oligomer, further comprising a pharmaceutically acceptable carrier. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of combining the patented antisense oligomer in a composition as taught by De Kimpe is described above in paragraph 43 and applied here. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,662,217 B2 Claims 27-28, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4 of U.S. Patent No. 10,662,217 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claims 1 and 3 recite methods of using a “PMO[]… that is 100% complementary to the 36th to the 60th nucleotides from the 5’ end of the 53rd exon in a human dystrophin pre-mRNA, wherein the 53rd exon in said human dystrophin pre-mRNA consists of… SEQ ID NO: 1….” The region to which the patented antisense oligomer must be 100% complementary overlaps with region R18 as described in claim 27 (“region R18… which consists of a base sequence of 400 bases in the upstream direction of from the 3’ end of the 52nd intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 53rd exon in the human dystrophin pre-mRNA”). The patented antisense oligomer, therefore, reads on instant claim 27. Patented claims 2 and 4 recite methods of using a “PMO[]… that is 100% complementary to… 5′-GAACACCUUCAGAACCGGAGGCAAC-3′ (SEQ ID NO: 124).” The recited target sequence comprises 100% identity to region R18 as set forth in instant SEQ ID NO: 250 (Table 10), and thus the antisense oligomer 100% complementary thereto meets the instant claim limitations. See attached alignment in Appendix III. The patented claims do not recite a “pharmaceutical composition” comprising the antisense oligomer, further comprising a pharmaceutically acceptable carrier. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of combining the patented antisense oligomer in a composition as taught by De Kimpe is described above in paragraph 43 and applied here. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,851,373 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 13-14 of U.S. Patent No. 10,851,373 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 13 recites “A pharmaceutical composition for treatment of muscular dystrophy, which comprises the antisense oligomer or pharmaceutically acceptable salt or hydrate thereof according to claim 1 as an active ingredient,” wherein the antisense oligomer “comprises two unit oligomers, each of which is selected from a nucleotide sequence complementary to a nucleotide sequence consisting of 7 to 16 contiguous bases selected from any one of SEQ ID NOs: 3-6 and 143….” SEQ ID NO: 3 consists of bases at positions -5 to 15 counted from the 5’-terminal end of exon 45 of the dystrophin gene based on the patented specification. Thus, a region to which the patented antisense oligomer may be complementary overlaps with region R2 as described in claim 27 (“region R2… which consists of a base sequence of 600 bases in the upstream direction of from the 3’ end of the 44th intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 45th exon in the human dystrophin pre-mRNA”). The patented antisense oligomer, therefore, reads on instant claim 27. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 13-14 of U.S. Patent No. 10,851,373 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 10,870,676 B2 Claims 27-28, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of U.S. Patent No. 10,870,676 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims recite methods of using an “antisense oligomer consist[ing] of a nucleotide sequence complementary to a sequence consisting of the 36th to the 56th nucleotides from the 5’ end of the 53rd exon in a human dystrophin pre-mRNA, wherein the 53rd exon in said human dystrophin pre-mRNA consists of… SEQ ID NO: 1….” The region to which the patented antisense oligomer must be 100% complementary overlaps with region R18 as described in claim 27 (“region R18… which consists of a base sequence of 400 bases in the upstream direction of from the 3’ end of the 52nd intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 53rd exon in the human dystrophin pre-mRNA”). The patented antisense oligomer, therefore, reads on instant claim 27. The patented claims, while reciting a “pharmaceutical composition,” do not recite “a pharmaceutically acceptable carrier.” The teachings of De Kimpe are described above and applied hereinafter. The obviousness of combining the patented antisense oligomer in a composition as taught by De Kimpe is described above in paragraph 43 and applied here. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 11,028,122 B1 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4 of U.S. Patent No. 11,028,122 B1. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claims 1-4 recite each recite a composition comprising a “cationic polymer” or “carrier,” together with a “PMO[] antisense oligomer that is 100% complementary to a target sequence of 5′-GAACACCUUCAGAACCGGAGGCAAC-3′ (SEQ ID NO: 124).” The recited target sequence comprises 100% identity to region R18 as set forth in instant SEQ ID NO: 250 (Table 10), and thus the antisense oligomer 100% complementary thereto meets the instant claim limitations. See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4 of U.S. Patent No. 11,028,122 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 11,053,497 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 5-6 of U.S. Patent No. 11,053,497 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 5 recites “A pharmaceutical composition for the treatment of muscular dystrophy, comprising as an active ingredient the antisense oligomer, or a pharmaceutically acceptable salt or hydrate thereof according to claim 1,” wherein the antisense oligomer “comprises, or consists of, SEQ ID NO: 1 or SEQ ID NO: 2.” The antisense oligomer corresponding to SEQ ID NO: 2 comprises a base sequence complementary to region R15 as set forth in instant SEQ ID NO: 247 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 5-6 of U.S. Patent No. 11,053,497 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 45 is described in paragraph 34 above and applied here. U.S. Patent No. 11,655,472 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 10-12 of U.S. Patent No. 11,655,472 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 10 recites “A pharmaceutical composition comprising (i) the antisense oligomer or the pharmaceutically acceptable salt or hydrate thereof according to claim 1, and (ii) a pharmaceutically acceptable carrier, a pharmaceutically acceptable additive, or an aqueous solvent,” wherein the antisense oligomer “consisting of the base sequence of SEQ ID NO: 4 or SEQ ID NO: 5….” The antisense oligomer corresponding to SEQ ID NO: 4 comprises a base sequence complementary to region R13 as set forth in instant SEQ ID NO: 245 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 10-12 of U.S. Patent No. 11,655,472 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. U.S. Patent No. 11,781,140 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 8 of U.S. Patent No. 11,781,140 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 8 recites “A pharmaceutical composition comprising (i) the antisense oligomer or the pharmaceutically acceptable salt or hydrate thereof according to claim 1, and (ii) a pharmaceutically acceptable carrier, a pharmaceutically acceptable additive, or an aqueous solvent,” wherein the antisense oligomer “consist[s] of the base sequence of any of SEQ ID NOs: 7, 8, 10, 16, 21, 24, 31, 42, 67, and 76….” The antisense oligomer corresponding to SEQ ID NO: 67 comprises a base sequence complementary to region R14 as set forth in instant SEQ ID NO: 246 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 8 of U.S. Patent No. 11,781,140 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 45 is described in paragraph 34 above and applied here. U.S. Patent No. 11,981,894 B2 Claims 27 and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of U.S. Patent No. 11,981,894 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. Patented claim 13 recites “A pharmaceutical composition comprising (i) an additive and (ii) an antisense oligomer of 14 to 32 bases in length, or a pharmaceutically acceptable salt or hydrate thereof, wherein the antisense oligomer comprises connected two unit oligomers, each of which is selected from a nucleotide sequence complementary to a nucleotide sequence consisting of 7 to 16 contiguous bases selected from any one of SEQ ID NO: 3-6 and 143, and wherein the two unit oligomers of the antisense oligomer are not contiguous to each other or do not overlap with each other.” SEQ ID NO: 3 consists of bases at positions -5 to 15 counted from the 5’-terminal end of exon 45 of the dystrophin gene based on the patented specification. Thus, a region to which the patented antisense oligomer may be complementary overlaps with region R2 as described in claim 27 (“region R2… which consists of a base sequence of 600 bases in the upstream direction of from the 3’ end of the 44th intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 45th exon in the human dystrophin pre-mRNA”). The patented antisense oligomer, therefore, reads on instant claim 27. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of U.S. Patent No. 11,981,894 B2 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The patented claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the patented antisense oligomer, with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. Co-pending Application No. 17/802,720 Claims 27 and 31 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13, 19-20, and 23-25 of co-pending Application No. 17/802,720. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The co-pending claims encompass pharmaceutical compositions comprising a pharmaceutically acceptable carrier, and an antisense oligomer corresponding to co-pending SEQ ID NO: 67. SEQ ID NO: 67 comprises a base sequence complementary to region R14 as set forth in instant SEQ ID NO: 246 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13, 19-20, and 23-25 of co-pending Application No. 17/802,720 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The co-pending claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the co-pending antisense oligomer with a second antisense oligomer taught by De Kimpe which targets exon 45 is described in paragraph 34 above and applied here. Co-pending Application No. 18/504,781 Claims 27 and 31 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 23-24, and 26-31 of co-pending Application No. 18/504,781. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The co-pending claims encompass pharmaceutical compositions comprising a pharmaceutically acceptable carrier, and an antisense oligomer corresponding to co-pending SEQ ID NO: 3 (“Viltolarsen”). SEQ ID NO: 3 comprises a base sequence complementary to region R18 as set forth in instant SEQ ID NO: 250 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 23-24, and 26-31 of co-pending Application No. 18/504,781 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The co-pending claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the co-pending antisense oligomer with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. Co-pending Application No. 18/774,442 Claims 27 and 31 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8, and 12-13 of co-pending Application No. 18/774,442. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The co-pending claims recite an “antisense oligomer… consisting of a nucleotide sequence complementary to… the 32nd to the 56th, and the 36th to the 56th nucleotides from the 5’ end of the 53rd exon in a human dystrophin gene.” The regions to which the co-pending antisense oligomer must be complementary overlap with region R18 as described in claim 27 (“region R18… which consists of a base sequence of 400 bases in the upstream direction of from the 3’ end of the 52nd intron and a base sequence of 50 bases in the downstream direction from the 5’ end of the 53rd exon in the human dystrophin pre-mRNA”). The co-pending antisense oligomer, therefore, reads on instant claim 27. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8, and 12-13 of co-pending Application No. 18/774,442 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The co-pending claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the co-pending antisense oligomer with a second antisense oligomer taught by De Kimpe which targets exon 51 is described in paragraph 28 above and applied here. Co-pending Application No. 18/951,766 Claims 27 and 31 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 22-33 of co-pending Application No. 18/951,766. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The co-pending claims encompass pharmaceutical compositions comprising a pharmaceutically acceptable carrier, and an antisense oligomer corresponding to co-pending SEQ ID NO: 2. The antisense oligomer corresponding to SEQ ID NO: 2 comprises a base sequence complementary to region R15 as set forth in instant SEQ ID NO: 247 (Table 10). See attached alignment in Appendix III. Claim 28 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 22-33 of co-pending Application No. 18/951,766 in view of De Kimpe (De Kimpe et al., WO 2009/054725 A2, published 30 April 2009). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. The co-pending claims do not recite a pharmaceutical composition comprising a suppressor nucleic acid as recited in instant claim 28. The teachings of De Kimpe are described above and applied hereinafter. The obviousness of preparing a composition comprising the co-pending antisense oligomer with a second antisense oligomer taught by De Kimpe which targets exon 45 is described in paragraph 34 above and applied here. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Jun 15, 2022
Application Filed
Jun 15, 2022
Response after Non-Final Action
Jan 30, 2026
Non-Final Rejection — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Apr 07, 2026
Patent 12570705
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12570975
COMPOSITION FOR DIAGNOSIS OR TREATMENT OF A CONDITION ASSOCIATED WITH INCREASED ACTIVITY OF EIF4E COMPRISING AN EIF4E INHIBITOR
2y 5m to grant Granted Mar 10, 2026
Patent 12570706
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12551573
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+73.4%)
2y 12m
Median Time to Grant
Low
PTA Risk
Based on 48 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month