DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Application Status A pplicant’s response and amendments to the claims filed December 19, 2025 are acknowledged. Claims 7 and 12 were amended. Claims 1-7, 9-10, 12-13, 15-18, 20, 25-27, 31, and 34-35 are pending. Restriction/Election As indicated by Applicant, c laim 12 was amended such that it depends from claim 2, and therefore, is encompassed by Group I. Claim 16, which depends from claim 12, is encompassed by Group III , along with claim 15 . G roup II is eliminated. Applicant’s election of Group I (claims 1-7, 9-10, and 12-13) is acknowledged. A pplicant did not indicated whether the election was made with or without traverse, and did n ot distinctly and specifically point out the supposed errors in the restriction requirement . Th e election has been treated as an election without traverse , accordingly. See MPEP § 818.01(a)). Claims 15-18, 20, 25-27, 31, and 34-35 a re withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Claims 1-7, 9-10, and 12-13 are under consideration hereinafter. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S .C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U .S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc. , 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The disclosure of the prior-filed application, Application No. 62/950,863, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. Specifically, 62/950,863 fails to disclose “a 13PB2 catalytic domain sequence,” “I-R3 catalytic domain sequence,” “nucleic acids 10-50 of SEQ ID NO: 37,” or “nucleic acids 10-19 of SEQ ID NO: 54 , ” as recited in instant claims 5- 6 and 12. The first disclosure of th is subject matter is in PCT/US2020/066223 (see claim 5- 6 and 12) . The effective filing date of claims 5- 6 and 12, therefore, is December 18, 2020 . Claims 1- 4 , 7, 9-10, and 13 find support in Application No. 62/950,863. The effective fil ing date of the claims 1- 4 , 7, 9-10, and 13 is December 19, 2019 . Claim Objections Claims 6 and 12 are objected to because of the following informalities: Claims 6 and 12 recite phrases with the structure “nucleic acids X-X… of SEQ ID NO: X . ” It would be preferred to amend the phrases to recite “ nucleotides nucleic acids X-X… of SEQ ID NO: X,” so that t he claims use the correct terminology to refer to the monomers of each SEQ ID NO . Appropriate correction is required. Claim Rejections - 35 USC § 102 – Kim The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale , or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-3, 7, and 10 are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Kim ( Kim et al., 2012, FEBS Letters, 586 (2012), pg. 3865-3869 ; of record ). Regarding claim 1, Kim teaches a system comprising one or more catalytic nucleic acids (“T315I Dz ”) comprising a catalytic domain (“10-23 DNAzyme ”) and one or more binding domains (“flanking sequences”) (" DNAzyme is an oligodeoxyribonucleotide that contains a 15-nt catalytic core sequence (10-23 DNAzyme , Fig. 1A) and flanking sequences of 7 to 8 nts for substrate binding (substrate binding arms),” pg. 3865, left col.). Kim teaches the one or more binding domains comprise a sequence complementary to and/or identical to a sequence flanking a target site ("T315I DNAzyme was designed to bind and cleave only the T315I mutation in ABL mRNA with a matched pyrimidine base (U, boxed sequence in Fig. 1A) next to an unpaired purine base (A)," pg. 3865; Fig. 1). Kim teaches the system comprises one or more catalytic nucleic acid-assisting reagents , i.e., “PNA 1” and “PNA 2” (“ As illustrated in Fig. 1 B, it may be possible to force structural changes in substrate RNAs by using facilitator oligonucleotides ... we examined binding of facilitator PNAs at the termini of DNAzyme attacking the T315I point mutation in ABL RNA," pg. 3866; Fig. 1 C) . The phrase “specifically binds” is interpreted as requiring that the one or more catalytic nucleic acid-assisting reagents bind to a defined target (pg. 13, lines 13-21). Kim teaches that the one or more catalytic nucleic acid-assisting reagents specifically binds a sequence that is complementary to and/or identical to a sequence flanking the target site ( see Fig. 1C , wherein lowercase letters indicate PNA 1 and PNA 2 ; “As illustrated in Fig. 1C, two 12mer PNAs were constructed to complement the substrate adjacent to the 5’- and 3’- end of the DNAzyme . In addition, T315I DNAzyme was engineered to have a longer binding arm… that can be complementarily hybridized to the PNAs, ” pg. 3867, right col. ). Regarding claim 2 , Kim teaches the one or more catalytic nucleic acids comprise DNAzymes (Fig. 1; pg. 3867, right col.). Regarding claim 3, Kim teaches the one or more catalytic nucleic acid-assisting reagent s comprise peptide nucleic acids (PNAs) ( Fig. 1; pg. 3867, right col. ). Regarding claim 7, as shown in Fig. 1, the one or more catalytic nucleic acids comprise two binding domains (“flanking sequences”), wherein a first binding domain specifically binds a sequence flanking a target site (“T315I DNAzyme cleavage site”), and a second binding domain specifically binds a sequence flanking the target site on the opposite side compared with the first binding domain. Regarding claim 10, as shown in Fig. 1C, the one or more catalytic nucleic acid-assisting reagents form a Watson-Crick base pair with a sequence that is complementary to and/or identical to a sequence flanking the target site (“As illustrated in Fig. 1C, two 12mer PNAs were constructed to complement the substrate adjacent to the 5’- and 3’- end of the DNAzyme . In addition, T315I DNAzyme was engineered to have a longer binding arm… that can be compl e mentarily hybridized to the PNAs,” pg. 3867, right col.). Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Kim The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable ove r Kim (Kim et al., 2012, FEBS Letters, 586 (2012), pg. 3865-3869; of record) as applied to claims 1-3, 7, and 10 above. The teachings of Kim are described above and applied as to claims 1-3, 7, and 10 therein. Kim does not teach a “kit” comprising the system, which is interpreted as a container comprising the elements of instant claim 1. However, Kim also teaches that “a major limitation of PNA is its inefficient intracellular delivery due to its uncharged backbone” (pg. 3867, right col.). Kim teaches introducing the PNAs together with the DNAzyme , in an effort to make delivery more efficient (pg. 3867, right col.). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared a “kit” comprising the elements of Kim’s system. It would have amounted to packaging elements of a known system, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing a kit comprising the elements of Kim’s system, because Kim teaches that the system elements are compatible, and means of packaging nucleic acids together in a container were well known in the art. Kim teaches benefits of combining the system elements (i.e., promoting efficient delivery), and therefore, the skilled artisan would have been motivated to prepare a kit comprising the elements of Kim’s system. Claim Rejections - 35 USC § 103 – Kim in view of Quijano Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable ove r Kim (Kim et al., 2012, FEBS Letters, 586 (2012), pg. 3865-3869; of record) as applied to claims 1-3, 7, and 10 above, in view of Quijano ( Quijano et al., 2017, Yale Journal of Biology and Medicine, 90 (2017), pg. 583-598 ). The teachings of Kim are described above and applied as to claims 1-3, 7, and 10 therein. Kim does not teach that the PNA comprise s γ-PNA . However, Quijano teaches that unmodified PNA have disadvantages, e.g., poor solubility and aggregation (pg. 586, left col.). Quijano teaches that a modified PNA form, γ-PNA (“ γ MP -PNA ”) improves PNA solubility, and enhances PNA hybridization and sequence selectivity (pg. 586, left col.; pg. 591, left col.). Quijano teaches that γ-PNA binds through Watson-Crick base pairing rules, and binds to RNA and DNA (pg. 591, left col.). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the PNA of Kim for PNA comprising γ-PNA in view of Quijano . It would have amounted to a simple substitution of two known PNA types, by known means to yield predictable results . The skilled artisan would have had a reasonable expectation of success in substituting the PNA types, because Quijano teaches that γ-PNA functions on RNA and DNA, and binds through Watson-Crick base pairing rules, and therefore, the skilled artisan would have had a reasonable expectation that γ-PNA would function in Kim’s system which uses Watson-Crick base pairing, targets an RNA, and also utilizes hybridization between the PNAs and DNAzyme (see Fig. 1). Quijano teaches several benefits of γ-PNA relative to unmodified PNA (i.e., improved solubility, and enhanced hybridization and sequence selectivity ), and therefore, the skilled artisan would have been motivated to substitute Kim’s unmodified PNA for PNA comprising γ-PNA. Claim Rejections - 35 USC § 103 – Xiao and Gomez Claim s 1-7, 9-10, and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Xiao ( Xiao et al., 2012, Nucleic Acids Research, Vol. 40, No. 4, pg. 1778-1786 ) and Gomez ( Gomez et al., 2014, Analytical Chemistry, 86, pg. 119 9 2-11998 ). Regarding claim 1, Xiao teaches a system comprising a one or more catalytic nucleic acids (“DNA catalyst,” or “ deoxyribozyme ”) comprising one or more catalytic domains (“catalytic region”) and one or more binding domains, wherein the one or more binding domains comprise a sequence complementary to and/or identical to a sequence within a target site (“binding domains”)(Figs. 1-2 ; pg. 1781). Xiao teaches the system is used for site-specific hydrolysis of single-stranded DNA (Abstract; pg. 1779, right col.). Xiao teaches that “comprehensive follow-up experiments should allow discovery of a complete set of deoxyribozymes that enable site-specific hydrolysis of essentially any arbitrarily chosen ssDNA substrate” (pg. 1779) . Xiao does not teach that the system comprises one or more catalytic nucleic acid-assisting reagents. However, Xiao teaches that “[t]o achieve DNA-catalyzed cleavage of double-stranded DNA (dsDNA) rather than ssDNA… separation of the dsDNA substrate into its two ssDNA components would be required” (pg. 1785, right col.). Xiao teaches that “[s] uch separation may be possible via suitable strand invasion strategies, whereupon each of the two single-stranded components would be cleavable by a corresponding deoxyribozyme ” (pg. 1 785, right col.). Gomez teaches a system comprise a pair of bis-PNA openers, each comprising a sequence that specifically binds a sequence complementary to and/or identical to a sequence flanking a target site (Fig. 1A-B; pg. 11992). Gomez illustrates that binding of the pair of bis-PNA openers to dsDNA exposes a ssDNA substrate (Fig. 1A-B; pg. 11992) . Gomez illustrates that the ssDNA substrate produced by the bis-PNA openers can be hybridized with a liner DNA probe (Fig. 1; “leaving the other strand free for probe hybridization. Two ends of a linear padlock probe are then ligated on the displaced strand forming a PD-loop,” pg. 11992; Table 1). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the catalytic nucleic acids in the system of Xiao with the bis-PNA openers of Gomez . It would have amounted to a simple combination of two known elements , by known means to yield predictable results . The skilled artisan could have combined the known elements with a reasonable expectation of success because the elements perform separate , but complementary, functions on DNA; the bis-PNA openers of Gomez “open” up dsDNA to expose a ssDNA substrate, and the catalytic nucleic acids in the system of Xiao site-specifically cleave ssDNA substrates . Gomez also teaches that the ssDNA substrate produced by the bis-PNA openers can be hybridized to a DNA probe . In combination with the explicit teachings of Xiao regarding dsDNA substrates , t he skilled artisan would have reasonably expected that the DNA-based catalytic nucleic acids of Xiao could be hybridized to a ssDNA substrate produced by Gomez’s bis-PNA openers . The skilled artisan would have reasonably expected that hybridization of the catalytic nucleic acids of Xiao, would have enabled site-specific hydrolysis of a target site within the ssDNA substrate. The skilled artisan would have been motivated to combine th e element s in an effort to expand the applications of Xiao’s catalytic nucleic acids, and because Xiao explicitly describes that use of the catalytic nucleic acids on dsDNA would require means to separate the dsDNA, a function fulfilled by Gomez’s bis-PNA openers. Regarding claims 2 and 4, the one or more catalytic nucleic acids above are DNAzymes comprising DNA hydrolysis activity (Figs. 1-3, Xiao). Regarding claims 3 and 9, the one or more catalytic nucleic acid-assisting reagents above are PNAs comprising bis-PNA (Fig. 1, Gomez). Regarding claim 5, the one or more catalytic nucleic acids above comprise a 13PB2 catalytic domain sequence (Fig. 3, Xiao). Regarding claim 6, Xiao teaches the DNAzymes comprise a catalytic region (“N 40 ”) flanked by two Watson-Crick binding arms (Fig. 3 , description). Xiao teaches the binding arm sequences, each of which comprise a “C” 5’ of the catalytic region as shown in Fig. A below ( underlined, pg. 1780, left col. ). Xiao teaches the 13PB2 catalytic region sequence in Fig. 3, which as shown in Fig. A below, is 100% identical to nucleotides 11-50 of SEQ ID NO: 3 . T hus, the DNAzyme of Xiao comprises a 13PB2 catalytic domain sequence comprising nucleotides 10-50 of SEQ ID NO: 37. FIGURE A. 5’-CGAAGTCGCCATCTCTT C -N 40 -ATAGTGAGTCGTATTA-3’ 5’-CGAAGTCGCCATCTCTT C -N 40 -ATAGTGAGTCGTATTAAGCTGATCCTGATGG-3’ TATGACACTTATTATAAATATGCTAGTAACGGATAGGTTG N 40 13PB2 (Fig. 3) CTATGACACTTATTATAAATATGCTAGTAACGGATAGGTTG nts 10-50 SEQ ID NO: 37 Regarding claim 7 , Xiao teaches the one or more catalytic nucleic acids comprise two binding domains (“ binding arms ”), wherein a first binding domain specifically binds a sequence flanking a target site, and a second binding domain specifically binds a sequence flanking the target site on the opposite side compared with the first binding domain (Fig. 1; Fig. 3, description; pg. 1781) Regarding claim 10, Gomez teaches the one or more catalytic nucleic-acid assisting reagents form a Watson-Crick and/or Hoogsteen base pair with a sequence that is complementary to and/or identical to a sequence flanking the target site ( “Cationic pyrimidine bis-PNAs can be used to sequence-specifically bind to one strand of the DNA duplex,” pg. 11992; Table 1; Fig. 3A ; pg. 1199 6 ) . Regarding claim 13, neither Xiao or Gomez teach a kit comprising the elements. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared a “kit” comprising the elements of the obvious system. It would have amounted to packaging elements of an obvious system, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing a kit comprising the elements of the system, because the system elements are compatible based on the prior art, and means of packaging nucleic acids together in a container were well known in the art. The skilled artisan would have been motivated to prepare a kit comprising the elements of the system in an effort to streamline use of the system. Claim Rejections - 35 USC § 103 – Xiao and Gomez as evidenced by Betts Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable ove r Xiao (Xiao et al., 2012, Nucleic Acids Research, Vol. 40, No. 4, pg. 1778-1786) and Gomez (Gomez et al., 2014, Analytical Chemistry, 86, pg. 11992-11998) as applied to claims 1-7, 9-10, and 13, and as evidenced by Betts (Betts et al., 1995, Science, Vol. 270 , pg. 1838-1841 ). Gomez teaches the bis- PNAs comprise a sequence which specifically binds a sequence that is complementary to a sequence flanking a target site (Fig. 1 ; Table 1 ), but does not teach that the bis- PNAs comprise a sequence that forms a triple heli x. However, Betts teaches that bis- PNA with a substantially identical structure to that of Gomez forms a triple helix which hybridized to a DNA substrate ( Abstract; “Several groups have designed and synthesized bis- or hairpin PNAs to promote triplex formation by tethering two polypyrimidine PNA strands by flexible linkers…,” pg. 1838-1839 ; Fig. 1 ; Fig. 3 ) . Thus, as evidenced by Betts, the bis- PNAs of Gomez inherently comprise a sequence that forms a triple heli x with a sequence that is complementary to a sequence flanking a target site . Each of the remaining limitations of claim 12 have been addressed above in the rejections of claims 1 - 3, and 6-7. The combination of Xiao and Gomez also renders obvious claim 12 as evidenced by Betts. Statutory Double Patenting A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co. , 151 U.S. 186 (1894); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert , 245 F.2d 467, 114 USPQ 330 (CCPA 1957). A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101. Claims 1 and 7 are provisionally rejected under 35 U.S.C. 101 as claiming the same invention as that of claims 1 and 7 of co-pending Application No. 19/374,578 (reference application). This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented. Co-pending claim 1 recites “ A system for genetic engineering, comprising: one or more catalytic nucleic acids, comprising: one or more catalytic domains; and one or more binding domains, wherein the one or more binding domains comprise a sequence complementary to and/or identical to a sequence flanking a target site and/or within the target site; and one or more catalytic nucleic acid-assisting reagents, comprising a sequence that specifically binds a sequence that is complementary to and/or identical to a sequence flanking the target site and/or within the target site .” C o-pending claim 1 recites the same language as instant claim 1, and therefore, the claims are drawn to identical subject matter. Co-pending claim 7 recites “ The system of claim 1, wherein a first binding domain specifically binds a sequence flanking the target site, and a second binding domain specifically binds a sequence flanking the target site on the opposite side compared with the first binding domain. ” Co-pending claim 7 recites the same language as instant claim 7, and therefore, the claims are drawn to identical subject matter. Nons tatutory Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg , 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman , 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi , 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum , 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington , 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or PTO/AIA/26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer . Claims 1-7, 10, and 12- 13 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11 of co-pending Application No. 19/374,578 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. As stated above, c o-pending claim s 1 and 7 recite the same language as instant claim s 1 and 7 , and therefore, the c o-pending claims anticipate instant claims 1 and 7. Co-pending claim 3 anticipates instant claim 2. Co-pending claim 2 anticipates instant claim 3. Co-pending claims 4, 5, and 6 anticipate instant claims 4, 5, and 6, respectively. Co-pending claims 9 and 10 anticipate instant claim 10. Co-pending claim 11 anticipates instant claim 13. Regarding instant claim 12, the co-pending claims do not recite the specific combination of elements recited in instant claim 12. However, the co-pending claims recite each of the limitations of instant claim 12 in separate claims (see claims 2, 6-7, and 10). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the limitations of the co-pending claims to arrive at the combination of limitations in instant claim 12 . It would have amounted to a simple combination of known co-pending elements by known means to yield predictable results . The skilled artisan would have been motivated to combine the elements with a reasonable expectation of success because the co-pending claims are all directed to the same system, and the co-pending elements merely recite further limitations of the system, and therefore, the skilled artisan would reasonably expect the elements to be compatible together . Claim 9 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11 of co-pending Application No. 19/374,578 (reference application) in view of Quijano (Quijano et al., 2017, Yale Journal of Biology and Medicine, 90 (2017), pg. 583-598) . Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding instant claim 9, the co-pending claims do not recite that the PNA comprises γ-PNA . The teachings of Quijano are described above and applied hereinafter. The obviousness of substituting the PNA of the co-pending claims for PNA comprising γ-PNA i s described above in paragraph REF _Ref224835304 \r \h 21 and applied here with respect to instant claim 9. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT JENNA L PERSONS whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (703)756-1334 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT M-F: 9-5pm . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT JENNIFER A DUNSTON can be reached at FILLIN "SPE Phone?" \* MERGEFORMAT (571) 272-2916 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/ Examiner, Art Unit 1637 /Soren Harward/ Primary Examiner, TC 1600