Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Response to Amendment and Arguments
The Amendment filed on 11/13/2025 in response to the previous Non-Final Office Action (8/13/2025) is acknowledged and has been entered.
Claim 7 has been cancelled.
Claims 1-6 and 8-20 are pending.
Claims 16 and 20 have been withdrawn from consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention/species.
Claims 1-6, 8-15 and 17-19, drawn to complex comprising anti-transferring receptor antibody comprising the CDR-H1-3, and CDR-L1-3 from SEQ ID NO: 54 and 55 linked to a payload (oligonucleotide), are under consideration.
Information Disclosure Statement:
The information disclosure statement (s) (IDS) submitted on 11/13/2025 are/is considered by the examiner and initialed copies/copy of the PTO-1449 are/is enclosed.
Rejections Withdrawn
The objection of claims 1-15 and 17-19 to as being drawn to a nonelected invention inhibiting activity of DUX4 in the claimed complex examination at this time, is withdrawn in view of the claim amendment.
The rejections of claim 10 and 17 because the claims recite insufficient antecedent basis for the limitation in the claims are withdrawn in view of the claim amendment.
The arguments are moot in view of withdrawals of the rejection(s).
Rejection Maintained and Response to Arguments
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description:
Oligonucleotide linked to anti-transferrin antibody without structural definition.
Claims 1-6, 8, 10-15, and 17-19 remain and are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Possession may be shown. For claimed product the specification must provide sufficient distinguishing identifying characteristics of the genus, including disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, level of skill and knowledge in the art, and predictability in the art or any combination thereof.
The claims are broadly drawn to
A complex comprising an anti-transferrin receptor antibody covalently linked to a molecular payload configured for inhibiting expression
Thus, the claims encompass a genus of any oligonucleotide used for inhibiting expression of DUX4.
To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof.
The specification first teaches:
Muscular dystrophies (MDs) are a group of diseases characterized by the progressive weakness and loss of muscle mass. These diseases are caused by mutations in genes which encode proteins needed to form healthy muscle tissue. Facioscapulohumeral muscular dystrophy (FSHD) is a dominantly inherited type of MD which primarily affects muscles of the face, shoulder blades, and upper arms…….. FSHD is caused by aberrant production of double homeobox 4 (DUX4), a protein whose function is unknown. The DUX4 gene, which encodes the DUX4 protein, is located in the D4Z4 repeat region on chromosome 4 and is typically expressed only in fetal development, after which it is repressed by hypermethylation of the D4Z4 repeats which surround and compact the DUX4 gene (page 2).
….complexes engineered to deliver oligonucleotides may release the oligonucleotides such that the oligonucleotides can inhibit DUX4 gene expression in the muscle cells (page 4).
The specification also teaches:
targeting complex (DTX-C-012) comprising an anti-transferrin receptor antibody (a 15G11 antibody) to reduce gene expression levels in cynomolgus monkey muscle tissues in vivo, relative to a vehicle experiment and compared to a naked ASO (control DMPK-ASO). (N=3 male cynomolgus monkeys). FIGs. 18A-18B depict non-limiting schematics showing the ability of a muscle targeting complex (DTX-C-012) comprising an anti-transferrin receptor antibody (a 15G11 antibody) to reduce gene expression levels in cynomolgus monkey smooth muscle tissues in vivo (Fig 16-18), AND
Any suitable oligonucleotide may be used as a molecular payload, as described herein.
The specification provides Examples of oligonucleotides useful for targeting DUX4 and teaches
…the oligonucleotide is an antisense oligonucleotide, a morpholino, a siRNA, a shRNA, or another nucleotide which hybridizes with the target DUX4 gene or mRNA. [000542] In some embodiments, oligonucleotides may have a region of complementarity to a sequence as set forth as: Human DUX4,
[00014] …… the oligonucleotide comprises an antisense strand of 18- 30 nucleotide in length and comprises a region of complementarity to at least 15 consecutive nucleotides of SEQ ID NO: 258 or 339, optionally wherein the antisense strand comprises a region of complementarity of at least 15 consecutive nucleotides of SEQ ID NO: 261. [00015] In some embodiments, the oligonucleotide comprises at least 15 consecutive
nucleotides of SEQ ID NO: 248 (GGGCATTTTAATATATCTCTGAACT), wherein each T is optionally and independently U, optionally wherein the oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 248 (GGGCATTTTAATATATCTCTGAACT), wherein each T is optionally and independently U.
The specification provides teachings of modulating expression levels of DUX4 in cell lines:
the expression levels of DUX4 in three DUX4-expressing cell lines (A549, U-2 OS, and HepG2 cell lines) and immortalized skeletal muscle myoblasts (SkMC). [00033] FIG. 6 depicts showing the ability of a phosphorodiamidate morpholino oligomer (PMO) version of an antisense oligonucleotide that targets DUX4 (FM10 PMO) …. (figures 4-6).
However, the instant specification does not provide representative numbers of oligonucleotides other than a few antisense strands to reduce the DUX4 gene expression for treating muscular dystrophy (FSHD). In the absence of sufficient recitation of distinguishing structural and functional characteristics, the specification does not provide adequate written description of the claimed genus of molecular payload. Therefore, the written description is not commensurate in scope with the claims, one of skill in the art would reasonably conclude that applicant was not in possession of the claimed genus.
“[A] sufficient description of a genus . . . requires the disclosure of either a representative number of species falling within the scope of the genus or structural features common to the members of the genus so that one of skill in the art can ‘visualize or recognize’ the members of the genus.” Ariad, 598 F.3d at 1350 (quoting Eli Lilly, 119 F.3d at 1568-69). A “representative number of species” means that those species that are adequately described are representative of the entire genus. AbbVie Deutschland GMBH v. Janssen Biotech, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014). Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus to provide a "representative number” of species. The “structural features common to the members of the genus” needed for one of skill in the art to ‘visualize or recognize’ the members of the genus takes into account the state of the art at the time of the invention. For antibodies, the Federal Circuit has found that possession of a mouse antibody heavy and light chain variable regions provides a structural "stepping stone" to the corresponding chimeric antibody, but not to human antibodies. Centocor, 97 USPQ2d at 1875.
The Court, in Abbvie v. Centocor (Fed. Cir. 2014), held that a disclosure of many different antibodies (in that case neutralizing antibodies to IL-12 with a particular binding affinity) was not enough to support the genus of all IL-12 neutralizing antibodies because the disclosed antibodies were very closely related to each other in structure and were not representative of the full diversity of the genus. The Court further noted that functionally defined genus claims can be inherently vulnerable to invalidity challenge for lack of written description support especially in technology fields that are highly unpredictable where it is difficult to establish a correlation between structure and function for the whole genus or to predict what would be covered by the functionallyclaimed genus.
A description of a genus may be achieved by means of a recitation of a representative number of species falling within the scope of the genus or by describing structural features common the genus that “constitute a substantial portion of the genus.” See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997): “A description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNA, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to the members of the genus, which features constitute a substantial portion of the genus.” The Federal Circuit has recently clarified that a DNA molecule can be adequately described without disclosing its complete structure. See Enzo Biochem, Inc. V. Gen-Probe Inc., 296 F.3d 1316, 63 USPQ2d 1609 (Fed. Cir. 2002). The Enzo court adopted the standard that the written description requirement can be met by “show[ing] that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristic, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics. “ Id. At 1324, 63 USPQ2d at 1613”.
The court has since clarified that this standard applies to compounds other than cDNAs. See University of Rochester v. G.D. Searle & Co., Inc., F.3d ,2004 WL 260813, at *9 (Fed.Cir.Feb. 13, 2004). The instant specification fails to provide sufficient descriptive information in the broadly claimed molecular payload in the claimed complex. The specification does not provide a specific or detail structural characteristics of the payload other than the described antisense oligonucleotide. Thus, one of skill in the art would reasonably conclude that the inventor(s), at the time the application was filed, did not have possession of the claimed invention.
Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116). As discussed, the skilled artisan cannot envision the detailed chemical structure(s) and functional attribute(s) of the encompassed genus of oligonucleotides in a complex. Therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016.
Therefore, only the claimed complex comprising an anti-transferrin receptor antibody CDR-H1-3 from the sequence of SEQ ID NO: 54 and CDR-L1-3 form the sequence of SEQ ID NO: 55, linked to an antisense oligonucleotide comprising at least 15 consecutive nucleotides of SEQ ID NO: 248 that is complementary to the sequence of SEQ ID NO: 258 or 339, but not broadly claimed any oligonucleotide in the claimed complex for inhibiting expression of DUX4, meet the written description provision of 35 U.S.C. §112, first paragraph. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115).
Response to applicant’s argument:
At page 6, applicant argues that
Claim 1 has been amended to delete the recitation "a molecular payload configured for inhibiting expression or activity of Double Homeobox 4 (DUX4)" and to recite "an oligonucleotide that inhibits expression of Double Homeobox 4 (DUX4)". Based on the teachings of the Application as-filed, one of ordinary skill in the art would have concluded that the Applicant had possession of the claimed complexes and their use in the claimed methods.
In response, the Office agrees that applicant’s amendment has further narrowed down to inhibition of expression of DUX4 with oligonucleotide. However, as set forth in the written description rejection, the specification provides antisense strand comprising a region of complementarity to at least 15 consecutive nucleotides of SEQ ID NO: 261 (specific oligonucleotide comprises at least 15 consecutive nucleotides of SEQ ID NO: 248 (GGGCATTTTAATATATCTCTGAACT) that is complementarity to SEQ ID NO: 258 or 339 to inhibit the gene expression of DUX4. The specification does not teach any other oligonucleotides to any DUX4 or any part of DUX4 to perform the function as claimed. Thus, in the rejection, last paragraph, the Office suggests using antisense oligonucleotide comprising at least 15 consecutive nucleotides of SEQ ID NO: 248 that is complementary to the sequence of SEQ ID NO: 258 or 339, but not broadly claimed any oligonucleotide in claim 1 to overcome the rejection.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the conflicting application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement.
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13 (MPEP 9th Ed, Feb 2023).
An obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but an examined application claim not is patentably distinct from the reference claim(s) because the examined claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Over Application:
Claims 1-6, 8-15 and 17-19 remain and are provisionally rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1-20 of copending Application No. 17791667. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims are directed to a complex comprising an anti-transferrin receptor antibody linked to a payload for modulation of expression of muscle disease gene.
The instant claims are drawn to
A complex comprising an anti-transferrin receptor antibody covalently linked to an oligonucleotide configured for inhibiting expression of Double Homeobox 4 (DUX4), wherein the antibody comprises a heavy chain complementarity determining region 1-3 (CDR-H1-3) of VH comprising the amino acid sequence to SEQ ID NO: 54, and a light chain complementarity determining region 1-3 (CDR-L1-3) of VL comprising amino acid sequence to SEQ ID NO: 55,
wherein the oligonucleotide comprising 15 nucleotides GGGCATTTTAATATATCTCTGAACT
wherein the oligonucleotide is modified at 2’ or linked to phosphonothioate or internucleotide linkage, is antisense oligonucleotide.
A method of inhibiting expression of DUX4 in a cell comprising contacting the cell with the complex of claim 1.
The amended claims of application ‘667 are drawn to
A complex comprising an anti-transferrin receptor antibody covalently linked to a molecular payload configured for inhibiting expression muscle disease gene, wherein the antibody comprises a heavy chain complementarity determining 1-3 (CDR-H1-3) of VH comprising SEQ ID NOs: 49., 50 ,and 51 and having 80% sequence to the amino acid sequence to SEQ ID NO: 54, and a light chain complementarity determining region 1-3 (CDR-L1-3) of VL comprising the sequences of 53, 29 and 53 having 80% the amino acid sequence to SEQ ID NO: 55,
wherein the oligonucleotide is modified at 2’ or linked to phosphonothioate linkage or internucleotide linkage and is antisense oligonucleotide.
A method of inhibiting expression of muscle disease gene in a cell comprising contacting the cell with the complex of claim 1.
A method of treating a subject having a muscle disease comprising administering the subject the complex of claim 1.
Both sets of the claims are drawn to the same complex comprising anti-transferrin receptor antibody having the same CDRs from VH and VL of SEQ ID NOs: 54 and 55 (see SCV) linked to an oligonucleotide. The difference is that the claims of ‘667 application do not specify the oligonucleotide comprising 15 nucleotides of SEQ ID NO: 248 (GGGCATTTTAATATATCTCTGAACT) to inhibit expression of DUX4, a muscle protein in the dependent claims
However, the specification of the ‘667 application specifically teaches muscle gene antisense oligonucleotide of DUX4 as a payload in the complex. The antisense oligonucleotide of DUX4 has the same oligonucleotide sequence 5'- GGGCATTTTAATATATCTCTGAACT-3' at [000889] that is used to inhibit the DUX4 gene expression (example 26) and treat a subject having a muscle disease. One having ordinary skill in the art would have been motivated to form a complex comprising antisense oligonucleotide to DUX4 linked to the same anti-transferrin receptor antibody to arrive at current invention without unexpected result.
This is a provisional obviousness-type double patenting rejection because the conflicting claims have not in fact been patented.
Applicant’s statement:
Applicant respectfully request that the provisional rejection be held in abeyance until allowable subject matter is agreed.
Conclusion
No claim is allowed.
Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Lei Yao, whose telephone number is (571) 272-3112. The examiner can normally be reached on 8:00am-6:00pm Monday-Friday.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis, can be reached on (571) 270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LEI YAO/Primary Examiner, Art Unit 1642