Prosecution Insights
Last updated: July 17, 2026
Application No. 17/792,612

METHODS FOR DIAGNOSING HEPATOCELLULAR CARCINOMA

Final Rejection §101§103§112
Filed
Jul 13, 2022
Priority
Jan 17, 2020 — provisional 62/962,437 +1 more
Examiner
DAUNER, JOSEPH G
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Board of Trustees of the Leland Stanford Junior University
OA Round
2 (Final)
57%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
92%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
414 granted / 729 resolved
-3.2% vs TC avg
Strong +35% interview lift
Without
With
+35.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
50 currently pending
Career history
797
Total Applications
across all art units

Statute-Specific Performance

§101
2.5%
-37.5% vs TC avg
§103
53.5%
+13.5% vs TC avg
§102
10.5%
-29.5% vs TC avg
§112
15.0%
-25.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 729 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The amended claims filed 5/1/2026 are under consideration. The amendments and arguments presented in the papers filed 5/1/2026 ("Remarks”) have been thoroughly considered. The issues raised in the Office action dated 12/1/2025 listed below have been reconsidered as indicated. a) Any objections or rejections of claims 5-6 and 14 are rendered moot by the cancellation of the claims and are withdrawn. b) The rejections of claims 1-4, 10-11, 14 and 42 under 35 U.S.C. 101 because the claimed invention is directed to judicial exceptions without significantly more are withdrawn in view of the amendments to the claims. c) The rejections of claims 1-4, 10-12, 15 and 42 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement, are withdrawn in view of the amendments to the claims. d) The rejections of claims 1-4, 10-12, 15 and 42 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, are withdrawn in view of the amendments to the claims. e) The rejections of claim 4 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, is withdrawn in view of the amendments to the claims. f) The rejections of claim(s) 1, 2, 3, 4, 10 and 15 under 35 U.S.C. 102(a)(2) as being anticipated by Zhang (Hepatol Int. 2013. 7:893-900) as evidenced by UCSC Genome Browser (retrieved on 10/30/2025 from the internet) are withdrawn in view of the amendments to the claims and Zhang is silent regarding the measuring of any increased frequency of methylation for each of the recited genes. The Examiner’s responses to the Remarks regarding issues not listed above are detailed below in this Office action. New and Modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL. Election/Restrictions Applicant elected without traverse Group I, claims 1-6, 11-12 and 14-15, in the reply filed on 9/22/2025. The restriction requirement between groups I and V has been withdrawn. Pending claims 16, 26, 34, 38-41 and 46 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 9/22/2025. Applicant elected without traverse of SPINT2, cg22522066 and SEQ ID NO: 289 in the reply filed on 9/22/2025. Priority The present application is a 371 national stage entry of PCT/US2021/013656 (filed 1/15/2021), which claims benefit of 62/962,437 (filed 1/17/2020). Priority to 62/962,437 for the elected claims is recognized. Information Disclosure Statement The listing of references in the specification or the citation of references throughout the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or cited on a submitted IDS, they have not been considered. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 12 is rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exceptions without significantly more. The claim(s) recite(s): “wherein detection of increased blood levels of AFP in combination with increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 compared to reference value ranges for blood levels of AFP and frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 for a control subject indicate that the patient has a positive diagnosis for the HCC” (claim 12). In regards to claim element (a) identified above, the language states the natural relationship between increased levels of AFP in patients with HCC and controls. This represents a natural phenomenon and is a judicial exception. The judicial exceptions are not integrated into a practical application because the claims do not involve: improvements to the functioning of a computer or to any other technology or technical field; applying or using the judicial exceptions to effect a particular treatment or prophylaxis for a disease or medical condition; applying the judicial exception with, or by use of, a particular machine; or effecting a transformation or reduction of a particular article to a different state or thing. The claimed limitations add insignificant extra-solution activity to the judicial exceptions. Additional steps (a) and (b) relate to data gathering to provide information. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims encompass the use of commercially available arrays that are well-known and used in a conventional manner as described in paragraphs 5, 99, 155 and 156 of the instant specification. Response to the traversal of the 101 rejections The Remarks argue why claims 1 and 42 are patent eligible (p. 9-11). The arguments have been fully considered but are not persuasive as the patent eligibility of claim 12 was not addressed. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 2, 3, 4, 10, 11, 12, 14, 15, 42 and 47 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The following are modified rejections. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 1, 2, 3, 4, 10, 11, 12, 14, 15, 42 and 47 require measuring “an increased frequency of methylation” at one or more CpG sites in each of the recited genes . The claims broadly encompass measuring increased methylation in any CpG site in SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 and any CpG sites within 200 nucleotides of cg15607538, cg08572734, cg00577935, cg03667968, cg08571859, cg02659086, cg04673590, cg09420439, cg26744375, cg08465862, cg14250130, cg00922376, cg05346841, cg26421310, cg13629563, cg06848185, cg17300544, cg22522066, cg24166864, and cg26397188. The instant specification used methylation frequency data from the Illumina HumanMethylation450 (450K) microarray (para. 155, 157, 158, 163, 182, 183, 184, 185, 186 and 187). The 450K microarray screens for numerous CpG sites within the SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 genes. The specification lists 20 CpG sites identified as a cfDNA biomarker panel in Table 2. The instant specification also states: “While excluded genes show differential methylation in their studies, this effect was not shown in the 450K data, suggesting that these genes may not be population-wide predictors of HCC in cirrhosis patients.” (para. 157); and CpGs with an AUC less than 0.8 from a univariate logistic regression model were discarded (Table 2)” (para. 184). The specification demonstrates a lack of possession of CpG biomarker sites that have increased frequency of methylation, e.g., hypermethylation, included in the 450K microarray other than cg15607538, cg08572734, cg00577935, cg03667968, cg08571859, cg02659086, cg04673590, cg09420439, cg26744375, cg08465862, cg14250130, cg00922376, cg05346841, cg26421310, cg13629563, cg06848185, cg17300544, cg22522066, cg24166864, and cg26397188. The specification explicitly describes analyzing the methylation frequency of all CpG sites screened using the 450K microarray, discarded a majority of them as not being of interest to the specification for diagnosing HCC and identified only the above recited CpG sites as biomarkers for HCC. As such, the specification demonstrates an interest in only some but not all of the CpG sites screened by the 450K microarray. The following are new rejections necessitated by the amendments to the claims. Regarding claim 1, the amended claim requires “capturing cfDNA from the patient blood sample with a panel of DNA probes”. This step is paired with any methodology of “measuring methylation at one or more CpG sites” or using those recited in claim 10. The instant specification demonstrates the possession of one method in which cfDNA is captured with probes and methylation is measured. This method is depicted in Fig. 3. In the disclosed method, e.g. LAMB, methylation is measured via sequencing. There is no indication that applicant contemplated methods in which captured cfDNA was assayed for methylation using PCR-based assays, COBRA, microarrays or Southern blotting. The specification has a very limited discussion of using capture probes, and that discussion is limited specifically to the LAMB method. Response to the traversal of the written description rejections The Remarks argue the Office Action asserts that the claims "broadly encompass making this [HCC] diagnosis based on increased methylation in any CpG sites in SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957” and the "specification explicitly describes analyzing the methylation frequency of all CpG sites using the 450K microarray, discarded a majority of them as not being useful for diagnosing HCC" and identified a subset thereof as "biomarkers for HCC." (p. 11-12). The Examiner’s position is detailed above. The Remarks argue the present disclosure provides, among other things, a physiologically-inspired biomarker discovery method, Layered Analysis for Methylated Biomarkers (LAMB), that can screen tumor suppressors for biologically-rooted cfDNA biomarkers and identifies hypermethylated tumor suppressors in tissues through meta-analysis data and differentially methylated CpGs in tumor suppressor promoters. The Remarks further argue Example 1 is exemplary and one of ordinary skill in the art reading the present disclosure would readily understand that the selected AUC cut point of 0.8 is dependent on, for example, the particular set of samples utilized, and a different AUC cut point may be selected depending on the samples evaluated. The Remarks further argue the particular CpG sites identified in the Examples using the LAMB method may be different using a different sample set with a different selected cut point and as such the particular CpGs identified in Table 2 and acknowledged as satisfying the written description requirement are solely exemplary based on the particular samples and selected cut point utilized in the examples. See p. 12. The arguments have been fully considered but are not persuasive. There is no guidance based on the disclosed CpG sites, which additional sites applicant contemplated or had possession of. There is no reasonable expectation that using a different set of samples, which CpG sites may be relevant and contemplated by the specification as other references of record did not observe increased methylation frequency of the same sites as applicant. The claims attempt to cover all CpG sites in the recited genes being measured as hypermethylated, but the instant specification does not demonstrate that this observation was made by applicant. Furthermore, methylation association studies such as those in the instant specification are highly variable and identified biomarkers vary between the studies. Thus, simply repeating the present studies with different patient cohorts would not necessarily uncover additional biomarkers and they may even fail to identify the CpGs of the instant specification being associated with HCC. The Remarks argue to the extent the rejection relies on the assertion that a majority of CpG sites were discarded as "not being useful for diagnosing HCC," this is respectfully not correct. The Remarks argue simply because certain CpGs with a lower AUC were discarded and other CpGs with an AUC demonstrating an increased predictive power were maintained does not mean those discarded are "not useful." And rather, such CpGs certainly may be useful depending on the particular samples and cut point selected, and those CpGs could be readily identified using the described LAMB technologies of the disclosure. See p. 12-13. The arguments have been fully considered but are not persuasive. Applicant considered a number of CpG sites and demonstrated possession of a limited number based on the observed hypermethylation that was associated with HCC. Applicant did not identify any other hypermethylated CpG cites that they contemplated or had possession in terms of measuring hypermethylation relative to a control reference. There is no discussion of adjustments to AUC, cut points or samples, in terms of what may or may not be acceptable, or that other AUC may be used in the LAMB model. The instant specification describes a particular methodology the LAMB model that identified a particular set of hypermethylated CpG sites. This limited number of species of hypermethylated CpG sites does not reasonably support possession of all other CpG sites encompassed by the broad scope of the claim. In particular, there is no guidance as to which additional CpG sites in SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP and AK055957 applicant had possession of in terms of having measured hypermethylation of and specifically any cites that are within 200 nucleotides the claimed “cg” CpG sites. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 2, 3, 4, 10, 11, 12, 14, 15, and 47 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, it is unclear based on the use of the passive voice whether the claim requires an active method step of “comparing” methylation of the captured cfDNA to reference value ranges for frequency of methylation at the one or more CpG site in a control captured cfDNA. It is further unclear if the claim requires an active method step of capturing control cfDNA. Claims 2, 3, 4, 10, 11, 12, 14, 15, and 47 depend from claim 1 and are rejected for the same reason. Regarding claim 4, it is unclear based on the use of the passive voice whether the claim requires an active method step of “obtaining” a blood sample from one or more control subjects not having HCC. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-4, 10-12, 14-15, 42 and 47 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shen (Epigenetics. 2013. 8(1):34-43 and Supplemental Material) in view of Zhang (Hepatol Int. 2013. 7:893-900; previously cited). Regarding claims 1, 2 and 10, Shen teaches capturing DNA using a panel of probes in the Infinium Methylation 450K assay (p. 41, DNA preparation and Infinium Methylation 450K assay). The 450K assay includes probes for CpG sites within the recited genes as evidenced by the instant specification (para. 155, 157, 158, 163, 182, 183, 184, 185, 186 and 187). PNG media_image1.png 457 1290 media_image1.png Greyscale Shen measures increased frequency of methylation at the following CpG sites: The 5th column represents the difference between Mean Tumor methylation (3rd column) and Mean Adjacent Tissue methylation (4th column). The difference is positive demonstrating increased frequency of methylation in the tumors relative to the adjacent tissue. Shen does not teach the use of cfDNA. However, Zhang teaches the use cfDNA in serum the context of the 450K assay (p. 894, Patients and blood collection; and DNA isolation and bisulfite conversion), the same as the one used by Shen. It would have been prima facie obvious to the ordinary artisan to have modified the method of Shen by using cell-free DNA from the serum of subjects. One would have been motivated to do so because cfDNA is useful in cancer prediction (Zhang, p. 897, right column) and is well-known as a non-invasive sample that provides DNA representing a number of tissues and cells found within the body. There is a reasonable expectation of success as Shen demonstrates the sites are hypermethylated in tumors relative to normal tissue. Regarding claim 3, Shen uses the Infinium Methylation 450K assay as described, which includes probes for each of the cited cg positions recited in the claim. It is noted that the claim requires generically measuring methylation at those cites and does not require measuring an “increased frequency of methylation” at each site. Regarding claim 4, Shen does not teach reference blood samples from one or more control subjects not having HCC. However, Zhang teaches the use of serum from blood samples from individuals without cancer (Table 1). It would have been obvious to have substituted the tissue samples and adjacent tissues with the use of serum from patients and normal, healthy controls as taught by Zhang. The two samples and references represent obvious variants of one another as both respectively a source of DNA from tumors and a control sample representing healthy tissues. Regarding claim 11, the 450K assay includes probes for SPINT2, including the cg22522066 CpG site. The probe for the cg22522066 CpG site, as evidenced by the HumanMethylation450 v1.2 Manifest file is: CACAACTTTCATCACTTTATACTAAACTTCCRCTATCACTACTCTAAACC An alignment of SEQ ID NO: 289 and the 450K probe sequence is depicted below: SEQ ID NO: 289 atcataccct aattttctaa cgacccaacc tctaatccct aaacttaacc ttccccatca || 450K Probe CA SEQ ID NO: 289 caactttcat cactttatac taaacttccg ctatcactac tctaaaccgt tcctatttaa |||||||||| |||||||||| |||||||||| |||||||||| |||||||| 450K Probe CAACTTTCAT CACTTTATAC TAAACTTCCR CTATCACTAC TCTAAACC The claimed probed having the sequence of SEQ ID NO: 289 is an obvious variant of the 450K probe. The two probes are functionally equivalent as they both are used to detect the cg22522066 CpG site for determining the methylation status of that CpG site. Regarding claim 12, Shen teaches measuring AFP levels (p. 41, HCC subjects and specimens). The claim also provides information regarding how the measured may be used, but does not further limit how any of the steps are to be carried out. Regarding claims 14 and 15, Shen teaches the patients include those with hepatitis viral infections and/or cirrhosis (Table 1). PNG media_image1.png 457 1290 media_image1.png Greyscale Regarding claim 42, Shen teaches capturing DNA using a panel of probes in the Infinium Methylation 450K assay (p. 41, DNA preparation and Infinium Methylation 450K assay). The 450K assay includes probes for CpG sites within the recited genes as evidenced by the instant specification (para. 155, 157, 158, 163, 182, 183, 184, 185, 186 and 187). Shen measures increased frequency of methylation at the following CpG sites: The 5th column represents the difference between Mean Tumor methylation (3rd column) and Mean Adjacent Tissue methylation (4th column). The difference is positive demonstrating increased frequency of methylation in the tumors relative to the adjacent tissue. Shen does not teach the use of cfDNA. However, Zhang teaches the use cfDNA in serum the context of the 450K assay (p. 894, Patients and blood collection; and DNA isolation and bisulfite conversion), the same as the one used by Shen. It would have been prima facie obvious to the ordinary artisan to have modified the method of Shen by using cell-free DNA from the serum of subjects. One would have been motivated to do so because cfDNA is useful in cancer prediction (Zhang, p. 897, right column) and is well-known as a non-invasive sample that provides DNA representing a number of tissues and cells found within the body. There is a reasonable expectation of success as Shen demonstrates the sites are hypermethylated in tumors relative to normal tissue. Regarding claim 47, Shen does not teach the use of methylation-specific pyrosequencing. However, Zhang teaches the use of Bisulfite sequencing to validate methylation measurements. It would have been prima facie obvious to the ordinary artisan at the time of filing to have modified the method of Shen by analyzing methylation levels using bisulfite sequencing in order to validate measurements. Methylation-specify pyrosequencing is a well-known sequencing technique as demonstrated by para. 7 and 66 and 120 of the instant specification and is one of a number of functionally equivalent methods for methylation analysis. Conclusion No claims allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH G DAUNER whose telephone number is (571)270-3574. The examiner can normally be reached 7 am EST to 4:30 EST with second Fridays Off. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JOSEPH G. DAUNER/Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Jul 13, 2022
Application Filed
Dec 01, 2025
Non-Final Rejection mailed — §101, §103, §112
May 01, 2026
Response Filed
Jun 30, 2026
Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12668845
METHODS FOR PREDICTING DRUG RESPONSIVENESS IN CANCER PATIENTS
5y 7m to grant Granted Jun 30, 2026
Patent 12662501
Transcriptome In Vivo Analysis (TIVA) and Transcriptome In Situ Analysis (TISA)
2y 6m to grant Granted Jun 23, 2026
Patent 12655469
COMPOSITIONS AND METHODS FOR ANALYZING CELL-FREE DNA IN METHYLATION PARTITIONING ASSAYS
2y 4m to grant Granted Jun 16, 2026
Patent 12644152
HIGH THROUGHPUT ANALYSIS OF FIXED CELLS
4y 10m to grant Granted Jun 02, 2026
Patent 12601006
TARGETED, LONG-READ NUCLEIC ACID SEQUENCING FOR THE DETERMINATION OF CYTOSINE MODIFICATIONS
3y 8m to grant Granted Apr 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
57%
Grant Probability
92%
With Interview (+35.4%)
3y 2m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 729 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month