DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The claims filed 1/23/2023 are under consideration.
Election/Restrictions
Applicant’s election without traverse of Group I, claims 1-6, 11-12 and 14-15 in the reply filed on 9/22/2025 is acknowledged.
Claims 16, 26, 34, 38-39 and 46 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 9/22/2025.
Applicant’s election without traverse of SPINT2, cg22522066 and SEQ ID NO: 289 in the reply filed on 9/22/2025 is acknowledged.
Priority
The present application is a 371 national stage entry of PCT/US2021/013656 (filed 1/15/2021), which claims benefit of 62/962,437 (filed 1/17/2020).
Priority to 62/962,437 for the elected claims is recognized.
Information Disclosure Statement
The listing of references in the specification or the citation of references throughout the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or cited on a submitted IDS, they have not been considered.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-6, 10-12, 14 and 42 are rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exceptions without significantly more.
The claim(s) recite(s):
“wherein increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 in the cfDNA sample from the patient compared to reference value ranges for frequency of methylation at the one or more CpG sites in a control cfDNA sample indicates that the patient has a positive diagnosis for the HCC” (claim 1);
“wherein the reference value ranges for frequency of methylation at the one or more CpG sites are obtained from cfDNA from one or more blood samples from one or more control subjects not having HCC” (claim 4);
“calculating an HCC risk score based on the methylation frequency at the CpG sites in the SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 genes of the cfDNA using one or more algorithms” (claim 5);
“wherein detection of increased blood levels of AFP in combination with increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 compared to reference value ranges for blood levels of AFP and frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 for a control subject indicate that the patient has a positive diagnosis for the HCC” (claim 12); and
“wherein increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTPI, WIF1, SEPT9, HOXAJ, PFKP, and AK055957 in the cfDNA sample from the patient compared to reference value ranges for frequency of methylation at the one or more CpG sites in the cfDNA for a control cfDNA sample indicates that the patient has a positive diagnosis for the HCC” (claim 42).
In regards to claim element (a) identified above, the language states the natural relationship between increased methylation levels of the recited genes in cfDNA in patients with HCC and controls. This represents a natural phenomenon and is a judicial exception.
In regards to claim element (b) identified above, the language states the natural relationship between increased methylation levels of the recited genes in cfDNA in patients with HCC and controls not having HCC. This represents a natural phenomenon and is a judicial exception.
In regards to claim element (c) identified above, the language states an abstract idea in the form of mathematics that are used by the algorithms to “calculate” a score.
In regards to claim element (d) identified above, the language states the natural relationship between increased levels of AFP in patients with HCC and controls. This represents a natural phenomenon and is a judicial exception.
In regards to claim element (e) identified above, the language states the natural relationship between increased methylation levels of the recited genes in cfDNA in patients with HCC and controls. This represents a natural phenomenon and is a judicial exception.
The judicial exceptions are not integrated into a practical application because the claims do not involve:
improvements to the functioning of a computer or to any other technology or technical field;
applying or using the judicial exceptions to effect a particular treatment or prophylaxis for a disease or medical condition;
applying the judicial exception with, or by use of, a particular machine; or
effecting a transformation or reduction of a particular article to a different state or thing.
The claimed limitations add insignificant extra-solution activity to the judicial exceptions. Additional steps (a) and (b) relate to data gathering to provide information, for example to be entered in the algorithms of claim 5. While claim 1 further encompasses “treating the patient”, the step is not required in all embodiments. The step is only required “if the patient has the positive diagnosis for the HCC based on the frequency of methylation at the CpG sites”. The claim does not require making any diagnosis of the patient, and the claim is interpreted as making the step of “treating the patient” a conditional step. Furthermore, the treatment of claim 1 is generically recited and is not a “particular treatment or prophylaxis”.
The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims encompass the use of commercially available arrays that are well-known and used in a conventional manner as described in paragraphs 5, 99, 155 and 156 of the instant specification.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-6, 10-12, 14-15 and 42 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1-6, 10-12, 14-16, 26 and 42 encompass embodiments in which patients are given a “positive diagnosis of the HCC”. The claim broadly encompasses making this diagnosis based on increased methylation in any CpG sites in SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 and any CpG sites within 200 nucleotides of cg15607538, cg08572734, cg00577935, cg03667968, cg08571859, cg02659086, cg04673590, cg09420439, cg26744375, cg08465862, cg14250130, cg00922376, cg05346841, cg26421310, cg13629563, cg06848185, cg17300544, cg22522066, cg24166864, and cg26397188.
The instant specification used methylation frequency data from the Illumina HumanMethylation450 (450K) microarray (para. 155, 157, 158, 163, 182, 183, 184, 185, 186 and 187). The 450K microarray screens for numerous CpG sites within the SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 genes. The specification lists 20 CpG identified as a cfDNA biomarker panel in Table 2. The instant specification also states :
“While excluded genes show differential methylation in their studies, this effect was not shown in the 450K data, suggesting that these genes may not be population-wide predictors of HCC in cirrhosis patients.” (para. 157); and
CpGs with an AUC less than 0.8 from a univariate logistic regression model were discarded (Table 2)” (para. 184).
The specification demonstrates a lack of possession of CpG biomarker sites that are usable to indicate a positive diagnosis of HCC included in the 450K microarray other than cg15607538, cg08572734, cg00577935, cg03667968, cg08571859, cg02659086, cg04673590, cg09420439, cg26744375, cg08465862, cg14250130, cg00922376, cg05346841, cg26421310, cg13629563, cg06848185, cg17300544, cg22522066, cg24166864, and cg26397188. The specification explicitly describes analyzing the methylation frequency of all CpG sites screened using the 450K microarray, discarded a majority of them as not being useful for diagnosing HCC and identified only the above recited CpG sites as biomarkers for HCC. As such, the specification demonstrates a non-interest in all of the CpG sites screened by the 450K microarray.
Claims 1-6, 10-12, 14-15 and 42 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
Claims 1-6, 10-12, 14-16, 26 and 42 encompass embodiments in which patients are given a “positive diagnosis of the HCC”.
As described above, the specification explicitly describes analyzing the methylation frequency of all CpG sites screened using the 450K microarray, discarding a majority of them as not being useful for diagnosing HCC and identified only the above recited CpG sites as biomarkers for HCC that can be used in the claimed methods to diagnosis a patient with HCC.
There is no reasonable expectation of additional CpG sites being present in the SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 genes that are enabled for use in embodiments that require diagnosing a patient as having HCC in view of the analysis presented in the instant specification.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-6, 10-12, 14-15 and 42 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, it is not clear how the recited preamble is intended to breathe life and meaning into the claims. The preamble of the claim recites a “method of diagnosing and treating hepatocellular carcinoma (HCC) in a patient”. However, the method steps in the claim only require: obtaining a circulating free DNA (cfDNA) sample from the patient; and detecting methylation at one or more CpG sites in one or more genes of the cfDNA, and includes a conditional step of “treating the patient for the HCC, if the patient has the positive diagnosis for the HCC based on the frequency of methylation at the CpG sites”. Thus, it is unclear if applicant intends to cover any method of obtaining cfDNA from patient and detecting methylation in the recited genes, or if the method is intended to somehow require more to accomplish the goal set forth in the preamble, in particular as it relates to the aspect of “diagnosing”. If it is the later, then it appears that the claims are incomplete, as they fail to provide any active steps that clearly accomplish the goal of “diagnosing” HCC in a patient as set forth in the preamble of the claim. Amending the claim to include active process steps directed towards observing increased methylation frequency of at least one of the recited genes and diagnosing the patient has having HCC based on the observation may overcome this rejection. Claims 2-6, 10-12 and 14-15 are similarly indefinite because they directly or indirectly depend from claim 1.
Regarding claim 42, it is not clear how the recited preamble is intended to breathe life and meaning into the claims. The preamble of the claim recites an “in vitro method of diagnosing hepatocellular carcinoma (HCC) in a patient”. However, the method steps in the claim only require: obtaining a circulating free DNA (cfDNA) sample from the patient; and detecting methylation at one or more CpG sites in one or more genes of the cfDNA. Thus, it is unclear if applicant intends to cover any method of obtaining cfDNA from patient and detecting methylation in the recited genes, or if the method is intended to somehow require more to accomplish the goal set forth in the preamble, in particular as it relates to the aspect of “diagnosing”. If it is the later, then it appears that the claims are incomplete, as they fail to provide any active steps that clearly accomplish the goal of “diagnosing” HCC in a patient as set forth in the preamble of the claim. Amending the claim to include active process steps directed towards observing increased methylation frequency of at least one of the recited genes as compared to frequency of methylation for a control cfDNA sample and diagnosing the patient has having HCC based on the observation may overcome this rejection.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 4 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding claim 4, the claim further describes the reference value ranges detailed in claim 1. Claims 1 and 4 do not require active method steps utilizing the reference value ranges. Claim 4 does not further limit claim 1 because it does not further limit how the active method steps required by claim 1 are performed.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 2, 3, 4, 10, 14 and 15 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Zhang (Hepatol Int. 2013. 7:893-900) as evidenced by UCSC Genome Browser (retrieved on 10/30/2025 from the internet: https://genome.ucsc.edu/).
Claim 1 is drawn to a method of “diagnosing and treating hepatocellular carcinoma (HCC) in a patient”. However, the active method steps do not explicitly require “diagnosing” HCC and sets forth a conditional step of “treating” HCC. MPEP 2111.02 states:
If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention's limitations, then the preamble is not considered a limitation and is of no significance to claim construction.
Accordingly, the claim language of "diagnosing and treating hepatocellular carcinoma (HCC) in a patient" merely sets forth the intended use or purpose of the claimed methods, but does not limit the scope of the claims. The claims are given the broadest reasonable interpretation as requiring the two following active method steps in view of the elected species:
a) obtaining a circulating free DNA (cfDNA) sample from the patient; and
b) detecting methylation at one or more CpG sites in one or more genes of the cfDNA, wherein the one or more genes is SPINT2.
Regarding claims 1, 2, 3, 10, 14 and 15, Zhang teaches obtaining cfDNA samples from the serum of HCC patients with chronic hepatitis B virus infection, as a liver disease (p. 894, Patients and blood collection; and DNA isolation and bisulfite conversion).
Zhang teaches detecting methylation of CpG sites in the cfDNA using Human methylation 450K assay (p. 894, Human methylation 450K assay), a bisulfite microarray analysis.
The 450K assay includes probes for SPINT2, including the cg22522066 CpG site, as evidenced by the UCSC Genome Browser (retrieved on 10/30/2025 from the internet: https://genome.ucsc.edu/).
The claim includes a “wherein” clause stating “increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 in the cfDNA sample from the patient compared to reference value ranges for frequency of methylation at the one or more CpG sites in a control cfDNA sample indicates that the patient has a positive diagnosis for the HCC”. The clause sets forth an intended use of the detected methylation of SPINT2 that is the consequence of the natural property of methylation frequencies of SPINT2 as it relates to HCC. The clause does not limit how the step of “detecting methylation” is performed and the property set forth does not need to be recognized by the prior art. See MPEP 2112.II.
The claim further sets forth a conditional step of “treating the patient for HCC”. The step is conditioned on the patient having a “positive diagnosis for the HCC based on the frequency of methylation at the CpG sites”. The claim does not require any active method step of “diagnosing” the patient and broadly encompasses embodiments in which the “treating” step is not performed because no “positive diagnosis for the HCC” based on the detected methylation in SPINT2 was made.
Zhang anticipates the broad scope of claims 1, 2, 3, 10, 14 and 15, in particular embodiments in which the conditional step (c) of “treating the patient” is not performed because the condition specified in the step is not satisfied.
Regarding claim 4, the claim further describes the intended use of the detected methylation of SPINT2, but does further limit the active method steps required by claim 1. Claim 4 is anticipated by Zhang for the same reason as claim 1.
Regarding claim 5, Zhang teaches calculating a “HCC risk score” based on the methylation detected, including for SPINT2 using Mann-Whitney U testing in the Linear Models for Microarray Analysis (p. 894, Statistical analysis; Fig. 1; and Fig. 5).
Regarding claim 6, the claim further limits the conditional step (c) of “treating the patient”. Zhang anticipates the broad scope of claim 6, in particular embodiments in which the conditional step (c) of “treating the patient” is not performed because the condition specified in the step is not satisfied.
Claim 42 is drawn to “An in vitro method of diagnosing hepatocellular carcinoma (HCC) in a patient”. However, the active method steps do not explicitly require “diagnosing” HCC and sets forth a conditional step of “treating” HCC. MPEP 2111.02 states:
If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention's limitations, then the preamble is not considered a limitation and is of no significance to claim construction.
Accordingly, the claim language of "diagnosing and treating hepatocellular carcinoma (HCC) in a patient" merely sets forth the intended use or purpose of the claimed methods, but does not limit the scope of the claims. The claims are given the broadest reasonable interpretation as requiring the two following active method steps in view of the elected species:
obtaining a circulating free DNA (cfDNA) sample from the patient; and
b) detecting methylation at one or more CpG sites in one or more genes of the cfDNA, wherein the one or more genes is SPINT2.
Regarding claim 42, Zhang teaches obtaining a cfDNA samples from the serum of HCC patients with chronic hepatitis B virus infection, as a liver disease (p. 894, Patients and blood collection; and DNA isolation and bisulfite conversion).
Zhang teaches detecting methylation of CpG sites in the cfDNA using Human methylation 450K assay (p. 894, Human methylation 450K assay), a bisulfite microarray analysis.
The 450K assay includes probes for SPINT2 as evidenced by the UCSC Genome Browser (retrieved on 10/30/2025 from the internet: https://genome.ucsc.edu/).
The claim includes a “wherein” clause stating “increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTPI, WIF1, SEPT9, HOXAJ, PFKP, and AK055957 in the cfDNA sample from the patient compared to reference value ranges for frequency of methylation at the one or more CpG sites in the cfDNA for a control cfDNA sample indicates that the patient has a positive diagnosis for the HCC”. The clause sets forth an intended use of the detected methylation of SPINT2 that is the consequence of the natural property of methylation frequencies of SPINT2 as it relates to HCC. The clause does not limit how the step of “detecting methylation” is performed and the property set forth does not need to be recognized by the prior art. See MPEP 2112.II.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 11 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang (Hepatol Int. 2013. 7:893-900) as evidenced by UCSC Genome Browser (retrieved on 10/30/2025 from the internet: https://genome.ucsc.edu/) and HumanMethylation450 v1.2 Manifest file (retrieved on 10/30/2025 from the internet: https://support.illumina.com/downloads/infinium_humanmethylation450_product_files.html).
Claim 11 is drawn to a method of “diagnosing and treating hepatocellular carcinoma (HCC) in a patient”. However, the active method steps do not explicitly require “diagnosing” HCC and sets forth a conditional step of “treating” HCC. MPEP 2111.02 states:
If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention's limitations, then the preamble is not considered a limitation and is of no significance to claim construction.
Accordingly, the claim language of "diagnosing and treating hepatocellular carcinoma (HCC) in a patient" merely sets forth the intended use or purpose of the claimed methods, but does not limit the scope of the claims. The claims are given the broadest reasonable interpretation as requiring the two following active method steps in view of the elected species:
a) obtaining a circulating free DNA (cfDNA) sample from the patient; and
b) detecting methylation at one or more CpG sites in one or more genes of the cfDNA, wherein the one or more genes is SPINT2.
Regarding claim 11, Zhang teaches obtaining a cfDNA samples from the serum of HCC patients with chronic hepatitis B virus infection, as a liver disease (p. 894, Patients and blood collection; and DNA isolation and bisulfite conversion).
Zhang teaches detecting methylation of CpG sites in the cfDNA using Human methylation 450K assay (p. 894, Human methylation 450K assay), a bisulfite microarray analysis.
The 450K assay includes probes for SPINT2, including the cg22522066 CpG site, as evidenced by the UCSC Genome Browser.
The probe for the cg22522066 CpG site, as evidenced by the HumanMethylation450 v1.2 Manifest file is:
CACAACTTTCATCACTTTATACTAAACTTCCRCTATCACTACTCTAAACC
An alignment of SEQ ID NO: 289 and the 450K probe sequence is depicted below:
SEQ ID NO: 289 atcataccct aattttctaa cgacccaacc tctaatccct aaacttaacc ttccccatca
||
450K Probe CA
SEQ ID NO: 289 caactttcat cactttatac taaacttccg ctatcactac tctaaaccgt tcctatttaa
|||||||||| |||||||||| |||||||||| |||||||||| ||||||||
450K Probe CAACTTTCAT CACTTTATAC TAAACTTCCR CTATCACTAC TCTAAACC
The claimed probed having the sequence of SEQ ID NO: 289 is an obvious variant of the 450K probe. The two probes are functionally equivalent as they both are used to detect the cg22522066 CpG site for determining the methylation status of that CpG site.
The claim includes a “wherein” clause stating “increased frequency of methylation at the one or more CpG sites in the one or more genes selected from the group consisting of SPINT2, RUNX3, PRDM2, APC, GSTP1, WIF1, SEPT9, HOXA1, PFKP, and AK055957 in the cfDNA sample from the patient compared to reference value ranges for frequency of methylation at the one or more CpG sites in a control cfDNA sample indicates that the patient has a positive diagnosis for the HCC”. The clause sets forth an intended use of the detected methylation of SPINT2 that is the consequence of the natural property of methylation frequencies of SPINT2 as it relates to HCC. The clause does not limit how the step of “detecting methylation” is performed and the property set forth does not need to be recognized by the prior art. See MPEP 2112.II.
The claim further sets forth a conditional step of “treating the patient for HCC”. The step is conditioned on the patient having a “positive diagnosis for the HCC based on the frequency of methylation at the CpG sites”. The claim does not require any active method step of “diagnosing” the patient and broadly encompasses embodiments in which the “treating” step is not performed because no “positive diagnosis for the HCC” based on the detected methylation in SPINT2 was made.
Zhang renders obvious the broad scope of claim 42, in particular embodiments in which the conditional step (c) of “treating the patient” is not performed because the condition specified in the step is not satisfied.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH G DAUNER whose telephone number is (571)270-3574. The examiner can normally be reached 7 am EST to 4:30 EST with second Fridays Off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOSEPH G. DAUNER/ Primary Examiner, Art Unit 1682