Prosecution Insights
Last updated: April 18, 2026
Application No. 17/792,961

TREATMENT OF MUCOPOLYSACCHARIDOSIS II WITH RECOMBINANT HUMAN IDURONATE-2-SULFATASE (IDS) PRODUCED BY HUMAN NEURAL OR GLIAL CELLS

Final Rejection §103§DP
Filed
Jul 14, 2022
Examiner
KIM, TAEYOON
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Regenxbio Rs LLC
OA Round
3 (Final)
52%
Grant Probability
Moderate
4-5
OA Rounds
3y 11m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
450 granted / 874 resolved
-8.5% vs TC avg
Strong +51% interview lift
Without
With
+51.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
74 currently pending
Career history
948
Total Applications
across all art units

Statute-Specific Performance

§101
4.8%
-35.2% vs TC avg
§103
34.9%
-5.1% vs TC avg
§102
15.4%
-24.6% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 874 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment and response filed on 1/29/2026 has been received and entered into the case. Claims 3, 5-8, 10, 14, 16, 20, 22-23, 26-27, 29-30, 33-39 have been canceled, claims 43-53 are newly added, and claims 1-2, 4, 9, 11-13, 15, 17-19, 21, 24-25, 28, 31-32, 40-53 have been considered on the merits. All arguments have been considered. Claim Objections Claim 47 is objected to because of the following informalities: The term “IC” and “ICV” should be in a full name followed by the abbreviation in the parenthesis. Appropriate correction is required. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-2, 4, 9, 11-13, 15, 17-19, 21, 24-25, 28, 31-32 and 40-50 is/are rejected under 35 U.S.C. 103 as being unpatentable over Yoo et al. (WO2018/191666; IDS ref.) in view of Steen et al. (2007, AJNR Am J Neuroradiol 28:1119 –25; of record), Lim et al. (2018, Journal of Forensic Radiology and Imaging; of record) and Tissue Properties (2019, IT’IS Foundation; of record) and as evidenced by Huff et al. (Neuroanatomy, Cerebrospinal Fluid; updated 8/28/2023; of record). Yoo et al. teach a method of treating mucopolysaccharidosis II (MPS II) with recombinant human iduronate-2 sulfatase (rIDS) by administering a viral vector encoding human IDS to a human subject diagnosed with MPSII (para. 12). Yoo et al. teach administering a viral vector to the CSF of a patient (para. 12). Regarding the dose of a recombinant expression vector encoding the rIDS determined by brain MRI of the human subject’s brain mass, Yoo et al. teach that the total dose of AAV vector administered depends on the assumed brain mass across the different age strata (para. 48). However, Yoo et al. do not particularly teach that the brain mass is determined by MRI. It is well known in the art that brain volume can be determined by MRI according to Steen et al. (see entire document). Furthermore, it is known in the art that brain mass can be converted by multiplying the volume of brain using a specific density (specific gravity conversion factor) of a brain according to Lim et al. (p.1, Materials and methods). It would have been obvious to a person skilled in the art to estimate the brain weight by using MRI taught by Lim et al. for the dose taught by Yoo et al. As Yoo et al. teach that the total dose of the AAV vector is dependent on the brain mass, and Lim et al. teach that the brain mass can be determined by MRI, one skilled in the art would carry out a brain MRI of the human patient to determine the brain mass and then based on the brain mass, the total dose of AAV vector taught by Yoo et al. would be determined, and administered to the human patient with a reasonable expectation of success. The combined teachings of Yoo et al in view of Lim et al. would also meet the limitations of claims 40-41 as discussed above. Regarding the limitation directed to the administration volume not exceeding 10% of the total CSF of the human subject (claim 1, previously claim 23: now canceled), Yoo et al. do not particularly disclose the limitation. However, Yoo et al. teach the injection volume is about 5-20 ml (para. 136), and at the same time, Yoo et al. teach that the total volume of product administered will not exceed 5 ml (para. 149 and 190). Considering a typical volume of CSF of human is estimated about 125-150 ml according to Neuroanatomy, CSF (Introduction), the 5 ml of injection volume taught by Yoo et al. inherently meets the limitation of no exceeding 10% of the total CSF volume of the human subject. Regarding claim 2, Yoo et al. teach that the rhIDS is secreted from the neuronal/glial cell depot into the CSF will be endocytosed by cells in the CNS (para. 12); the hIDS transgene is produced by the expression control element including CB7 promoter (para. 17, 19, 44, 112); the hIDS glycoprotein precursor of about 90 kDa measured by polyacrylamide gel electrophoresis being secreted (para. 25(iv) at p.10). Regarding claim 9, the wherein clause is directed to the rIDS produced upon the administration of the expression vector to a human subject, and thus, the produced rIDS in the human subject would inherently contain the feature as claimed. Regarding claims 11 and 43-46 directed to rAAV is a recombinant AAV9 or AAVrh10, Yoo et al. teach the limitation (para. 18, 121, 246; Example 1). Regarding claim 12 directed to the brain mass being converted from the brain volume by multiplying by a factor of 1.046 g/cm3, Yoo et al. in view of Lim et al. do not particularly teach the factor. However, the wherein clause of claim 12 is not considered as an active step, rather it is a mental step of calculating or estimating the brain mass using a brain volume determined by MRI and this does not require any active step to carry out the claimed method of treating a human subject having MPS II. Thus, the wherein clause of claim 12 does not limit the claimed method. Regardless, the factor as claimed is known in the art according to Tissue Properties: Density. According to the Tissue Properties: Density, it discloses that the specific density of brain is 1.046 kg/m3 (g/cm3). While Lim et al. teach that the specific density of brain utilized for the conversion of brain volume to brain mass is 1.08 g/cm3, however, it would have been obvious to use another known specific density of human brain to convert the brain volume measured by MRI to brain mass with a reasonable expectation of success. Regarding the dose disclosed in claim 13, in the tables of claim 17 or 19, Yoo et al. teach the dose 1 at 1.3x1010 GC/g brain mass (dose 1) and at 6.5x1010 GC/g brain mass (dose 2) (para. 149 or 156). The total dose taught by Yoo et al. in para. 49 teaches that the dose(s) for the brain mass of 1300 g as 1.7x1013 (dose 1) or 8.5x 1013 GC/g brain mass (dose 2), and this value is identical to the dose for brain mass 1201 and up in the tables of claims 17 and 19. Regarding the human subject being 5 years old or older and less than 18 years old (claim 15), or 4 months old or older and less than 5 years old (claim 18), Yoo et al. teach that the therapeutically effective doses of the recombinant vector are administered to patients that are aged 8 to 16 years old or the patients are aged 2 to 4 years old (para. 131). Regarding claim 21, Yoo et al. teach that the expression vector is administered via intracisternal administration (para. 70). Regarding claim 24, the wherein clause is not considered as an active step of carrying out the delivery. Rather the neuronal or glial cells transduced by the vector would inherently release the recombinant enzyme into the CSF. Thus, the method of Yoo et al. teaching administering a viral vector to the CSF of a patient (para. 12) is expected to the same release of the enzyme as claimed. Regarding claim 28 directed to antibiotics before or concurrently with the immune suppression therapy, Yoo et al. teach the use of rapamycin as an immunosuppressive agent, which is also an antibiotics (para. 30). Thus, the use of rapamycin would meet the limitation of concurrent use of immune suppression therapy and antibiotics. Regarding claim 31 directed to a step of measuring biomarkers after administration including the level of IDS (I2S) in plasma, CSF or urine, Yoo et al. teach to evaluate biomarkers in CSF (GAGs, I2S activity), plasma (GAGs, I2S activity) and urine (GAGs) (para. 163), or vector shedding in CSF, plasma and urine (para. 152 and 160). Regarding claim 42 directed to continuing the immunosuppressive therapy, Yoo et al. teach that immune suppression therapy can be continued subsequent to the gene therapy treatment (para. 30). Regarding claim 47-48 directed to intracisternal (IC) or intracerebroventricular (ICV) injection, Yoo et al. teach IC injection or ICV administration (para. 21). Regarding claims 25 and 49-50 directed to the method further comprising administering an immunosuppressive therapy to the human subject starting before or concurrently with the first administration of the recombinant expression vector, Yoo et al. teach immunosuppressive therapy administered in the morning of vector administration (day 1 predose) (para. 197), and this teaching is considered to meet “before” the first administration of the AAV9 expressing rIDS. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 32 is/are rejected under 35 U.S.C. 103 as being unpatentable over Yoo et al. in view of Steen et al., Lim et al. and Tissue Properties as applied to claims 1 and 31 above, and further in view of Chung et al. (2014, Glycoconjugate Journal; IDS ref.). Regarding claim 32 directed to the GAGs in claim 31 being heparan sulfate, Yoo et al. do not particularly teach the limitation. However, GAGs, i.e. glycosaminoglycans, accumulated in the patient suffering from MPS II due to the lack of IDS enzyme include heparan sulfate and dermatan sulfate according to Chung et al. (Abstract; Introduction). It would have been obvious to a person skilled in the art to measure GAGs including heparan sulfate from the human patient treated with the rIDS expressing AAV vector taught by Yoo et al. with a reasonable expectation of success. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 51-53 is/are rejected under 35 U.S.C. 103 as being unpatentable over Yoo et al. in view of in view of Steen et al., Lim et al. and Tissue Properties as applied to claims 1 and 40-41 above, and further in view of Hinderer et al. (US2019/0070311 A1; IDS ref.) Regarding claims 51-53 directed to the SEQ ID NO:45, Yoo et al. in view of in view of Steen et al., Lim et al. and Tissue Properties do not teach the limitation. Hinderer et al. teach a gene therapy for treating mucopolysaccharidosis type II using AAV9 expressing human IDS gene (Abstract). Hinderer et al. teach the SEQ ID NO: 3 (para. 252) and this sequence is 100% identical to the SEQ ID NO:45 of the instant claims (see alignment below). It would have been obvious to a person skilled in the art to use the nucleic acid sequence encoding hIDS taught by Hinderer et al. for the AAV9 vector encoding hIDS of the method taught by Yoo et al. with a reasonable expectation of success. RESULT 1 US-16-093-413-3 (NOTE: this sequence has 2 duplicates in the database searched) Sequence 3, US/16093413 Patent No. 11253612 Query Match 100.0%; Score 3967; Length 3967; Best Local Similarity 100.0%; Matches 3967; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTT 60 Qy 61 TGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCAC 120 Qy 121 TAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACCAGGGTAATGGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACCAGGGTAATGGG 180 Qy 181 GATCCTCTAGAACTATAGCTAGTCGACATTGATTATTGACTAGTTATTAATAGTAATCAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GATCCTCTAGAACTATAGCTAGTCGACATTGATTATTGACTAGTTATTAATAGTAATCAA 240 Qy 241 TTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAA 300 Qy 301 ATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATG 360 Qy 361 TTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGT 420 Qy 421 AAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACG 480 Qy 481 TCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC 540 Qy 541 CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCA 600 Qy 601 CGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 CGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTA 660 Qy 661 TTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCG 720 Qy 721 GGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 GGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATC 780 Qy 781 AGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 AGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATA 840 Qy 841 AAAAGCGAAGCGCGCGGCGGGCGGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 AAAAGCGAAGCGCGCGGCGGGCGGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCG 900 Qy 901 CTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGT 960 Qy 961 GAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 GAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCT 1020 Qy 1021 TGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGG 1080 Qy 1081 GGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTC 1140 Qy 1141 CGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAG 1200 Qy 1201 TGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGG 1260 Qy 1261 GAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTC 1320 Qy 1321 GGTCGGGCTGCAACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 GGTCGGGCTGCAACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTC 1380 Qy 1381 GGGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 GGGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCG 1440 Qy 1441 GCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGG 1500 Qy 1501 GCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCT 1560 Qy 1561 TTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGCC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGCC 1620 Qy 1621 GAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 GAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGC 1680 Qy 1681 CGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 CGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCT 1740 Qy 1741 CCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAG 1800 Qy 1801 GGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 GGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCA 1860 Qy 1861 TGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCA 1920 Qy 1921 TTTTGGCAAAGAATTCATGCCGCCACCCCGGACCGGCCGAGGCCTTCTCTGGCTGGGTCT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTTTGGCAAAGAATTCATGCCGCCACCCCGGACCGGCCGAGGCCTTCTCTGGCTGGGTCT 1980 Qy 1981 GGTTCTGAGCTCCGTCTGCGTCGCCCTCGGATCCGAAACGCAGGCCAACTCGACCACAGA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 GGTTCTGAGCTCCGTCTGCGTCGCCCTCGGATCCGAAACGCAGGCCAACTCGACCACAGA 2040 Qy 2041 TGCTCTGAACGTTCTTCTCATCATCGTGGATGACCTGCGCCCCTCCCTGGGCTGTTATGG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 TGCTCTGAACGTTCTTCTCATCATCGTGGATGACCTGCGCCCCTCCCTGGGCTGTTATGG 2100 Qy 2101 GGATAAGCTGGTGAGGTCCCCAAATATTGACCAACTGGCATCCCACAGCCTCCTCTTCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 GGATAAGCTGGTGAGGTCCCCAAATATTGACCAACTGGCATCCCACAGCCTCCTCTTCCA 2160 Qy 2161 GAATGCCTTTGCGCAGCAAGCAGTGTGCGCCCCGAGCCGCGTTTCTTTCCTCACTGGCAG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 GAATGCCTTTGCGCAGCAAGCAGTGTGCGCCCCGAGCCGCGTTTCTTTCCTCACTGGCAG 2220 Qy 2221 GAGACCTGACACCACCCGCCTGTACGACTTCAACTCCTACTGGAGGGTGCACGCTGGAAA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 GAGACCTGACACCACCCGCCTGTACGACTTCAACTCCTACTGGAGGGTGCACGCTGGAAA 2280 Qy 2281 CTTCTCCACCATCCCCCAGTACTTCAAGGAGAATGGCTATGTGACCATGTCGGTGGGAAA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 CTTCTCCACCATCCCCCAGTACTTCAAGGAGAATGGCTATGTGACCATGTCGGTGGGAAA 2340 Qy 2341 AGTCTTTCACCCTGGGATATCTTCTAACCATACCGATGATTCTCCGTATAGCTGGTCTTT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 AGTCTTTCACCCTGGGATATCTTCTAACCATACCGATGATTCTCCGTATAGCTGGTCTTT 2400 Qy 2401 TCCACCTTATCATCCTTCCTCTGAGAAGTATGAAAACACTAAGACATGTCGAGGGCCAGA 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 TCCACCTTATCATCCTTCCTCTGAGAAGTATGAAAACACTAAGACATGTCGAGGGCCAGA 2460 Qy 2461 TGGAGAACTCCATGCCAACCTGCTTTGCCCTGTGGATGTGCTGGATGTTCCCGAGGGCAC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 TGGAGAACTCCATGCCAACCTGCTTTGCCCTGTGGATGTGCTGGATGTTCCCGAGGGCAC 2520 Qy 2521 CTTGCCTGACAAACAGAGCACTGAGCAAGCCATACAGTTGTTGGAAAAGATGAAAACGTC 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CTTGCCTGACAAACAGAGCACTGAGCAAGCCATACAGTTGTTGGAAAAGATGAAAACGTC 2580 Qy 2581 AGCCAGTCCTTTCTTCCTGGCCGTTGGGTATCATAAGCCACACATCCCCTTCAGATACCC 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 AGCCAGTCCTTTCTTCCTGGCCGTTGGGTATCATAAGCCACACATCCCCTTCAGATACCC 2640 Qy 2641 CAAGGAATTTCAGAAGTTGTATCCCTTGGAGAACATCACCCTGGCCCCCGATCCCGAGGT 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 CAAGGAATTTCAGAAGTTGTATCCCTTGGAGAACATCACCCTGGCCCCCGATCCCGAGGT 2700 Qy 2701 CCCTGATGGCCTACCCCCTGTGGCCTACAACCCCTGGATGGACATCAGGCAACGGGAAGA 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 CCCTGATGGCCTACCCCCTGTGGCCTACAACCCCTGGATGGACATCAGGCAACGGGAAGA 2760 Qy 2761 CGTCCAAGCCTTAAACATCAGTGTGCCGTATGGTCCAATTCCTGTGGACTTTCAGCGGAA 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 CGTCCAAGCCTTAAACATCAGTGTGCCGTATGGTCCAATTCCTGTGGACTTTCAGCGGAA 2820 Qy 2821 AATCCGCCAGAGCTACTTTGCCTCTGTGTCATATTTGGATACACAGGTCGGCCGCCTCTT 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 AATCCGCCAGAGCTACTTTGCCTCTGTGTCATATTTGGATACACAGGTCGGCCGCCTCTT 2880 Qy 2881 GAGTGCTTTGGACGATCTTCAGCTGGCCAACAGCACCATCATTGCATTTACCTCGGATCA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 GAGTGCTTTGGACGATCTTCAGCTGGCCAACAGCACCATCATTGCATTTACCTCGGATCA 2940 Qy 2941 TGGGTGGGCTCTAGGTGAACATGGAGAATGGGCCAAATACAGCAATTTTGATGTTGCTAC 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 TGGGTGGGCTCTAGGTGAACATGGAGAATGGGCCAAATACAGCAATTTTGATGTTGCTAC 3000 Qy 3001 CCATGTTCCCCTGATATTCTATGTTCCTGGAAGGACGGCTTCACTTCCGGAGGCAGGCGA 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 CCATGTTCCCCTGATATTCTATGTTCCTGGAAGGACGGCTTCACTTCCGGAGGCAGGCGA 3060 Qy 3061 GAAGCTTTTCCCTTACCTCGACCCTTTTGATTCCGCCTCACAGTTGATGGAGCCAGGCAG 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 GAAGCTTTTCCCTTACCTCGACCCTTTTGATTCCGCCTCACAGTTGATGGAGCCAGGCAG 3120 Qy 3121 GCAATCCATGGACCTTGTGGAACTTGTGTCTCTTTTTCCCACGCTGGCTGGACTTGCAGG 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 GCAATCCATGGACCTTGTGGAACTTGTGTCTCTTTTTCCCACGCTGGCTGGACTTGCAGG 3180 Qy 3181 ACTGCAGGTTCCACCTCGCTGCCCCGTTCCTTCATTTCACGTTGAGCTGTGCAGAGAAGG 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 ACTGCAGGTTCCACCTCGCTGCCCCGTTCCTTCATTTCACGTTGAGCTGTGCAGAGAAGG 3240 Qy 3241 CAAGAACCTTCTGAAGCATTTTCGATTCCGTGACTTGGAAGAGGATCCGTACCTCCCTGG 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 CAAGAACCTTCTGAAGCATTTTCGATTCCGTGACTTGGAAGAGGATCCGTACCTCCCTGG 3300 Qy 3301 TAATCCCCGTGAACTGATTGCCTATAGCCAGTATCCCCGGCCTTCAGACATCCCTCAGTG 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 TAATCCCCGTGAACTGATTGCCTATAGCCAGTATCCCCGGCCTTCAGACATCCCTCAGTG 3360 Qy 3361 GAATTCTGACAAGCCGAGTTTAAAAGATATAAAGATCATGGGCTATTCCATACGCACCAT 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 GAATTCTGACAAGCCGAGTTTAAAAGATATAAAGATCATGGGCTATTCCATACGCACCAT 3420 Qy 3421 AGACTATAGGTATACTGTGTGGGTTGGCTTCAATCCTGATGAATTTCTAGCTAACTTTTC 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 AGACTATAGGTATACTGTGTGGGTTGGCTTCAATCCTGATGAATTTCTAGCTAACTTTTC 3480 Qy 3481 TGACATCCATGCAGGGGAACTGTATTTTGTGGATTCTGACCCATTGCAGGATCACAATAT 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 TGACATCCATGCAGGGGAACTGTATTTTGTGGATTCTGACCCATTGCAGGATCACAATAT 3540 Qy 3541 GTATAATGATTCCCAAGGTGGAGATCTTTTCCAGTTGTTGATGCCTTGACTCGAGGACGG 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 GTATAATGATTCCCAAGGTGGAGATCTTTTCCAGTTGTTGATGCCTTGACTCGAGGACGG 3600 Qy 3601 GGTGAACTACGCCTGAGGATCCGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCAT 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 GGTGAACTACGCCTGAGGATCCGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCAT 3660 Qy 3661 GAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGT 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 GAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGT 3720 Qy 3721 GTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGCAATTCGTTGATCTGAATTTCGACCAC 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 GTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGCAATTCGTTGATCTGAATTTCGACCAC 3780 Qy 3781 CCATAATACCCATTACCCTGGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGG 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3781 CCATAATACCCATTACCCTGGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGG 3840 Qy 3841 AACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCG 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3841 AACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCG 3900 Qy 3901 GGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAG 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3901 GGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAG 3960 Qy 3961 CGCGCAG 3967 ||||||| Db 3961 CGCGCAG 3967 Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2, 4, 9, 11-13, 15, 17-19, 21, 24-25, 28, 31-32 and 40-53 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of U.S. Patent No. 11,613,739 in view of Yoo et al. (supra), Tissue Properties (supra), Lim et al. (supra), Chung et al. (supra) and Hinderer et al. (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘739 patent disclose a method of treating a human subject diagnosed with MPS II by delivering to the cerebrospinal fluid (CSF) of the brain of the human subject a therapeutically effective amount of a glycosylated recombinant human iduronate-2-sulfatase (IDS) precursor produced by the human subject's neuronal or human glial cells transduced with a recombinant adeno-associated virus (AAV) vector carrying an expression cassette encoding the IDS precursor, by a single dose administration of the recombinant AAV vector via intracisternal (IC) injection or intracerebroventricular (ICV) injection to the human subject (RE: claims 1, 4). Regarding the limitation directed to the administration volume not exceeding 10% of the total CSF of the human subject (claim 1), the claims of the ‘739 patent do not particularly disclose the limitation. However, Yoo et al. teach the injection volume of an expression vector encoding rIDS into CSF is about 5-20 ml (para. 136), and at the same time, Yoo et al. teach that the total volume of product administered will not exceed 5 ml (para. 149 and 190). It would have been obvious to a person skilled in the art to use the volume suggested by Yoo et al. for the method of the ‘739 patent. Combining the teaching of Yoo, the volume, e.g. 5 ml, of the expression vector of the ‘739 patent would be less than 10% of a total human CSF volume as claimed. The claims of the ‘739 patent disclose that the glycosylated recombinant human IDS precursor, is about 90 kDa as measured by polyacrylamide gel electrophoresis (RE: claim 2). Regarding claim 9, the limitation is directed to the results of the rIDS produced by a human cell, and thus, the rIDS of the ‘739 patent would have the identical feature as claimed. Regarding claim 11, the claims of the ‘739 patent disclose that the recombinant AAV comprises an AAV9 capsid protein or AAVrh10 capsid protein. Regarding the dose and the determining the dose based on the brain mass converted from the MRI-determined brain volume by multiplying the factor of 1.046 g/cm3, as discussed above in the 103 rejection, it is known in the art that MRI determined brain volume can be converted to brain mass by using specific density of human brain of 1.046 g/cm3 according to Steen et al., Lim et al. and Tissue Properties:Density. It is noted that the claims of the ‘739 patent disclose the dose per brain mass. The claims of the ‘739 patent disclose the ages of the human subject as in the claims of the instant application. Regarding claim 12, the claims of the ‘739 patent do not teach the limitation. However, the wherein clause of claim 12 is not considered as an active step, rather it is a mental step of calculating or estimating the brain mass using a brain volume determined by MRI and this does not require any active step to carry out the claimed method of treating a human subject having MPS II. Thus, the wherein clause of claim 12 does not limit the claimed method. Regardless, the factor as claimed is known in the art according to Tissue Properties: Density. According to the Tissue Properties: Density, it discloses that the specific density of brain is 1.046 kg/m3 (g/cm3). While Lim et al. teach that the specific density of brain utilized for the conversion of brain volume to brain mass is 1.08 g/cm3, however, it would have been obvious to use another known specific density of human brain to convert the brain volume measured by MRI to brain mass with a reasonable expectation of success. Regarding the dose disclosed in claim 13, while the claims of the ‘739 patent teach a single dose being from about 1.1x1010 GC/g brain mass. Regarding the doses of the tables in claim 17 or 19, they do not teach the limitations. Yoo et al. teach the dose 1 at 1.3x1010 GC/g brain mass (dose 1) and at 6.5x1010 GC/g brain mass (dose 2) (para. 149 or 156). The total dose taught by Yoo et al. in para. 49 teaches that the dose(s) for the brain mass of 1300 g as 1.7x1013 (dose 1) or 8.5x 1013 GC/g brain mass (dose 2), and this value is identical to the dose for brain mass 1201 and up in the tables of claims 17 and 19. Regarding the human subject being 5 years old or older and less than 18 years old (claim 15), or 4 months old or older and less than 5 years old (claim 18), the claims of the ‘739 patent teach the limitations. Regarding claim 21, claim 1 of the ‘739 patent teaches intracisternal administration. Regarding claim 24, the wherein clause is not considered as an active step of carrying out the delivery. Rather the neuronal or glial cells transduced by the vector would inherently release the recombinant enzyme into the CSF. Thus, the method of the ‘739 patent teaching administering a viral vector to the CSF of a patient (para. 12) is expected to the same release of the enzyme as claimed. Regarding claim 25 and 42 directed to an immune suppression therapy, the ‘739 patent do not teach the limitation. Yoo et al. teach that the patient is co-treated with immune suppression therapy (para. 30), and continuing the immune suppression therapy. Regarding claim 28 directed to antibiotics before or concurrently with the immune suppression therapy, Yoo et al. teach the use of rapamycin as an immunosuppressive agent, which is also an antibiotics (para. 30). Thus, the use of rapamycin would meet the limitation of concurrent use of immune suppression therapy and antibiotics. Regarding claim 31 directed to a step of measuring biomarkers after administration including the level of IDS (I2S) in plasma, CSF or urine, Yoo et al. teach to evaluate biomarkers in CSF (GAGs, I2S activity), plasma (GAGs, I2S activity) and urine (GAGs) (para. 163), or vector shedding in CSF, plasma and urine (para. 152 and 160). Regarding the immune suppression therapy and antibiotics, biomarkers being GAGs which includes heparan sulfate, as discussed above in the 103 rejections, Yoo et al. and Chung et al. teach the limitations. Regarding claims 44-46, the claims of the ‘739 patent disclose AAV9. Regarding claim 47-48, claim 1 of the ‘739 patent discloses intracisternal (IC) or intracerebroventricular (ICV) injection. Regarding claims 49-50 directed to the immunosuppressive therapy, the claims of the ‘739 patent do not disclose the limitation. However, Yoo et al. teach the immunosuppressive therapy before the first dose of the administration (para. 197). Regarding claims 51-53 directed to SEQ ID NO:45, the claims of the ‘739 patent do not disclose the limitation. However, Hinderer et al. teach a nucleic acid of SEQ ID NO:3 encoding human IDS for the same purpose of the claimed method disclosed by the ‘739 patent. Thus, it would have been obvious to use the SEQ ID NO:3 encoding hIDS for the method of the ‘739 patent with a reasonable expectation of success. Thus, the claims of the ‘739 patent in view of the cited references render the claims of the instant application obvious. Response to Arguments Applicant's arguments filed 1/29/2026 have been fully considered but they are not persuasive. Applicant asserted that the claimed method require the administration volume of the recombinant expression vector to be dependent on the total CSF volume of the human subject, and it is a personalized administration dependent on a feature unique to each human subject. Applicant argued that the volume of total CSF is about 50 ml in infants and about 150 ml in adults, and children ages 4-13 years, the CSF varies between 65 and 150 ml. The claimed volume is less than 10% of the total CSF volume of human subject, and based on what applicant discussed, the volume would be about 5 ml to 15 ml and this would be based on the volume of the total CSF. As discussed in the claim rejection, Yoo et al. teach the total volume of product administered will not exceed 5 ml (para. 149 and 190). The teaching of Yoo et al. in the paragraph [0149] is a part of Example 5, and this example is intended to treat pediatric subjects and the injection volume is limited 5 ml. Considering the total CSF volume for pediatric patients would be about 50-150 ml including infants and ages 4-13 as discussed by applicant in the remarks, the volume not exceeding 5 ml would well within the claimed range of “not exceed 10% of the total CSF volume”. It is also noted that Yoo et al. teach the range of 5-20 ml (para. 136). While over 15 ml would not fall into the claimed range, however, the volume between 5-15 ml would meet the claimed range. Thus, it is the Examiner’s position that Yoo et al. teach the volume of the expression vector would not exceed 10% of the total CSF volume of the human subject. Applicant alleged that a personalized administration volume have improved features. First, the claimed invention does not particularly disclose “personalized” method and the volume of the expression vector being not exceeding 10% of the total CSF volume is personalized method. However, the range of the claimed volume is “less than 10% of the total CSF volume”, and for adults for example the volume of 5 ml taught by Yoo et al. would be equally applicable to any adults as the total CSF volume would be in between 125-150 ml as acknowledged by applicant. Then, there is no “personalized” volume if the claimed method would be carried out with 5 ml for all ages of adults. The volume taught by Yoo et al., i.e. not exceeding 5 ml, would also meet the infants whose total CSF volume would be about 50 ml. Applicant alleged that non-personalized administration “could” be too high for an infant or a child. It is not clear what “non-personalized” administration this argument refers to. It is not clear if applicant assert that the volume taught by Yoo et al. is considered as “non-personalized”. It is noted that as discussed above, the teaching of “not exceeding 5 ml” for pediatric patients is viewed as the same “personalized” administration based on the age. Furthermore, the volume of the expression vector taught by Yoo et al. for the pediatric patients would meet the claimed limitation for infants and ages 4-13 group as it does not exceed 10% of the total CSF volume. Applicant argued that the claimed personalized administration volume provided clinicians the option to use a standardized concentration of the vector composition as it is determined by a brain mass determined by the human subject’s brain mass. Applicant alleged that without a personalized administration volume, a clinician would have to administer different concentrations of the vector composition to be able to deliver different brain mass-determined doses to the patients, requiring manual calculation significantly increasing medication error and safety issues. The argument is not persuasive to overcome the prima facie case of obviousness based on the teaching of Yoo et al. It is obvious that the volume and concentration of the vector composition administered to a subject would be readily optimized for the needs of the subject. Yoo et al. teach the upper limitation of the volume, particularly for pediatric subject, and the total dose of AAV vector administered depends on the assumed brain mass across the different agent strata. The modification of dosages based on the subjects is extremely well known practice in the art. Thus, it is the Examiner’s position that the fact that the claimed administration volume could provide an option to clinicians to use a standardized concentration of the vector based on the subject’s brain mass does not overcome the strong prima facie obviousness based on the combined teachings of Yoo et al. along with the secondary references. Regarding the double patenting rejection, applicant argued that the claims of the ‘739 patent or none of Yoo, Lim and Chung remedy the deficiencies of the volume not exceeding 10% of the total CSF volume of the human subject. As discussed above with regard to the 103 rejection, it is the Examiner’s position that Yoo teaches the administration volume not exceeding 10% of the total CSF volume of human subjects. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jul 14, 2022
Application Filed
May 16, 2025
Non-Final Rejection — §103, §DP
Aug 20, 2025
Response Filed
Sep 29, 2025
Non-Final Rejection — §103, §DP
Jan 29, 2026
Response Filed
Apr 06, 2026
Final Rejection — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594301
COMPOSITIONS AND METHODS FOR TREATMENT OF LIQUID CANCERS
2y 5m to grant Granted Apr 07, 2026
Patent 12583894
MATERIALS AND METHODS FOR THE TREATMENT OF LEWY BODY DISORDERS
2y 5m to grant Granted Mar 24, 2026
Patent 12582699
COMPOSITIONS AND METHODS FOR ENHANCED LYMPHOCYTE-MEDIATED IMMUNOTHERAPY
2y 5m to grant Granted Mar 24, 2026
Patent 12582724
Compositions and Methods for the Treatment of Genetic Diseases
2y 5m to grant Granted Mar 24, 2026
Patent 12577535
GENERATION OF A MESENCHYMAL STROMAL CELL BANK FROM THE POOLED MONONUCLEAR CELLS OF MULTIPLE BONE MARROW DONORS
2y 5m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

4-5
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+51.1%)
3y 11m
Median Time to Grant
High
PTA Risk
Based on 874 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month