Prosecution Insights
Last updated: August 18, 2026
Application No. 17/793,506

METHODS OF TREATING FRAGILE X SYNDROME WITH REELIN

Non-Final OA §103§DP
Filed
Jul 18, 2022
Priority
Jan 17, 2020 — provisional 62/962,609 +1 more
Examiner
KIM, TAEYOON
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of South Florida
OA Round
3 (Non-Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
458 granted / 888 resolved
-8.4% vs TC avg
Strong +52% interview lift
Without
With
+51.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
62 currently pending
Career history
957
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
36.4%
-3.6% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
30.2%
-9.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 888 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 5/18/2026 has been entered. Applicant’s amendment and response filed on 4/6/2026 has been received and entered into the case. Claims 3, 5 and 17-18 have been canceled, claim 20 is newly added, and claims 1-2, 4, 6-16 and 19-20 have been considered on the merits. All arguments have been considered. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-2, 4, 6-16 and 19-20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Weeber (WO2018/027037; of record) in view of Liu et al. (2016, J. Biosci. Bioeng.; of record). Weeber teaches a method of treating neurological disorders including FXS by administering a therapeutically effective amount of a repeat fragment of Reelin or a construct formed from fragment repeats of Reelin to a patient (Abstract; p.10, line 20 thru p.11, line 11). Weeber also teaches a recombinant Reelin fragment or Reelin splice fragment including those comprising R3, one without R4 and R5, i.e. R3+R6 (p.12, lines 8-15). This teaching meets the claimed REELIN fusion protein. Weeber teaches that the construct of recombinant Reelin is inserted into a viral vector including AAV (p. 11, lines 37-39). Regarding the Reelin fusion protein comprising an N-terminal Reelin R3 repeat encoded by SEQ ID NO:2, the SEQ ID NO:2 of Weeber (p.37) is 100% identical to the SEQ ID NO:2 of claim 1 (see the alignment presented in the previous OA mailed on 9/5/2025). Regarding the Reelin fusion protein comprising a C-terminal REELIN R6 encoded by SEQ ID NO:5, Weeber discloses SEQ ID NO:5 (p.38) and this is 100% identical to the SEQ ID NO: 5 (see alignment presented in the OA mailed on 9/5/2025). Regarding the N-terminal REELIN R3 repeat being operably conjugated to the C-terminal REELIN R6 repeat, Weeber teaches a recombinant human Reelin protein comprising R3 fragment conjugated to the R6 fragment (R3+R6) (p.40; SEQ ID NO:10), and this would meet the limitation. Regarding claim 1 directed to the recombinant Reelin fusion protein comprising an IgKappa signal sequence fused in frame to the N-terminal Reelin R3 repeat, Weeber teaches the presence of a signal sequence in the sequence of R3+R6 fragment (see p.14, lines 35-37; Fig. 8), and the signal peptide appears to be a native signal peptide of Reelin protein. However, Weeber does not teach the IgKappa signal peptide. The IgGk (IgKappa) signal peptide is extremely well known in the art for the purpose of directing a protein into a secretory pathway (see Liu et al. 2016). As the Reelin fragment of Weeber is intended for secretion, and Weeber teaches the use of native signal sequence for the purpose of directing the protein into the secretory pathway, it would have been obvious to a person skilled in the art to use an alternative signal peptide/signal sequence that equivalently directs a protein into a secretory pathway to the native signal peptide. The substitution of an art-recognize equivalent is obvious (MPEP2144.06(II)). Regarding claim 4 directed to the recombinant Reelin fusion protein having SEQ ID NO: 10, Weeber teaches SEQ ID NO: 10 (p.40) that is 100% identical to the SEQ ID NO:10 of claim 4 (see the alignment presented in the OA mailed on 9/5/2025). Regarding claim 6, Weeber teaches intracerebral injection of the Reelin vector (p.64, claim 5). Regarding claim 7, Weeber teaches that the Reelin is bilaterally injected into the patient (p.64, claim 6). This teaching is understood that the Reelin vector is administered by a bilateral intracerebral injection. Regarding claim 8 directed to ICV injection, Weeber teaches intraventricular injection as well as intracerebral injection. Weeber also teaches the procedure of bilateral injection into a mouse (p.50, lines 14-24). This teaching is considered to meet the ICV injection because the procedure involves drilling holes through the skull and the Hamilton needle is through the brain into the ventricles, i.e. intracerebroventricular injection. Regarding claims 9-16, the limitations of these claims are considered as results of the claimed method. Therefore, the wherein clause of these claims does not require any additional active step other than administering the AAV vector encoding a secreted recombinant REELIN fusion protein, and they do not provide any patentable weight in determining patentability of the claimed method. Furthermore, as the method steps taught by Weeber are identical to the method steps of the instant claims, the results are expected the same. Regarding claim 19, Weeber teaches that vectors include AAV9, AAV5, AAV1 or AAV4 (p.11, lines 37-39). Regarding claim 20 directed to the recombinant REELIN fusion protein encoded by SEQ ID NO:9, Weeber teaches a human Reelin gene construct, R3 fragment conjugated to the R6 fragment, i.e. Reelin fragment R3+R6 (SEQ ID NO:9) (p.39). The sequence of SEQ ID NO:9 of Weeber is 100% identical to SEQ ID NO:9 of the instant application (see alignment below). RESULT 1 US-16-264-896A-9 Sequence 9, US/16264896A Patent No. 12516091 GENERAL INFORMATION APPLICANT: University of South Florida TITLE OF INVENTION: Reelin Compositions for Treatment of Neurological Disorders FILE REFERENCE: 1372.1144 CURRENT APPLICATION NUMBER: US/16/264,896A CURRENT FILING DATE: 2019-02-01 PRIOR APPLICATION NUMBER: 63/370,519 PRIOR FILING DATE: 2016-08-03 PRIOR APPLICATION NUMBER: 62/486,729 PRIOR FILING DATE: 2017-04-18 PRIOR APPLICATION NUMBER: PCT/US2017/045307 PRIOR FILING DATE: 2017-08-03 PRIOR APPLICATION NUMBER: 16/264,896 PRIOR FILING DATE: 2019-02-01 NUMBER OF SEQ ID NOS: 12 SEQ ID NO 9 LENGTH: 1895 TYPE: DNA ORGANISM: artificial sequence FEATURE: OTHER INFORMATION: Reelin Fragment R3 and R6 Query Match 100.0%; Score 1895; Length 1895; Best Local Similarity 100.0%; Matches 1895; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGCTTCCACCATGGAGCGCAGTGGCTGGGCCCGGCAGACTTTCCTCCTAGCGCTGTTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AAGCTTCCACCATGGAGCGCAGTGGCTGGGCCCGGCAGACTTTCCTCCTAGCGCTGTTGC 60 Qy 61 TGGGGGCGACGCTGAGGGCGCGCGCGTTCAGCAGTACTGCTCCAGTTCTTCTTCAGTACT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TGGGGGCGACGCTGAGGGCGCGCGCGTTCAGCAGTACTGCTCCAGTTCTTCTTCAGTACT 120 Qy 121 CTCATGATGCTGGTATGTCCTGGTTTCTGGTGAAAGAAGGCTGTTACCCGGCTTCTGCAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTCATGATGCTGGTATGTCCTGGTTTCTGGTGAAAGAAGGCTGTTACCCGGCTTCTGCAG 180 Qy 181 GCAAAGGATGCGAAGGAAACTCCAGAGAACTAAGTGAGCCCACCATGTATCACACAGGGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GCAAAGGATGCGAAGGAAACTCCAGAGAACTAAGTGAGCCCACCATGTATCACACAGGGG 240 Qy 241 ACTTTGAAGAATGGACAAGAATCACCATTGTTATTCCAAGGTCTCTTGCATCCAGCAAGA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACTTTGAAGAATGGACAAGAATCACCATTGTTATTCCAAGGTCTCTTGCATCCAGCAAGA 300 Qy 301 CCAGATTCCGATGGATCCAGGAGAGCAGCTCACAGAAAAACGTGCCTCCATTTGGTTTAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CCAGATTCCGATGGATCCAGGAGAGCAGCTCACAGAAAAACGTGCCTCCATTTGGTTTAG 360 Qy 361 ATGGAGTGTACATATCCGAGCCTTGTCCCAGTTACTGCAGTGGCCATGGGGACTGCATTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ATGGAGTGTACATATCCGAGCCTTGTCCCAGTTACTGCAGTGGCCATGGGGACTGCATTT 420 Qy 421 CAGGAGTGTGTTTCTGTGACCTGGGATATACTGCTGCACAAGGAACCTGTGTGTCAAATG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CAGGAGTGTGTTTCTGTGACCTGGGATATACTGCTGCACAAGGAACCTGTGTGTCAAATG 480 Qy 481 TCCCCAATCACAATGAGATGTTCGATAGGTTTGAGGGGAAGCTCAGCCCTCTGTGGTACA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TCCCCAATCACAATGAGATGTTCGATAGGTTTGAGGGGAAGCTCAGCCCTCTGTGGTACA 540 Qy 541 AGATAACAGGTGCCCAGGTTGGAACTGGCTGTGGAACACTTAACGATGGCAAATCTCTCT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AGATAACAGGTGCCCAGGTTGGAACTGGCTGTGGAACACTTAACGATGGCAAATCTCTCT 600 Qy 601 ACTTCAATGGCCCTGGGAAAAGGGAAGCCCGGACGGTCCCTCTGGACACCAGGAATATCA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ACTTCAATGGCCCTGGGAAAAGGGAAGCCCGGACGGTCCCTCTGGACACCAGGAATATCA 660 Qy 661 GACTTGTTCAATTTTATATACAAATTGGAAGCAAAACTTCAGGCATTACCTGCATCAAAC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GACTTGTTCAATTTTATATACAAATTGGAAGCAAAACTTCAGGCATTACCTGCATCAAAC 720 Qy 721 CAAGAACTAGAAATGAAGGGCTTATTGTTCAGTATTCAAATGACAATGGGATACTCTGGC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CAAGAACTAGAAATGAAGGGCTTATTGTTCAGTATTCAAATGACAATGGGATACTCTGGC 780 Qy 781 ATTTGCTTCGAGAGTTGGACTTCATGTCCTTCCTGGAACCACAGATCATTTCCATTGACC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| D 781 ATTTGCTTCGAGAGTTGGACTTCATGTCCTTCCTGGAACCACAGATCATTTCCATTGACC 840 Qy 841 TGCCACAGGACGCGAAGACACCTGCAACGGCATTTCGATGGTGGCAACCGCAACATGGGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TGCCACAGGACGCGAAGACACCTGCAACGGCATTTCGATGGTGGCAACCGCAACATGGGA 900 Qy 901 AGCATTCAGCCCAGTGGGCTTTGGATGATGTTCTTATAGGAATGAATGACAGCTCTCAAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 AGCATTCAGCCCAGTGGGCTTTGGATGATGTTCTTATAGGAATGAATGACAGCTCTCAAA 960 Qy 961 CTGGATTTCAAGACAAATTTGATGGCTCTATAACCCTTGATAGTAGGAAATGGCTGCTTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CTGGATTTCAAGACAAATTTGATGGCTCTATAACCCTTGATAGTAGGAAATGGCTGCTTC 1020 Qy 1021 ACCCAGGAGGCACCAAGATGCCCGTGTGTGGCTCTACTGGTGATGCCCTGGTCTTCATTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 ACCCAGGAGGCACCAAGATGCCCGTGTGTGGCTCTACTGGTGATGCCCTGGTCTTCATTG 1080 Qy 1081 AAAAGGCCAGCACCCGTTACGTGGTCAGCACAGACGTTGCCGTGAATGAGGATTCCTTCC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 AAAAGGCCAGCACCCGTTACGTGGTCAGCACAGACGTTGCCGTGAATGAGGATTCCTTCC 1140 Qy 1141 TACAGATAGACTTCGCTGCCTCCTGCTCAGTCACAGACTCTTGTTATGCGATTGAATTGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TACAGATAGACTTCGCTGCCTCCTGCTCAGTCACAGACTCTTGTTATGCGATTGAATTGG 1200 Qy 1201 AATACTCAGTAGATCTTGGATTGTCATGGCACCCATTGGTAAGGGACTGTCTGCCTACCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AATACTCAGTAGATCTTGGATTGTCATGGCACCCATTGGTAAGGGACTGTCTGCCTACCA 1260 Qy 1261 ATGTGGAATGCAGTCGCTATCATCTGCAACGGATCCTGGTGTCAGACACTTTCAACAAGT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATGTGGAATGCAGTCGCTATCATCTGCAACGGATCCTGGTGTCAGACACTTTCAACAAGT 1320 Qy 1321 GGACTAGAATCACTCTGCCTCTCCCTCCTTATACCAGGTCCCAAGCCACTCGTTTCCGTT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 GGACTAGAATCACTCTGCCTCTCCCTCCTTATACCAGGTCCCAAGCCACTCGTTTCCGTT 1380 Qy 1381 GGCATCAACCAGCTCCTTTTGACAAGCAGCAGACATGGGCAATAGATAATGTCTATATCG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 GGCATCAACCAGCTCCTTTTGACAAGCAGCAGACATGGGCAATAGATAATGTCTATATCG 1440 Qy 1441 GGGATGGCTGCATAGACATGTGCAGTGGCCATGGGAGATGCATCCAGGGAAACTGCGTCT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GGGATGGCTGCATAGACATGTGCAGTGGCCATGGGAGATGCATCCAGGGAAACTGCGTCT 1500 Qy 1501 GTGATGAACAGTGGGGTGGCCTGTACTGTGATGACCCCGAGACCTCTCTTCCAACCCAAC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GTGATGAACAGTGGGGTGGCCTGTACTGTGATGACCCCGAGACCTCTCTTCCAACCCAAC 1560 Qy 1561 TCAAAGACAACTTCAATCGAGCTCCATCCAGTCAGAACTGGCTGACTGTGAACGGAGGGA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TCAAAGACAACTTCAATCGAGCTCCATCCAGTCAGAACTGGCTGACTGTGAACGGAGGGA 1620 Qy 1621 AATTGAGTACAGTGTGTGGAGCCGTGGCGTCGGGAATGGCTCTCCATTTCAGTGGGGGTT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 AATTGAGTACAGTGTGTGGAGCCGTGGCGTCGGGAATGGCTCTCCATTTCAGTGGGGGTT 1680 Qy 1681 GTAGTCGATTATTAGTCACTGTGGATCTAAACCTCACTAATGCTGAGTTCATCCAATTTT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GTAGTCGATTATTAGTCACTGTGGATCTAAACCTCACTAATGCTGAGTTCATCCAATTTT 1740 Qy 1741 ACTTCATGTATGGGTGCCTGATTACACCAAACAACCGTAACCAAGGTGTTCTCTTGGAAT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 ACTTCATGTATGGGTGCCTGATTACACCAAACAACCGTAACCAAGGTGTTCTCTTGGAAT 1800 Qy 1801 ATTCTGTCAATGGAGGCATTACCTGGAACCTGCTCATGGAGATTTTCTATGACCAGTACA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 ATTCTGTCAATGGAGGCATTACCTGGAACCTGCTCATGGAGATTTTCTATGACCAGTACA 1860 Qy 1861 GTGATTACAAGGATGACGACGATAAGTGACTCGAG 1895 ||||||||||||||||||||||||||||||||||| Db 1861 GTGATTACAAGGATGACGACGATAAGTGACTCGAG 1895 Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2, 4, 6-16 and 19-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 of U.S. Patent No. 9,962,426 in view of Weeber (supra) and Liu et al. (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘426 patent disclose a method of improving cognitive function in a subject by administering a therapeutically effective amount of a Reelin fragment to the subject suffering from fragile X syndrome. While the ‘426 patent does not particularly disclose what the Reelin fragments are except their MW, i.e. a 180 kDa, a 370 kDa or a 450 kDa Reelin fragment, the claims of the ’426 patent do not disclose the Reelin fusion protein of the instant claims. However, Weeber teaches the Reelin fragments identical to the SEQ ID NOs: 2, 5 and 10 (as shown above), and Weeber teaches the use of these Reelin fusion fragments for treating FXS, it would have been obvious to a person skilled in the art to use the Reelin fragments of Weeber in the method of the claims of the ‘426 patent. While the claims of the ‘426 patent do not teach the delivery of an AAV vector encoding the Reelin protein, rather the claims are directed to the delivery of a Reelin protein fragment, however, it would have been obvious to a person skilled in the art to deliver a viral vector such as AAV encoding the Reelin protein fragment or fusion protein as Weeber teaches such method for treating FXS. Regarding the routes of delivery, Weeber teaches intracerebral or intraventricular delivery, and the ICV delivery is an obvious alternative to these routes for delivering an AAV vector encoding the Reelin fusion protein of the instant claims. Regarding the use of IgKappa signal sequence (claim 1), while the claims of the ‘426 patent in view of Weeber do not teach the IgKappa signal sequence, however, it would have been obvious to a person skilled in the art to use IgKappa signal sequence for the secretion of the Reelin fusion protein as it is well known option in the art for directing a protein to a secretory pathway according to Liu et al. Regarding the AAV being AAV1, AAV4, AAV5 or AAV9, Weeber teaches that the AAV vectors include the claimed serotypes. Regarding claim 20 directed to SEQ ID NO:9, as discussed above in the 103 rejection, as SEQ ID NO:9 of Weeber is identical to the claimed SEQ ID NO:9., it would have been obvious to a person skilled in the art to use the Reelin fragment (R3+R6) of SEQ ID NO:9 taught by Weeber for the method of the ‘426 patent with a reasonable expectation of success. Thus, the claims of the ‘426 patent in view of the cited references render the claimed invention obvious. Claims 1-2, 4, 6-16 and 19-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 of U.S. Patent No. 10,729,744 in view of Weeber (supra) and Liu et al. (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘744 patent disclose a method of improving cognitive function in a subject by administering a therapeutically effective amount of a Reelin fragment to the subject suffering from fragile X syndrome. While the ‘744 patent does not particularly disclose what the Reelin fragments are except their MW, i.e. a 180 kDa, a 370 kDa or a 450 kDa Reelin fragment, the claims of the ’744 patent do not disclose the Reelin fusion protein of the instant claims. However, Weeber teaches the Reelin fragments identical to the SEQ ID NOs: 2, 5 and 10 (as shown above), and Weeber teaches the use of these Reelin fusion fragments for treating FXS, it would have been obvious to a person skilled in the art to use the Reelin fragments of Weeber in the method of the claims of the ‘744 patent. While the claims of the ‘744 patent do not teach the delivery of an AAV vector encoding the Reelin protein, rather the claims are directed to the delivery of a Reelin protein fragment, however, it would have been obvious to a person skilled in the art to deliver a viral vector such as AAV encoding the Reelin protein fragment or fusion protein as Weeber teaches such method for treating FXS. Regarding the routes of delivery, Weeber teaches intracerebral or intraventricular delivery, and the ICV delivery is an obvious alternative to these routes for delivering an AAV vector encoding the Reelin fusion protein of the instant claims. Regarding the use of IgKappa signal sequence, while the claims of the ‘744 patent in view of Weeber do not teach the IgKappa signal sequence, however, it would have been obvious to a person skilled in the art to use IgKappa signal sequence for the secretion of the Reelin fusion protein as it is well known option in the art for directing a protein to a secretory pathway according to Liu et al. Regarding the AAV being AAV1, AAV4, AAV5 or AAV9, Weeber teaches that the AAV vectors include the claimed serotypes. Regarding claim 20 directed to SEQ ID NO:9, as discussed above in the 103 rejection, as SEQ ID NO:9 of Weeber is identical to the claimed SEQ ID NO:9., it would have been obvious to a person skilled in the art to use the Reelin fragment (R3+R6) of SEQ ID NO:9 taught by Weeber for the method of the ‘426 patent with a reasonable expectation of success. Thus, the claims of the ‘744 patent in view of the cited references render the claimed invention obvious. Claims 1-2, 4, 6-16 and 19-20 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 19-25 of copending Application No. 19/387,230 in view of Weeber and Liu et al. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘230 application are directed to a method of treating a symptom of a nervous system disease or disorder including fragile X syndrome by administering a viral vector encoding a Reelin recombinant protein fragment repeat R3 joined to Reelin fragment repeat R6. It is noted SEQ ID NO:9 of the ‘230 application is 100% identical to SEQ ID NO:9 of claim 20 of the instant application. Regarding the routes of delivery, the claims of the ‘230 application do not teach the limitation. Weeber teaches intracerebral or intraventricular delivery of Reelin fragment identical to SEQ ID NO:10 (amino acid) or SEQ ID NO:9 (nucleic acid) of the instant application, and the ICV delivery is an obvious alternative to these routes for delivering an AAV vector encoding the Reelin fusion protein of the instant claims. Regarding the use of IgKappa signal sequence required by the claims of the instant application, while the claims of the ‘230 application in view of Weeber do not teach the IgKappa signal sequence, however, it would have been obvious to a person skilled in the art to use IgKappa signal sequence for the secretion of the Reelin fusion protein as it is well known option in the art for directing a protein to a secretory pathway according to Liu et al. Regarding the AAV being AAV1, AAV4, AAV5 or AAV9, claim 22 of the ‘230 application teach the limitation. Thus, the claims of the ‘230 application in view of Weeber and Liu et al. render the claims of the instant application obvious. This is a provisional nonstatutory double patenting rejection. Response to Arguments Applicant's arguments with respect to the 103 rejection have been fully considered but they are not persuasive. Applicant stated that Weeber lists many different combinations of Reelin fragments to form a recombinant Reelin, and acknowledged that Weeber discloses various recombinant Reelin fragments in p.10-11. Applicant alleged that nowhere in Weeber is it taught, however, that an AAV encoding a secreted recombinant Reelin fusion protein comprising repeat R3 joined to repeat R6 is effective at treating Fragile X syndrome. Applicant asserted that Example 8 and 9 are based on different condition (Alzheimer’s mouse model and TBI model, respectively), and utilized purified Reelin fragment or exogenous full-length Reelin protein rather than using the claimed fragment produced by AAV. It is acknowledged that Weeber did not disclose any Example showing that the Reelin fragment including the claimed R3+R6 fragment effectively treats FXS. However, applicant is reminded that the instant claim rejection is an obviousness rejection, and the combined teachings do not require to provide factual evidence showing therapeutic efficacy in a method of treating. Furthermore, obviousness does not require absolute predictability, but at least some degree of predictability is required. Instead, obviousness requires a reasonable expectation of success (see MPEP2143.02). As Weeber teaches that the recombinant fragment of Reelin can be used in a method of treating various neurological conditions including FXS, it is reasonably expected that the R3+R6 Reelin fragment, one of several Reelin fragments disclosed by Weeber, is expected to treat FXS. In the absence of clear evidence showing that there was no reasonable expectation of success, it is the Examiner’s position that the claimed invention is obvious over the combined teachings of Weeber and Liu et al. While there is no example or evidence showing the effective treatment of FXS with the Reelin fragments, however, as Weeber teaches that the fragments of Reelin which are effective in initiating signaling pathway (Example 3), and claims a method of treating FXS using the Reelin fragments (p.64, claim 1), one skilled in the art would consider that there is a reasonable expectation of success in using the reelin fragments of Weeber to treat FXS in the absence of any evidence to the contrary. Weeber teaches all the limitations of the instant claims except the use of IgKappa signal sequence fused in frame to the N-terminal Reelin R3 repeat, and the teaching of Liu et al. was combined to address this limitation. Considering the presence of signal peptide not involving therapeutic efficacy of the Reelin fragment, it is predictable that the Reelin fragment of Weeber can produce therapeutic effect in treating FXS. Applicant argued that as surprisingly demonstrated in the present application as originally filed, "the R36 fragment [containing REELIN repeat region 3 joined to REELIN repeat 6] functionally rescued cognitive deficits in a mouse model of FXS and did not appear to have any adverse effects on wild type mouse behavior (Fig. 3). It appears that applicant relies on the unexpected results of the claimed method in treating FXS. However, applicant has failed to establish how this is considered unexpected. According to the teaching of Weeber, it is expected that the Reelin fragment as claimed would treat FXS. Regarding the double patenting rejections, the rejections have been modified to address the instant amendment. It is also noted that a provisional ODP rejection is newly presented. Applicant’s request to hold the rejection in abeyance is not a proper response. The double-patenting rejections will not be held in abeyance. See 37 C.F.R. 1.111(b), which allows that some objections or “requirements as to form” may be held in abeyance but includes no provision for holding rejections in abeyance. Section 1.111(b) also requires applicants to respond to each rejection with “arguments pointing out the specific distinctions believed to render the claims, including any newly presented claims, patentable over any applied references.” For each rejection, for example, applicants might provide a proper terminal disclaimer (or at least indicate a willingness to submit one when double patenting is the only remaining issue); explain why the rejection is overcome by amendments; provide convincing arguments that the rejection was made in error; and/or explain why amendments or claim cancellations in the copending applications have rendered the rejection moot. If any of the conflicting pending application matures to a patent, modifying the rejection to account for claim-number changes will not constitute a new ground of rejection. Thus, the double patenting rejections are maintained. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Show 1 earlier event
Aug 22, 2023
Response after Non-Final Action
Sep 05, 2025
Non-Final Rejection mailed — §103, §DP
Dec 01, 2025
Response Filed
Feb 20, 2026
Final Rejection mailed — §103, §DP
Apr 06, 2026
Response after Non-Final Action
May 18, 2026
Request for Continued Examination
May 19, 2026
Response after Non-Final Action
Jul 27, 2026
Non-Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698474
B-cell cultivation method
7y 1m to grant Granted Aug 04, 2026
Patent 12685774
CELL/GENE THERAPIES TARGETING MAGE-A4 PEPTIDE
3y 7m to grant Granted Jul 21, 2026
Patent 12668778
METHOD FOR EXPANSION OF DOUBLE NEGATIVE REGULATORY T CELLS
3y 6m to grant Granted Jun 30, 2026
Patent 12661377
COMBINATION THERAPY COMPRISING A COMPOSITION OF MESENCHYMAL STROMAL CELLS AND HYALURONIC ACID FOR USE IN TREATMENT OF OSTEOARTHRITIS
3y 5m to grant Granted Jun 23, 2026
Patent 12648967
Post-Natal Transplantation Of Factor VIII-Expressing Cells For Treatment of Hemophilia
3y 2m to grant Granted Jun 09, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+51.8%)
3y 9m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 888 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month