Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
This office action is in reply to Applicant’s response of 2 September 2025. The amendment filed 2 September 2025 has been entered. Applicant’s remarks and amendments have been fully and carefully considered but are not found to be sufficient to put the application in condition for allowance.
Note: The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office Action.
This action is made NON-FINAL.
Claim Status
Claims 119-138 are pending and under examination.
Claims 1-118 are canceled.
Claims 119-121, 123-125, and 127-138 are currently amended.
Claims 122, 126 are previously presented.
Drawings
Modified
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). No petition for the acceptance of color drawings has been granted, so the drawings filed 21 July 2022 are not accepted.
Response to Arguments
Applicant’s statement on page 17 of the Remarks filed on 2 September 2025 that there is no intention to have color drawings presented in this application and request that the drawings be accepted as filed is insufficient for the color drawings filed on 21 July 2022 to be accepted. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). No petition for the acceptance of color drawings has been granted, so the drawings filed 21 July 2022 are not accepted because they were filed in color. Applicant is required to submit new black and white drawings if they do not intend to have color drawings in this application.
Specification
New
The use of the term ONETAQ in line 4 of [0019] of the instant specification, as amended on 2 September 2025, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Response to Amendments
Applicant’s amendments to the Specification have overcome the objections to the specification previously set forth in the Non-Final Office action mailed 30 May 2025, which are accordingly withdrawn. However, the term ONETAQ is a trade name or mark used in commerce and has accordingly been objected to.
Claim Interpretation
New
Claims 119 and 133 recite “the pair of oligonucleotide primers each has a melting temperature (Tm), and a Tm value of the pair of oligonucleotide primers differs from each other by less than 1°C” and claim 135 recites “the pair of oligonucleotide primers each has a melting temperature (Tm), and the Tm of the pair of oligonucleotide primers differs from each other by less than 1°C”. It is noted that the pair does not have an individual Tm, but rather each primer of the pair of oligonucleotide primers has a Tm. For the purpose of examination, this recitation is interpreted as reading “each primer of the pair of oligonucleotide primers has a melting temperature (Tm), and the Tm of a first primer of the pair of oligonucleotide primers differs from the Tm of a second primer of the pair of oligonucleotide primers by less than 1°C”. Amendment of the claim to improve the clarity of this recitation is suggested (language like that of claim 124, as an example, would improve the clarity).
Claim Objections
New
Claims objected to because of the following informalities:
Claim 124 recites “and wherein difference between” in line 3. Insertion of an article such as ‘a’ or ‘the’ between ‘wherein’ and ‘difference’ is suggested.
Claim 135 recites “a pair or oligonucleotide primers” in lines 2-3. The word ‘or’ should be corrected to the word ‘of’.
Claim 138 recites “and wherein difference between” in line 62. Insertion of an article such as ‘a’ or ‘the’ between ‘wherein’ and ‘difference’ is suggested.
Appropriate correction is required.
Response to Amendments
Applicant’s amendments to the Claims have overcome each objection to the claims previously set forth in the Non-Final Office action mailed 30 May 2025. The objections to the claims as set forth on pages 3-4 of the Office Action of 30 May 2025 are therefore withdrawn. However, new objections to the claims are made in this action.
Claim Rejections - 35 USC § 112(b) - Indefiniteness
Maintained and New, Not Necessitated by Amendment
Claims 123-126, 128, and 136-138 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 123 recites the limitation "the optimal temperature of the polymerase" in line 4. There is insufficient antecedent basis for this limitation in the claim and the claim it depends upon. Claims 124-126 are rejected based on their dependency on claim 123.
Claim 125 recites the limitation "the first melting temperature" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim.
Claim 125 recites the limitation "the oligonucleotide primer" in line 4. There is insufficient antecedent basis for this limitation in the claim, since two oligonucleotide primers making up the pair of oligonucleotide primers are recited.
Claim 126 recites the limitation "the first [...] melting temperature" in line 2. There is insufficient antecedent basis for this limitation in the claim.
Claim 128 contains the trademark/trade name Vent. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a specific polymerase and, accordingly, the identification/description is indefinite.
Claim 136 recites the limitation "the optimal temperature of the thermostable polymerase" in line 2. There is insufficient antecedent basis for this limitation in the claim.
Claim 137 contains the trademark/trade name 2.0, WarmStart, and 3.0. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a specific polymerase and, accordingly, the identification/description is indefinite.
Claim 138 recites “wherein further comprising dUTPs” in line 1. It would be unclear to one of ordinary skill in the art what further comprises dUTPs, so claim 138 is indefinite.
Claim 138 recites “wherein, further comprising polyethylene glycol” in line 1. It would be unclear to one of ordinary skill in the art what further comprises polyethylene glycol, so claim 138 is indefinite.
Claim 138 recites “the total ramp time” in line 55 and “the total reaction time” in line 56. There is insufficient antecedent basis for these limitations in the claim.
Claim 138 contains the trademark/trade name 2.0, WarmStart, 3.0, Vent, Deep Vent, EpiMark, OneTaq, and LongAmp. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe specific polymerases and, accordingly, the identification/description is indefinite.
Response to Amendments and Arguments
Applicant’s amendments to the Claims have overcome the rejection of claims 119-134 as being indefinite due to the recitation “less than about”, the rejection is withdrawn. Applicant’s amendments to the Claims have overcome the rejection of claims 120-121, 123-129, 131, and 134 as being indefinite due to reciting a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation within the same claim, the rejection is withdrawn. Applicant’s amendments to the Claims have overcome the rejection of claim 125 as being indefinite due to containing a trademark or trade name, the rejection is withdrawn. The rejection of claim 127 as being indefinite due to containing a trademark or trade name is withdrawn because claim 127 does not contain a trademark or trade name. The rejection of claim 132 as being indefinite due to the repeated use of “and/or” is withdrawn as not being indefinite, repeated uses of “and/or” in the same list are interpreted as requiring only any one of the limitations joined together in the “and/or” list due to “or” presenting the option that they are alternatives.
Applicant’s amendments to the Claims do not overcome the rejection of claim 137, because claim 137 still contains the trademark or trade name “WarmStart”. The rejection of claim 137 is therefore maintained and modified. A new rejection of claim 137 has also been made identifying “2.0” and “3.0” as trademarks or trade names in the context of the claim.
New rejections of claims 123-126, 128, 136, and 138 have been made.
Claim Rejections - 35 USC § 102
Modified, Necessitated by Amendment
Claims 119-120, 130, and 132-133 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai.
Regarding claim 119, Cai teaches a method for amplifying a target nucleic acid molecule in a sample (“OPCRar is capable of amplifying a specific target sequence present in a double stranded DNA analyte” [0117]), the method comprising: contacting a polymerase and a pair of oligonucleotide primers with the sample (“OPCRar solution was set up by mixing: […] Primer set HLBForSh and HLBRevSh […] VentR (exo-) DNA Polymerase […] PCR product dilution” [0117-0128]), thereby forming an amplification mixture, wherein the primers are configured to specifically hybridize to the target nucleic acid molecule (“we used two OPCRar primers, primer HLB (Huang Long Bing) ForSh and primer HLBRevSh, to generate a 140 bp sequence from a PCR-amplified fragment of the C. Liberibacter asiaticus elongation factor gene” [0117]), and wherein each primer of the pair of oligonucleotide primers has a melting temperature (Tm), and the Tms of the primers of the pair of oligonucleotide primers differs from each other by less than 1 °C (“HLBForSh […] Tm: 75.6° C” [0254-0255]; “HLBRevSh […] Tm: 75.5° C” [0257]); subjecting the amplification mixture to a number of thermal cycles between a first temperature and a second temperature, thereby amplifying a sequence of the target nucleic acid molecule through polymerase chain reaction (PCR); wherein the difference between the first and second temperatures is less than 20°C (“oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129]), and wherein at least one of the primers has an elongation terminus where the polymerase adds nucleotides during the PCR and wherein the primer has G or C at the elongation terminus (“(SEQ ID NO 16 […] HLBRevSh” [0257]; SEQ ID NO 16 on page 20 ends in a C at the 3’ elongation terminus).
Regarding claim 120, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein the difference between the first and second temperature is about 10-15°C (“oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129]).
Regarding claim 130, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein at least one of the primers has a G/C content in the range of about 40% to about 60%, and wherein the difference between the G/C content of the primers are less than 20% (“(SEQ ID NO 14) […] HLBForSh” [0254]; “(SEQ ID NO 16 […] HLBRevSh” [0257]; SEQ ID NO 14 on pages 19-20 has G/C content 47%, SEQ ID NO 16 on page 20 has G/C content 45%); or wherein at least one of the primers has an elongation terminus where the polymerase adds nucleotides during the PCR, and wherein the primer has a G/C content of at least 40% in a continuous 5-nucleotide region including the elongation terminus (SEQ ID NO 16 on page 20 ends in AAGCC at the 3’ elongation terminus, which is a 60% G/C content).
Regarding claim 132, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein the amplification mixture further comprises a single strand binding protein (SSB) (“Et SSB, Extreme Thermostable Single Stranded Binding Protein” [0127]); or wherein the amplification mixture has a volume of about 1-30 µL (“A 20 µL OPCRar solution was set up by mixing” [0117]); or wherein the target nucleic acid is a double-stranded nucleic acid molecule (“To demonstrate that OPCRar is capable of amplifying a specific target sequence present in a double stranded DNA analyte” [0117]).
Regarding claim 133, the methods of (I), (II), and (III) repeat the limitations of claim 119 with either equal or greater breadth of scope, while adding in (I) the step of detecting the amplified sequence in the amplification mixture, in (II) the step of providing a nucleic acid containing sample collected from a subject, that the target is a pathogenic sequence, and the step of detecting the presence or absence of the amplified sequence in the amplification mixture, and in (III) the step of providing a nucleic acid containing sample collected from a subject, that the target is a sequence from the subject’s genome suspected of containing a genetic alteration, and the step of sequencing the amplified sequence to determine the presence or absence of the genetic alteration. However, the claim requires only one of these methods, chosen from (I), (II), or (III). Cai teaches method (I), since Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above) including the step of detecting the amplified sequence in the amplification mixture (“After the reactions were complete, 5 µL of OPCRar product was […] visualized” [0129]).
Therefore, claims 119-120, 130, and 132-133 are anticipated by Cai.
Response to Amendments
Claims 119 and 133 have been amended to limit the difference in Tm between the primers, the difference between the first and second temperatures (only claim 119), and to require that at least one of the primers have a G or C at the elongation terminus. While these amendments overcome the previous rejection using Cai, since the primers in the embodiment of the previous rejection had Tms >1°C apart, the rejection is modified to cite a different embodiment of Cai wherein the primers have Tms <1°C apart and one of the primers has a C or G at its elongation terminus. Therefore, the rejection is modified as necessitated by amendment to map to the different embodiment.
Modified, Necessitated by Amendment
Claims 121 and 123-126 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, as applied to claims 119-120, 130, and 132-133 above, and as evidenced by NEB_temp (New England Biolabs, https://www.neb.com/en-us/protocols/2012/09/10/protocol-for-a-routine-vent-exo-pcr-reaction).
Regarding claim 121, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein the polymerase has an optimal temperature for catalyzing primer extension during the PCR; and wherein the optimal temperature is between the first and second temperatures (“VentR (exo-) DNA Polymerase” [0126]; “oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129]). Though Cai does not explicitly teach the optimal temperature of the Vent® (exo-) DNA Polymerase, NEB_temp provides evidence that the optimal temperature of the Vent® (exo-) DNA Polymerase is 72°C (“Cycling conditions for a routine reaction […] 72°C”, NEB_temp), which is between the first and second temperatures.
Regarding claim 123, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein the pair of oligonucleotide primers have an average melting temperature, and wherein the second temperature is in the range of ±5°C of the average melting temperature; and wherein the average melting temperature is within ±5°C of the optimal temperature of the polymerase (“HLBForSh […] Tm: 75.6° C” [0254-0255]; “HLBRevSh […] Tm: 75.5° C” [0257], so the average melting temperature 75.55°C; “oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129], interpreting 80° C as the second temperature). Though Cai does not explicitly teach the optimal temperature of the Vent® (exo-) DNA Polymerase, NEB_temp provides evidence that the optimal temperature of the Vent® (exo-) DNA Polymerase is 72°C (“Cycling conditions for a routine reaction […] 72°C”, NEB_temp). The average melting temperature 75.55°C is within ±5°C of the second temperature (80°C) and within ±5°C of the optimal temperature of the polymerase (72°C).
Regarding claim 124, Cai teaches the method of claim 123 (see 35 U.S.C. 102 rejection of claim 123 above), wherein one of the pair of oligonucleotide primers has a second melting temperature and the other one of the pair of oligonucleotide primers has a third melting temperature, and wherein the difference between the second and third melting temperatures is less than 0.5°C (“HLBForSh […] Tm: 75.6° C” [0254-0255]; “HLBRevSh […] Tm: 75.5° C” [0257]).
Regarding claim 125, Cai teaches the method of claim 124 (see 35 U.S.C. 102 rejection of claim 124 above), wherein the first melting temperature is determined using a computer algorithm based on the sequence of the target nucleic acid molecule, and wherein the second or third melting temperature is determined using a computer algorithm based on the sequence of the oligonucleotide primer (“All primer melting temperatures (Tm) calculated using IDT OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc., Coralville, Iowa) using the Primer 3 Tm calculating software” [0229]).
Regarding claim 126, Cai teaches the method of claim 124 (see 35 U.S.C. 102 rejection of claim 124 above), wherein the method further comprises determining the first, second, third, and/or average melting temperature (“All primer melting temperatures (Tm) calculated” [0229]; “HLBForSh […] Tm: 75.6° C” [0254-0255]; “HLBRevSh […] Tm: 75.5° C” [0257]).
Therefore, claims 121 and 123-126 are anticipated by Cai as evidenced by NEB_temp.
Response to Amendments
The rejections of claims 121 and 123-126 have been modified to map to a different embodiment in Cai, as necessitated by the amendment to claim 119 upon which claims 121 and 123-126 depend. The reasoning for why the amendment to claim 119 necessitates the mapping to a different embodiment in Cai is given in the Response to Amendments section immediately following the rejection of claims 119-120, 130, and 132-133 under 35 U.S.C. 102 as being anticipated by Cai.
Modified, Necessitated by Amendment
Claim 122 is rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, as applied to claims 119-120, 130, and 132-133 above, and as evidenced by Oligo Calculator (Krantz Lab, University of California, Berkeley, https://mcb.berkeley.edu/labs/krantz/tools/oligocalc.html).
Regarding claim 122, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein the sequence of the target nucleic acid molecule has a first melting temperature, and wherein the first temperature is in the range of ±5°C of the first melting temperature (“oscillating between 80° C” [0129]). Though Cai does not explicitly teach the melting temperature of the sequence of the target nucleic acid molecule, Oligo Calculator provides evidence that the melting temperature (Tm) of the amplified sequence of the target nucleic acid molecule (the portion of the sequence of the Candidatus Liberibacter asiaticus elongation factor gene amplified by the HLBForSh and HLBRevSh primers) is 79°C (“Melting Temperature (Tm) 79°C”, Oligo Calculator), which is within 5°C of 80°C.
Therefore, claim 122 is anticipated by Cai as evidenced by Oligo Calculator.
Response to Amendments
The rejection of claim 122 has been modified to map to a different embodiment in Cai, as necessitated by the amendment to claim 119 upon which claim 122 depends. The reasoning for why the amendment to claim 119 necessitates the mapping to a different embodiment in Cai is given in the Response to Amendments section immediately following the rejection of claims 119-120, 130, and 132-133 under 35 U.S.C. 102 as being anticipated by Cai.
Modified, Necessitated by Amendment
Claims 127-128 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, as applied to claims 119-120, 130, and 132-133 above, and as evidenced by NEB_strand_displacement (New England Biolabs, https://www.neb.com/en-us/products/m0257-vent-exo-dna-polymerase#Protocols---Manuals---Usage).
Regarding claim 127, Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above), wherein the polymerase is a thermostable polymerase (“VentR (exo-) DNA Polymerase” [0126]). Though Cai does not explicitly teach that Vent® (exo-) DNA Polymerase is a thermostable polymerase, NEB_strand_displacement provides evidence that Vent® (exo-) DNA Polymerase is a thermostable polymerase (“High thermostability” page 1).
Regarding claim 128, Cai teaches the method of claim 127 (see 35 U.S.C. 102 rejection of claim 127 above), wherein the polymerase is a Vent DNA polymerase (“VentR (exo-) DNA Polymerase” [0126]); and wherein the first temperature is in the range of about 70-80°C, and the second temperature is in the range of about 55-70°C (“oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129]).
Therefore, claims 127-128 are anticipated by Cai as evidenced by NEB_strand_displacement.
Response to Amendments
The rejections of claims 127-128 have been modified to map to a different embodiment in Cai, as necessitated by the amendment to claim 119 upon which claims 127-128 depend. The reasoning for why the amendment to claim 119 necessitates the mapping to a different embodiment in Cai is given in the Response to Amendments section immediately following the rejection of claims 119-120, 130, and 132-133 under 35 U.S.C. 102 as being anticipated by Cai.
Claim Rejections - 35 USC § 103
New, Not Necessitated by Amendment
Claims 133-134 are rejected under 35 U.S.C. 103 as being unpatentable over Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, as applied to claims 119-120, 130, and 132-133 above.
Regarding claim 133, the claim requires any one of the methods (I), (II), or (III) using the method of claim 119 and additional limitations that vary among (I), (II), and (III) (see discussion of claim 133 in the 35 U.S.C. 102 rejection of claim 133 above). Cai teaches method (II), since Cai teaches the method of claim 119 (see 35 U.S.C. 102 rejection of claim 119 above) including the step of providing a nucleic acid containing sample collected from a subject, that the target is a pathogenic sequence (“Embodiments of this invention include the detection of pathogens in a biological sample where a nucleic acid of the pathogen is the target nucleic acid” [0093]), and the step of detecting the presence or absence of the amplified sequence in the amplification mixture (“After the reactions were complete, 5 µL of OPCRar product was […] visualized” [0129]).
Regarding claim 134, Cai teaches the method of claim 133 (see 35 U.S.C. 103 rejection of claim 133) above, wherein in the method (II), the sample contains extracted genomic acid of the subject, or cell-free nucleic acid from the subject, wherein, the sample is a bodily fluid sample (“Nucleic acid samples may be isolated from cells or viruses and may include chromosomal DNA, extra-chromosomal DNA including plasmid DNA, recombinant DNA, DNA fragments, messenger RNA, ribosomal RNA, transfer RNA, double stranded RNA or other RNAs that occur in cells or viruses. Nucleic acid may be isolated from any number of sources such as agriculture, food, environmental, fermentations, or biological fluids such as saliva” [0047]).
Though Cai’s teaching of using the method to target a pathogenic sequence in a sample from a subject was not part of the primary embodiment that taught the method of claim 119 and the step of detecting, one of ordinary skill in the art would have a reasonable expectation of success in combining these embodiments because it merely involves the simple substitution (MPEP §2143 Rationale B) of one nucleic acid containing sample (a biological sample containing nucleic acid of a pathogen) for a different nucleic acid containing sample (a “PCR product” [0128]) which both contain the relevant component of a nucleic acid that can be targeted. Therefore, the invention as a whole of claims 133-134 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Response to Amendments
The previous rejection of claim 134 under 35 U.S.C. 102 is withdrawn, because Cai does not teach all of the limitations of method (II) of claim 133 (upon which claim 134 depends) and claim 134 in a single embodiment. However, upon further consideration, Cai teaches all of the limitations of claims 133 and 134 (specifically the method (II), claimed in the alternative to methods (I) and (III)) across multiple embodiments that would be obvious to combine, so a new ground of rejection is made over Cai.
New, Necessitated by Amendment
Claim 131 is rejected under 35 U.S.C. 103 as being unpatentable over Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, as applied to claims 119-120, 130, and 132-133 above, and in view of Wittwer et al. (“Rapid Cycle DNA Amplification” In: Mullis, K.B., Ferré, F., Gibbs, R.A. (eds) The Polymerase Chain Reaction. Birkhäuser, Boston, MA, pages 174-181 (1994)), herein Wittwer.
Regarding claim 131, Cai teaches the method of claim 119 (see 35 U.S.C. 103 rejection of claim 119) above and teaches their general method wherein each thermal cycle further comprises a total ramp time of less than 10s (“the temperature could increase or decrease sufficiently to perform OPCRar in […] more preferably less than or equal to about 8 seconds, or more preferably less than or equal to about 4 seconds. Thus an OPCRar temperature cycle could be performed in as little as, or even faster than, 8 seconds” [0116]). However, Cai does not teach explicitly teach a thermal cycle comprising incubating the amplification mixture at the first temperature for less than 2s and incubating the amplification mixture at the second temperature for less than 2s. This deficiency is made up for in the teachings of Wittwer.
Regarding claim 131, Wittwer teaches incubation at denaturing and annealing temperatures for less than 2s (“Amplification yield and product specificity were optimal when denaturation (93°C) and annealing (55°C) times were less than 1 sec. There was no advantage to longer denaturation or annealing times” page 175 left column paragraph 2) and that no elongation time was necessary for short amplification sequences around 100 bp (“Fragments around 100 bp usually require no specific elongation time; extension is apparently adequate during the transition from annealing to denaturation, even with rapid cycling” page 175 right column paragraph 1). As the method of Cai is a 2-step PCR method where extension happens during the oscillation between denaturation and annealing temperatures (equivalent to the claimed first and second temperatures) and the extension is of about 100 bp (amplicon is 140 bp and the primers are 47 or 49 bp), this teaching of Wittwer teaches one of ordinary skill in the art to modify the method of Cai such that the incubation at each of the first and second temperatures is less than 2s.
In view of Wittwer’s teaching that no advantage is gained from denaturation or annealing times of more than 1 sec, one of ordinary skill in the art would be motivated to perform the simple substitution of less than 1 second denaturation and annealing times taught by Wittwer for the 5 second denaturation (80°C) time and the 5 second annealing (65°C) time of the method taught by Cai in order to gain the advantage of a faster reaction time (8 seconds less each cycle, saving 5 minutes and 20 seconds in the 40 cycle method, see Cai [0129]) (MPEP §2143 Rationales B and G). One of ordinary skill in the art could perform this substitution, as it merely involves changing the duration of a step, and would have a reasonable expectation of success because Wittwer teaches that there is no advantage to larger durations and because extension would be expected to successfully occur during the ramp between the denaturing and annealing temperatures due to the extension being of about 100 bp and not be dependent on the 5 second incubation time at the denaturation and annealing temperatures in the method Cai. Therefore, the invention as a whole of claim 131 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Response to Amendments
The amendment of claim 131 to require that each thermal cycle further comprises a total ramp time of less than 10 seconds requires a limitation which is taught in Cai. However, the rejection of claim 131 under 35 U.S.C. 102 is withdrawn because Cai does not teach that each thermal cycle comprises incubation at the first and second temperatures for less than 2 seconds, which is clearly required in the amended claim 131, whereas it previously had not been clearly required prior to the amendment. Therefore, the new ground of rejection is necessitated by amendment. Upon further consideration, a new ground of rejection is made over Cai in view of Wittwer.
New, Necessitated by Amendment
Claim 129 is rejected under 35 U.S.C. 103 as being unpatentable over Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, as applied to claims 119-120, 130, and 132-133 above, and in view of Cheng et al. (US 2016/0053305, published 25 February 2016, effectively filed 19 August 2014), herein Cheng, and Goel (US 2009/0246834, published 1 October 2009, effectively filed 13 May 2004).
Regarding claim 129, Cai teaches the method of claim 119 (see 35 U.S.C. 103 rejection of claim 119) above, wherein the ratio of the length of the amplified sequence and the length of at least one of the primers is in the range of about 30-60% (“to generate a 140 bp sequence” [0117]; “HLBForSh LENGTH: 47” [0254-0255]; “HLBRevSh LENGTH: 49” [0257]). Cai also teaches that their method has the advantage in speed and reliability over isothermal amplification methods and the advantage of simpler instrumentation requirements over normal PCR methods (“By minimizing the temperature differentials encountered during thermal cycling, OPCRar combines the speed and reliability of PCR with the lowered instrumentation requirements of isothermal amplification methodologies” [0096]). However, Cai does not teach that the amplified sequence is about 20-50 base pair (bp) long. This deficiency is made up for in the teachings of Cheng and Goel.
Regarding claim 129, Cheng teaches the amplification of amplified sequences that are about 20-50 bp long (“A short synthetic RNA molecule of 22 nucleotide long (RNA1, 5′ GCAUCAGCGACACACUCAAGAG), which mimics the size of naturally existing miRNAs, was annealed to the 3′ portion of a longer synthetic RNA […] then mixed with reverse transcription reagents […] and incubated according to the manufacturer’s recommendation […] reverse transcription reaction was added to a qPCR reaction containing 1× DyNamo qPCR mastermix and 250 nM each of PCR primers (PCR1: 5′GCATCAGCGAC and PCR2: 5′CTCTTGAGTGTG)” [0094], note that the sequence amplified by the primers is the 22 bp long RNA1 sequence). Cheng also teaches that the amplification of short RNAs is desirable despite being difficult (“While short RNAs are of great interest in a large number of biological contexts, amplification and detection of short RNAs can be difficult” [0058]). However, the amplification of a 20-50 bp long sequence, as taught by Cheng, cannot be directly done with the method of Cai, because Cai does not teach their method with short enough primers to amplify a 50 or less bp sequence, instead teaching that longer primers are preferable (“In the OPCRar system, however, primers are preferably designed to be unusually long at 35-55 base pairs, with a melting temperature preferably between 70-80.° C. in order to raise the temperature of the annealing stage” [0104], the shortest sequence non-overlapping OPCRar primers could amplify would be 70 bp). Though this may suggest that the method of Cai is incompatible with amplification of short sequences like those of Cheng, in view of the benefits taught by Cheng (being able to amplify and detect short RNAs that are of interest) and the benefits taught by Cai (speed, reliability, and relatively simple instrumentation) one of ordinary skill in the art would be motivated to look for art that can bridge the gap between the teachings of Cai and Cheng by modifying the annealing/denaturing temperatures of nucleic acids like in Cai while permitting the primers to be short enough to amplify short RNA targets like in Cheng. This deficiency is made up for in the teachings of Goel.
Regarding claim 129, Goel teaches a method of using tension applied to nucleic acids in order modify the annealing and denaturing temperatures of a PCR reaction such that they are brought close together independent of the design of the primers (“Adjusting the amount of tension applied to DNA enables performance of PCR at temperatures well below the amount required for denaturation in conventional PCR. This effect permits PCR using low amplitude thermal cycling” [0053], see also all of [0050-0054], [0054] teaches various denaturing and annealing temperatures that can be achieved using the method of Goel). Goel also teaches their method also provides various advantages over standard PCR, such as being able to more accurately amplify GC rich and repeat DNA sequences (“Nano-PCR™ permits accurate replication of not only normal target templates but also difficult sequences (e.g. GC rich DNA, tandem repeat, microsatellite or trinucleotide repeat DNA) to be replicated and amplified with substantially increased accuracy relative to conventional PCR” [0047]).
Therefore, regarding claim 129, by combining the method of Goel with the method of Cai and teachings of Cheng, one of ordinary skill in the art would be able to perform the fast and reliable method of Cai (teaching the limitations of claim 119 and the ratio of the length between amplified sequence and primers) with primers that are shortened sufficiently to allow for amplification of the desirable small RNA sequences taught by Cheng (such as the 22 bp sequence) by using the tension taught by Goel to obtain the denaturing and annealing temperatures of the method of Cai despite having shortened the primers.
The combination of Cai, Cheng, and Goel would have been obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention. Cai teaches advantages of their method of amplifying DNA (speed and reliability) that would motivate one of ordinary skill in the art to use it on sequences that are desirable to amplify, such as the short RNAs taught by Cheng. The seeming incompatibility of the methods of Cai and Cheng alone would motivate one of ordinary skill in the art to solve the particular problem of needing to alter denaturing and annealing temperatures without using long primers. Goel teaches a solution to this motivating problem by using tension to alter denaturing and annealing temperatures independent of the primer design, and additionally teaches that their method also provides the advantage of improving the accuracy of amplification of difficult sequences. This advantage and solution to a motivating problem would motivate one of ordinary skill in the art to combine the teachings of Goel with the teachings of Cai and Cheng. One of ordinary skill in the art would have a reasonable expectation of success in the combination of Cai, Cheng, and Goel as discussed above because the method of Cai is based on a minimized temperature differential during thermal cycling (Cai [0096]) and Goel teaches that their method enables PCR using temperatures that are close together (“low amplitude thermal cycling” Goel [0053]), demonstrating their compatibility and allowing the primers to be shortened (due to no longer having to be long to raise the annealing temperature) as necessary to amplify the desirable short sequences taught by Cheng. Therefore, the invention as a whole of claim 129 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Response to Amendments
The amendment of claim 129 to require that the amplified sequence is about 20-50 bp overcomes the previous rejection of claim 129 because this limitation is not taught by Cai, so the rejection is withdrawn. However, upon further consideration, a new ground of rejection of claim 129 is made over Cai in view of Cheng and in view of Goel.
New, Not Necessitated by Amendment
Claims 135-138 are rejected under 35 U.S.C. 103 as being unpatentable over Cai et al. (U.S. Patent Application Publications Cite No 1 in IDS filed 21 July 2022)(US 2014/0045221, published 13 February 2014, effectively filed 20 April 2011), herein Cai, and in view of Cheng et al. (US 2016/0053305, published 25 February 2016, effectively filed 19 August 2014), herein Cheng, and Goel (US 2009/0246834, published 1 October 2009, effectively filed 13 May 2004), as applied to claim 129 above, and further in view of Ahern (“Biochemical, Reagent Kits Offer Scientists Good Return On Investment” The Scientist, July 24, 1995) and as evidenced by NEB_strand_displacement (New England Biolabs, https://www.neb.com/en-us/products/m0257-vent-exo-dna-polymerase#Protocols---Manuals---Usage).
Regarding claim 135, Cai teaches a method for amplifying a target nucleic acid molecule comprising a plurality of components comprising a thermostable polymerase and a pair of oligonucleotide primers, wherein the pair of primers are configured to amplify, through PCR, an amplification region in the target nucleic acid, and wherein the pair of oligonucleotide primers each has a Tm, and the Tm value of each primer of the pair of oligonucleotide primers differs from each other by less than 1°C, and wherein at least one of the primers has an elongation terminus where the polymerase adds nucleotides during the PCR, and wherein the primer has G or C at the elongation terminus (see 35 U.S.C. 102 rejection of claim 127 above, which contains all of the above limitations via its dependency on claim 119); and wherein the thermostable polymerase comprises strand displacement activity (“Strand Displacement +++” NEB_strand_displacement page 2). However, Cai does not teach that the primers are configured to amplify and amplification region that is specifically about 20-50 base pairs (bp). The combination of the teachings of Cai with the teachings of Cheng and the teachings of Goel though make up for this deficiency and teach the method of Cai modified to amplify an amplification region of about 20-50 bp (see 35 U.S.C. 103 rejection of claim 129 above). However, the teachings of Cai, Cheng, and Goel do not teach a kit comprising the components of this method. This deficiency is made up for in the teachings of Ahern.
Regarding claim 135, Ahern teaches that a kit supplies all the necessary reagents for a particular application and provides detailed instructions to follow, and that kits are advantageous because they are convenient and save time (section titled “The Kit Concept”, starting page 21 far right column).
Regarding claim 136, the combination of Cai, Chen, Goel, and Ahern teach the kit of claim 135 (see 35 U.S.C. 103 rejection of claim 135 above), and Cai teaches their method wherein at least one of the primers has a G/C content in the range of about 40%-60% (“(SEQ ID NO 14) […] HLBForSh” [0254]; “(SEQ ID NO 16 […] HLBRevSh” [0257]; SEQ ID NO 14 on pages 19-20 has G/C content 47%, SEQ ID NO 16 on page 20 has G/C content 45%); or wherein each primer comprises an elongation terminus where the polymerase adds nucleotides during the PCR, and wherein at least one of the primers has a G/C content of at least 40% in a continuous 5-nucleotide region including the elongation terminus (SEQ ID NO 16 on page 20 ends in AAGCC at the 3’ elongation terminus, which is a 60% G/C content). Additionally, Cheng teaches the use of primers about 10-25 nucleotides long for amplifying short target sequences (“PCR primers (PCR1: 5′GCATCAGCGAC and PCR2: 5′CTCTTGAGTGTG)” [0094]). Additionally, as discussed in the 35 U.S.C. 102 rejection of claim 121, NEB_temp provides evidence that the thermostable polymerase has an optimal temperature within ±5°C of a melting temperature of at least one of the primers.
Regarding claim 137, the combination of Cai, Chen, Goel, and Ahern teach the kit of claim 135 (see 35 U.S.C. 103 rejection of claim 135 above), and Cai teaches their method wherein the polymerase is a DNA polymerase (as claimed in the alternative in line 15 of instant claim 137). Additionally, Cai teaches additional options for polymerases that may be used in their method, including Bst Polymerase ([0072]) and Taq DNA polymerase ([0061]).
Regarding claim 138, the combination of Cai, Chen, Goel, and Ahern teach the kit of claim 135 (see 35 U.S.C. 103 rejection of claim 135 above), and Cai teaches their method, further comprising a buffer solution suitable for the polymerase (“10×OPCRar Buffer” [0119]), or wherein the kit further comprises a single strand binding protein (SSB) wherein the SSB protein is originated from a bacteria or phage and the amplification mixture comprises the SSB at a concentration of about 1-50µg/mL and the amplification mixture has a volume of about 1-30 µL (“0.2 µL Et SSB, Extreme Thermostable Single Stranded Binding Protein (500 µg/mL)” [0127]; “20 µL OPCRar solution was set up by mixing:” [0117], so the concentration in the mixture was 5µg/mL), or wherein the polymerase is Vent (exo-) DNA polymerase and wherein the first temperature is in the range of about 70-80°C and the second temperature is in the range of about 55-70°C (“VentR (exo-) DNA Polymerase” [0126]; “oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129]), or wherein each thermal cycle further comprises a total ramp time of less than 10s (“OPCRar temperature cycle could be performed in as little as, or even faster than, 8 seconds” [0116]), or wherein the amplification region has a first melting temperature and wherein the first temperature is in the range of ±5°C of the first melting temperature (see 35 U.S.C. rejection of claim 122 over Cai as evidenced by Oligo Calculator), or wherein the pair of primers have an average melting temperature, and wherein the second temperature is in the range of ±5°C of the average melting temperature (“HLBForSh […] Tm: 75.6° C” [0254-0255]; “HLBRevSh […] Tm: 75.5° C” [0257], so the average melting temperature 75.55°C; “oscillating between 80° C. for 5 seconds, and 65° C. for 5 seconds” [0129], interpreting 80° C as the second temperature), or wherein one of the pair of primers has a second melting temperature and the other one of the pair of primers have a third melting temperature, and wherein difference between the second and third melting temperatures is less than about 3°C (“HLBForSh […] Tm: 75.6° C” [0254-0255]; “HLBRevSh […] Tm: 75.5° C” [0257]).
The combination of Cai, Cheng, and Goel would be obvious for the same reasons as discussed in the 35 U.S.C. 103 rejection of claim 129. Further, one of ordinary skill in the art would be motivated by Ahern’s teaching that kits provide the advantages of convenience and time saving to combine the teachings of Ahern with the combination of Cai, Cheng, and Goel in order to obtain these advantages. One of ordinary skill in the art would have a reasonable expectation of success in this combination because the packaging of components and inclusion of instructions taught by Ahern does not affect the fundamental principles underlying the method taught by the combination of Cai, Cheng, and Goel. Therefore, the invention as a whole of claims 135-138 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Response to Amendments
Claim 135 (upon which claims 136-138 depend) has been amended to limit the difference in Tm between the primers and to require that at least one of the primers have a G or C at the elongation terminus. While these amendments overcome the previous rejection using Cai, since the primers in the embodiment of the previous rejection had Tms >1°C apart, the rejection is Cai teaches a different embodiment wherein the primers have Tms <1°C apart and one of the primers has a C or G at its elongation terminus. However, the rejection is withdrawn because neither Cai nor Ahern teach primers configured to amplify an amplification region of about 20-50 bp. Upon further consideration, a new a ground of rejection is made over Cai in view of Cheng, Goel, and Ahern.
Response to Arguments
Applicant's Remarks filed 2 September 2025 have been fully considered and they are persuasive in part. However, a new ground of rejection has been to replace every withdrawn rejection under 35 U.S.C. 102 or 103.
On pages 17-18 of Applicant’s Remarks, Applicant responds to objections to the drawings, specification, and claims and to rejections under 35 U.S.C. 112. These responses are addressed immediately following each relevant section of this action.
On page 18 of Applicant’s Remarks, Applicant states the claims rejected under 35 U.S.C. 102 and 103 in the previous Office Action and notes that claims have been amended to recite a limitation on the difference in Tm between the primers as well as a limitation on the primer structure that at least one primer has an elongation terminus with G or C at the elongation terminus. Applicant submits where support for the claim amendments can be found. See Response to Amendments following each rejection under 35 U.S.C. 102 or 103 where these amendments are addressed.
On pages 18-19 of Applicant’s Remarks, Applicant states that the claims are directed to an improvement of denaturation bubble mediated isothermal chain displacement amplification by rapidly changing the reaction temperature and cites Examples 1-7 and 10 of the instant specification as demonstrating various listed mechanisms by which the efficiency and rate of the amplification is improved and Examples 9-14 as verifying the method and its advantages. Applicant's argument is not persuasive because they do not clearly point out the patentable novelty which he or she thinks the claims present in view of the state of the art disclosed by the references cited. Further, they do not show how the amendments avoid such references.
On page 19 of Applicant’s Remarks, Applicant asserts that the OPCRar method of Cai relies on increasing annealing temperature of primers to reduce the temperature difference and allow PCR thermal cycling in a smaller temperature range, in contrast to the inventive concept of the instant application involving the reduction of the melting temperature of the target nucleic acid sequence to enable PCR amplification at lower temperature conditions. Applicant thus contends that the approach taught by Cai and that claimed in the instant application are fundamentally different. However, it is noted that the inventive concept asserted here is not required by any claim. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Therefore, the difference asserted by Applicant here does not distinguish the claims over the prior art and is not persuasive.
On page 19 of Applicant’s Remarks, Applicant argues that the length of amplification fragments varies between Cai and the instant application, pointing out that, in the present application, the length of amplification primers is 10-25 bp and the length of the amplification product is 20-50 bp. Applicant also asserts a use of the primers. Applicant notes that the primers of Cai are 35-70 bp, so an amplification length is no less than 70 bp. This argument is persuasive, insofar as it pertains to any claims that require primers of 10-25 bp or an amplification product of 20-50 bp. Since claims 129 and 135-138 require an amplification product of about 20-50 bp, the rejections of claim 129 under 35 U.S.C. 102 and claims 135-138 under 35 U.S.C. 103 are withdrawn. However, upon further consideration, a new ground of rejection of claim 129 is made over Cai in view of Cheng and in view of Goel and of claims 135-138 over Cai in view of Cheng, in view of Goel, and in view of Ahern.
One pages 19-20 of Applicant’s Remarks, Applicant argues that Cai’s method is based on a combination of nucleic acid destabilizers and primers with high Tm and that Cai fails to teach the optimization of the Tm value difference between amplification primers and their GC content, further arguing that Cai teaches primers with AT rich 3’ region instead of GC rich 3’ region. Applicant also contends that Ahern does not teach optimization of amplification primers and so does not address the alleged deficiencies in Cai. Applicant concludes by contending that the teachings of Cai and Ahern would lead one of ordinary skill in the art to use nucleic acid destabilizers and include AT rich 3’ region in primers to increase the efficiency and rate of amplification instead of optimizing the Tm value difference between amplification primers and including a G or C at the elongation terminus of the primers as claimed in the amended claims. However, in Example 1, Cai recites an OPCRar assay using a primer with a GC rich 3’ region ending with a G or C at the elongation terminus and with primers that are highly optimized for the Tm value difference between amplification primers, differing by only 0.1°C. Therefore, these limitations fail to distinguish the claims from the art of Cai and the argument is unpersuasive.
Conclusion
Claims 119-138 are rejected. This action is NON-FINAL.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jeffrey Lawrence Bellah whose telephone number is (571)272-1024. The examiner can normally be reached M-Th, 7:30-5 ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571)272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEFFREY BELLAH/Examiner, Art Unit 1683
/ANNE M. GUSSOW/Supervisory Patent Examiner, Art Unit 1683