authorDETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s amendment filed April 2, 2026, amending claims 1-2, 4-5, 8-10, 12, 16-119, 122-131, 135-139 and 141, and canceling claims 3, 6-7, 11, 15 and 120-121 is acknowledged. Claims 1-2, 4-5, 8-10, 12 and 16-119 and 122-145 are pending.
Claims 130-145 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Claims 29, 34-36, 38-44, 46-47, 50-56, 58, 61-71, 80, 83, 97-101, 105-106, 111, 113, 117 and 119 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected species, there being no allowable generic or linking claim.
Claims 1-2, 4-5, 8-10, 12, 16-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-96, 102-104, 107-110, 112, 114-116 and 118, and 122-129 are under examination along with the species Mad7 and Cas9 PNMEs, VHH 7d12 CRD, Cys6 and His10 EEs and a donor DNA that introduces a stop codon in the CXCR4 gene.
Withdrawn Rejections
The amendment to claim 1 requiring the CRD, EE and PNME to be fused together through a series of peptide linkages (i.e., a fusion protein) overcomes the §102 rejections over Roche1. The closest claim in the previous claim set to amended claim 1 is canceled claim 11 and the claims that require the fusion protein to be genetically encoded, like claim 122. However, canceled claim 11 also required a hapten binding domain. The claim amendments overcome all previous §103 rejections. However, the claims are still rejected under §103 over Roche1 in view of Deng. The §103 rejections presented below are new, as necessitated by amendment to claim 1, but are similar to previous rejections of claims that recite fusion proteins with domains in a specific order. Therefore, to the extent that Applicant’s arguments apply to the new rejections, they are addressed following the §103 rejections.
The amendment to claim 1 overcomes the previous §112(a) rejection of claims 4-5. However, the claims are still rejected under §112(a) for new matter based on the combination of limitations recited in claims 1 and 4 and 5. See §112(a) section below.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 8 and 10 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 8 recites “The fusion protein of claim 2, wherein the domains are linked in the order of any one of the following (a) PNME-CRD-EE, (b) CRD-PNME-EE, (c) EE-CRD-PNME, (d) PNME-hapten binding domain-EE…” Because claim 8 depends from claim 2, which depends from claim 1, claim 8 requires a fusion protein to have all of the PNME, CRD, EE and hapten binding domain. Options (a), (b), (c), and (d) are all missing either the hapten binding domain or the CRD. Thus, those options for claim 8 do not include all the subject matter of the claims from which it depends.
Claim 10 recites “the fusion polypeptide of claim 1, wherein one or more of the domains are physically linked by one or more peptide linkers, or one or more chemical cross-linkers. Claim 1 requires the domains to be a fusion protein “physically linked by protein ligation through peptide linkers in between a N-terminus and a C-terminus”. Thus claim 10 has two deficiencies under § 112(d). The embodiment of the domains being linked through one or more peptide linkers does not further limit the subject matter of claim 1. The embodiment of the domains physically linked though one or more chemical cross-linkers eliminates the option for peptide linkers, and as such, does not include all the limitations from claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 22 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 22 recites “the fusion polypeptide of claim 1, where the hapten binding domain is located…” “The hapten binding domain” lacks clear antecedent basis” because claim 1 does not recite a hapten binding domain.
To remedy the indefiniteness, it is suggested that claim 22 depend from claim 2, which does recite a hapten binding domain.
Claim Rejections - 35 USC § 112(a) – New Matter
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 4-5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a NEW MATTER rejection that is new and necessitated by amendment to claim 1.
MPEP 2163.II.A.3.(b) states, “when filing an amendment an applicant should show support in the original disclosure for new or amended claims” and “[i]f the originally filed disclosure does not provide support for each claim limitation, or if an element which applicant describes as essential or critical is not claimed, a new or amended claim must be rejected under 35 U.S.C. 112a, as lacking adequate written description". According to MPEP § 2163.I.B, "While there is no in haec verba requirement, newly added claim limitations must be supported in the specification through express, implicit, or inherent disclosure" and "The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117".
As amended, claims 4-5 now require 1) a fusion protein comprising a cell recognition domain (CRD), an endosome escape domain (EE), and a polynucleotide-modifying enzyme domain (PNME) and 2) a bispecific scaffold that binds non-covalently to the CRD and the PNME. Claim 5 also requires that the bispecific scaffold comprises a hapten and its hapten-binding domain (HBD). The combination of the fusion protein comprising a CRD-EE-PNME together with a bispecific scaffold (hapten-HBD) that noncovalently binds to both the CRD and the PNME appears to be new matter. No specific basis for this limitation was identified in the specification, nor did a review of the specification by the examiner find any basis for the limitation.
The Specification only recites “bispecific scaffold” three times and all three are in [0003]. Although paragraph [0003] includes embodiments where the CRD, EE and PNME are linked in a fusion protein, [0003] does not include the bispecific scaffold in those embodiments. Additionally, paragraph [0003] discusses embodiments where the HBD is part of the fusion protein, which is not encompassed by a non-covalent attachment. It is not clear why a bispecific scaffold that links the CRD and PNME is even necessary because claim 1 already requires the CRD and PNME to be linked by peptide bonds in a fusion protein. Since no basis has been identified, the claims are rejected as incorporating new matter.
Response to Arguments - § 112(a)
Applicant argues that the amendment to claim 1 renders the §112(a) rejection for lack of written description moot (Remarks, page 25). This argument has been fully considered. While the argument is persuasive as it pertains to the previous §112(a) rejection, the combination of the amendment to claim 1 requiring a fusion protein with the CRD and the PNME and the bispecific scaffold non-covalently linking the CRD and PNME is new matter and also not sufficiently described in the specification.
Claim Rejections - 35 USC § 103 – Roche1 in view of Deng
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124 and 126-129 are rejected under 35 U.S.C. 103 as being unpatentable over Roche1 (Roche et al., Receptor Mediated Delivery of Cas9-Nanobody Induces Cisplatin Synthetic Dose Sensitivity. bioRxiv (2018): 389122; of record) in view of Deng (Deng et al., Oncotarget (2017), 8: 38568-38580; of record). Claims 23-24 and 82 are evidenced by Doudna (US 20140068797 A1). Clams 25-26 are evidenced by Manzano (Manzano et al., Biotechnology Progress (2021), 37:e3104). Claims 30-31 are evidenced by van Lith (van Lith et al., European Journal of Pharmaceutics and Biopharmaceutics (2018), 124: 63-72). Claim 37 is evidenced by Schmitz (Schmitz et al., Structure (2013), 21: 1214-1224). This is a new rejection necessitated by amendment.
Claim 22 is indefinite for the reasons recited above in paragraph 15. For the purpose of compact prosecution, claim 22 is interpreted as depending from claim 2 which does recite a hapten binding domain.
Regarding claim 1, 10, 17 and 19, Roche1 teaches Cas9NLS with 6 C-terminal cysteines (6Cys) (page 4, ¶3). The Specification defines Cys6 as an endosomal escape protein (EE) (Table 3). Roche1 teaches Cas9-6Cys chemically conjugated to the 7D12 nanobody (i.e., a cell recognition domain) at the N-terminus of Cas9 (Fig 1). Roche1 teaches the 6Cys is at the C-terminus and the 7D12 nanobody conjugated to the N-terminus (Fig 1). Thus, Roche teaches 7D12*Cas9-6Cys, wherein - = a peptide bond and * = a non-peptide bond.
Although Roche1 teaches that 7D12*Cas9-6Cys fusions, Roche1 conjugates the 7D12 nanobody to the N-terminus after recombinant protein production and purification. Roche1 does not teach the entirety of the 7D12-Cas9-6Cys as a fusion protein all linked through peptide bonds.
Deng teaches a genetically encoding fusion protein comprising 7D12 nanobody and connected to the N-terminus of a protein of interest to be delivered to cancer cells through a flexible linker (Figure 1). Deng teaches the 7D12 fusion protein successfully delivered to the target cancer cell (Figures 4-5).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have produced 7D12 fused to the Cas9-6Cys as a fusion protein in cells. It would have amounted to using known fusion protein production techniques to produce obvious rearrangements of known protein domains to yield predictable results. The skilled artisan would have predicted that a 7D12-Cas9-6Cys fusion protein could be produced because Deng teaches that 7D12 can be genetically conjugated instead of chemically conjugated to a protein of interest to be delivered to target cells. The skilled artisan would have been motivated to do so in order to save a step of post-translational conjugation of 7D12 to the Cas9-6Cys protein.
Regarding claims 2 and 22, Roche1 also teaches a 7D12-Cas9NLS-MAV conjugate (page 4, ¶2). Roche1 teaches MAV is a monoavidin domain (i.e., a hapten binding domain) that can bind biotinylated donor DNA which is desirable for promoting homology directed repair (HDR) (page 4, ¶2).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included a MAV domain at the C-terminus of the 7D12-Cas9-6Cys fusion protein rendered obvious of claim 1. It would have amounted to the simple combination of known protein domains that are known to function as a component of a fusion protein by known means to yield predictable results. The skilled artisan would have predicted that the MAV domain could be added to the C-terminus of the 712D-Cas9-6Cys fusion protein because all components can be genetically encoded, as evidenced by Roche1 and Deng, and Roche1 teaches such a fusion protein without the 6Cys domain. The skilled artisan would have been motivated to do so to provide additionally functionality to the Cas9 complex, including recruiting donor DNA to the target site as taught in Roche1.
Regarding claims 8-9, 16, 18 and 20-21, it would have been obvious to one skilled in the art before the effectively filing date of the claimed invention to have rearranged the domains in the 7D12-Cas9-6Cys(-MAV) in the fusion proteins rendered obvious for claims 1 and 2. It would have amounted to the simple rearrangement of parts/domains in Roche1’s, Deng’s and the obvious fusion protein, which is prima facie obvious and considered routine. See MPEP 2144.04.VI.A. There is no indication in Specification or the prior art that a change in the order of domains would change the function of the fusion protein. Additionally, the skilled artisan would have predicted that the domains could easily be rearranged since each domain can be genetically encoded and rearranging coding sequences is routine in the art.
Regarding claim 12, Deng teaches a (G4S)3 linker (i.e., a non-structural linker domain) in between the 7D12 nanobody domain and the protein of interest (Figure 1).
Regarding claims 23-24, Roche1 teaches the molecular weight of the 7D12 nanobody is 15 kDa. Roche1 teaches the Cas9 is SpCas9 (page 9). Doudna teaches the sequence of SpCas9 (Fig 3A). Although Roche1 does not disclose the sequence of the NLS on Cas9NLS, the longest NLS sequences known to be appended to Cas9 are bipartite NLSs, such as: PKKKRKVEDPKKKRKVD (i.e., 17 amino acids). Using an online MW calculator (https://web.expasy.org/compute_pi/), the MW of SpCas9NLS-Cys6 is 161 kD and the MW of the (G4S)3 linker in Deng is 0.964 kD. Thus, the MW of the 7D12-Cas9NLS-6Cys fusion protein rendered obvious for claim 1 and including a flexible linker is approximately 177 kD.
Regarding claims 25-26, Roche1 teaches the 7D12 nanobody does not substantially increase the Cas9 hydrodynamic radius (page 4, ¶1). Manzano teaches the hydrodynamic diameter of SpCas9 is between 9-30 nm (i.e., a hydrodynamic radius between 5-15 nm) (Figure 5). Because Roche1 teaches the 7D12 nanobody does not substantially increase the Cas9 hydrodynamic radius, the obvious 7D12-Cas9NLS-6Cys fusion protein rendered obvious for claim 1 is less than 100 and less than 90 nm.
Regarding claims 27-28, Roche1 teaches the 7D12 nanobody binds the EGFR receptor (i.e., the CRD binds to an epitope of a cell surface receptor) (page 7, ¶1).
Regarding claim 30-31, although Roche1 teaches that the 7D12-Cas9-Cys6 is taken up via receptor-mediated internalization (page 5, ¶3-4), Roche1 is silent about what pathway the complex is internalized. Van Lith teaches the 7D12 VHH nanobody binds EGFR (Abstract). Van Lith teaches 7D12 binding to EGFR induces clathrin-mediated endocytosis (Section 3.3). Therefore, the obvious 7D12-Cas9NLS-6Cys fusion protein of claims 1/27/28 is reasonably expected to be internalized by clathrin-mediated endocytosis that is triggered by binding of the VHH 7D12 nanobody to EGFR.
Regarding claims 32-33, the receptor is not a component of the claimed fusion protein. As such, limitations limiting the receptor expression in cells is interpreted as limiting the possible receptors that the fusion protein can functionally bind to. Roche1 teaches EGFR, which the VHH 7D12 nanobody can bind to, is expressed on some cancer cells but not on others (page 3, ¶3). Therefore, the obvious 7D12-Cas9NLS-6Cys fusion protein of claims 1/27 is reasonably expected to bind to a receptor that is expressed on some cancer cells but not on others.
Regarding claim 37, Roche1 does not recite the epitope on EGFR to which the 7D12 VHH nanobody binds. Schmitz teaches the 7D12 VHH nanobody binds to EGFR vIII (Table 1). Therefore, the obvious 7D12-Cas9NLS-6Cys fusion protein of claims 1/27 would reasonably be expected to bind the EGFR vIII epitope.
Regarding claims 45, 48 and 49, the fusion protein rendered obvious for claim 1 comprises the 7D12 VHH nanobody, which is also a protein ligand.
Regarding claims 57 and 59, the fusion protein rendered obvious for claim 1 comprises the 6Cys endosome escape domain, which comprises 6 cysteines (i.e., between 3 and 9 amino acids, between 3 and 8 cysteines).
Regarding claim 60, the fusion protein rendered obvious for claim 1, 7D12-Cas9NLS-6Cys, comprises an NLS.
Regarding claims 72-76, the limitations directed to characteristics of the hapten binding domain, as in “can bind to a hapten that is covalently….” are considered functional limitations of the hapten binding domain. As such, the hapten-conjugated peptide, proteins and oligonucleotides are not required elements of the composition. Roche1 teaches that monoavidin can bind biotin (i.e., a hapten) (page 4, ¶2), which can be attached any biomolecule. Thus, the fusion protein comprising 7D12-Cas9-6Cys-MAV rendered obvious above for claim 2 has the function of binding to biotin that is covalently attached to proteins, peptides of oligonucleotides.
Regarding claim 77, 79, 81, 84, 85 and 86, the fusion protein rendered obvious for claim 1, 7D12-Cas9NLS-6Cys, comprises Cas9 (i.e., a Class II Cas programmable endonuclease that cleaves double-stranded DNA).
Regarding claim 78 the fusion protein comprising 7D12-Cas9-MAV-6Cys rendered obvious above comprises Cas9, which Roche1 teaches is programmed by the sgRNA to target a DNA.
Regarding claim 82, Roche1 does not teach what type of ends Cas9 creates when cleaving double stranded DNA. However, Doudna teaches Cas9 creates blunt ends (FIG 10). Therefore, the fusion protein rendered obvious for claim 1, 7D12-Cas9NLS-6Cys, comprises a nuclease that creates the target dsDNA to create a blunt end.
Regarding claims 78 and 89-91, Roche1 teaches the 7D12-Cas9NLS-6Cys composition mixed with a Cas9 single guide RNA (i.e., a programmable noncovalently bound type II guide oligonucleotide derived from a crRNA and tracrRNA) to form a ribonucleoprotein (RNP) (Fig 1A, blue line; page 11, ¶1).
Regarding claims 92-94 and 96, Roche1 teaches the sgRNA was synthesized with 5’ and 3’ 2-O-Me and phosphorothioate backbone modifications (i.e., non-canonical nucleotides with 2’-OMe modifications at the 2’ position of the sugar moieties at the 1, 2, n-1 and n positions) (page 8, ¶4).
Regarding claim 114, Roche1 teaches the 7D12-Cas9NLS-6Cys composition does not comprise any sugar-derived polymer when being transfected (page 11, ¶1-2). Additionally, Deng teaches the purifying the 7D12 fusion protein (page 38576, ¶6). There is no indication that the purified fusion proteins contained any PEI, PEG, PAMAN or any sugar derivative after purification or when applied to in vitro cells. Thus, the skilled artisan would reasonably expect that the fusion protein rendered obvious for claim 1 also would be free of PEI, PEG, PAMAN or sugar derivatives.
Regarding claim 115, the fusion protein rendered obvious for claim 1, 7D12-Cas9NLS-6Cys, comprises six consecutive cysteines, which is SEQ ID NO 26).
Regarding claims 122-124 and 126, the teachings of Roche1 and Deng are recited above. Roche1 teaches plasmids (i.e., vectors) encoding the Cas9-6Cys protein (page 9, ¶2) and the 7D12 nanobody (page 9, ¶1). Roche1 teaches introducing the plasmids encoding Cas9-6Cys and 7D12 into BL21 (DE3) cells (i.e., a host E. coli cell) (page 9, ¶1-2). Deng teaches plasmids encoding the 7D12 fusion protein (page 38576, ¶6). The obviousness of including the 7D12 as a genetically encoded domain fused to the Cas9-6Cys is recited above for claim 1.
Regarding claims 127-129, the specification does not provide a special definition for the term "kit”, thus "kit" is interpreted as merely the sum of its contents. The obviousness of including the 7D12 as a genetically encoded domain fused to the Cas9-6Cys is recited above for claims 1 and 122. It also would have been obvious to include the sgRNA and donor DNA used with the Cas9-6Cys taught in Roche1 together in a kit together with the obvious fusion protein, vector encoding the fusion protein, or cell comprising the fusion protein since Roche1 teaches using the Cas9 fusion proteins together with such components.
Claim Rejections - 35 USC § 103 – Roche1 in view of Deng and Gill
Claims 87-88 are rejected under 35 U.S.C. 103 as being unpatentable over Roche1 (Roche et al., Receptor Mediated Delivery of Cas9-Nanobody Induces Cisplatin Synthetic Dose Sensitivity. bioRxiv (2018): 389122; of record) and Deng (Deng et al., Oncotarget (2017), 8: 38568-38580; of record) as applied to claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124, 126 and 128-129 above, and further in view of Gill (US 20180371498 A1, published December 27, 2018; of record). This is a new rejection necessitated by amendment to claim 1. It also addresses the elected PMNE nuclease, Mad7.
The teachings of Roche1 and Deng are recited above and applied as for claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124, 126 and 128-129.
Roche1 and Deng do not teach a CRISPR nuclease that is a type V or Mad7.
Gill teaches Mad7 is an engineered nucleic-acid guided nuclease (i.e., a PNME). Gill teaches the Mad7 nuclease achieved up to 100% editing efficiency (Table 3). Gill teaches the MAD nucleases including MAD7 can be fused to an NLS ([0085]). Gill teaches the MAD7 nuclease can bind guide RNAs to form a complex and targeted to a target DNA sequence ([0076]-[0077]). Gill teaches MAD7 can be delivered together with an editing template (i.e., a donor DNA) ([0091]). Gill teaches MAD7 can be delivered as a polypeptide to cells ([0101]). Gill teaches expressing Mad7 in bacterial host cells, including E. coli ([0078]). Gill teaches Mad7 PAM specificity is TTTN ([0626]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the Cas9 nuclease of Roche1 in the fusion protein rendered obvious above for the Mad7 nuclease taught in Gill. It would have amounted to the simple substitution of one known Cas nuclease for another by known means to yield predictable results. The skilled artisan would have predicted that the substitution could be made because both are single-subunit Cas endonucleases that can be expressed in bacterial host cells and fused to other domains. The skilled artisan would have been motivated to do so to target DNA sites that Cas9 cannot target due to differences in PAM preferences.
Claim Rejections - 35 USC § 103 – Roche1 in view of Deng and Cromwell
Claim 95 is rejected under 35 U.S.C. 103 as being unpatentable over Roche1 (Roche et al., Receptor Mediated Delivery of Cas9-Nanobody Induces Cisplatin Synthetic Dose Sensitivity. bioRxiv (2018): 389122; of record) and Deng (Deng et al., Oncotarget (2017), 8: 38568-38580; of record) as applied to claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124, and 126-129 above, and further in view of Cromwell (Cromwell et al., Nature Communications (2018), 9: 1448; of record). This is a new rejection necessitated by amendment to claim 1.
The teachings of Roche1 and Deng are recited above and applied as for claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124, and 126-129.
Although Roche1 teaches guide RNAs that have non-canonical nucleotides, Roche1 does not teach using bridged nucleotides in the seed sequence (i.e., the targeting sequence) of the guide RNA.
Cromwell teaches using bridged nucleic acids at specific locations in the crRNAs (i.e., guide RNAs) reduced off-target cleavage by Cas9 (Abstract). Cromwell teaches bridged nucleotides at positions 11-16 of the targeting sequence reduced off-target cleavage (Fig 1).
Regarding claim 95, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included bridged nucleotides in the spacer/targeting sequence of the sgRNA used in Roche1 together with the fusion protein rendered obvious above. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted they could be incorporated since Cromwell demonstrates synthesizing guide RNAs with the bridged nucleotides. The skilled artisan would have been motivated to include bridged nucleotides for the purpose of reducing off-target cleavage as taught in Cromwell.
Claim Rejections - 35 USC § 103 – Roche1 in view of Deng and Roche2
Claims 102-104, 107-110, 112 and 118 are rejected under 35 U.S.C. 103 as being unpatentable over Roche1 (Roche et al., Receptor Mediated Delivery of Cas9-Nanobody Induces Cisplatin Synthetic Dose Sensitivity. bioRxiv (2018): 389122; of record) and Deng (Deng et al., Oncotarget (2017), 8: 38568-38580; of record) as applied to claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124, and 126-129 above, and further in view of Roche2 (Roche et al., CRISPR Journal (2018), 1(6): 414-430; of record). This is a new rejection necessitated by amendment to claim 1.
The teachings of Roche1 and Deng are recited above and applied as for claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 114-115, 122-124, and 126-129.
Although Roche1 teaches that 7D12-Cas9-avidin fusions are useful for recruiting a biotin-conjugated donor DNA, Roche1 does not actually teach in a single embodiment a donor DNA delivered with the Cas9 fusion proteins.
Regarding claims 102-104 and 112, Roche2 teaches a Cas9-monoavidin fusion protein delivered together with a biotin-conjugated donor DNA (page 419, ¶4-6; Fig 2). Roche2 teaches the biotinylated donor DNA (i.e., the biotin hapten is conjugated to the donor DNA) is recruited by the monoavidin domain (i.e. the hapten binding domain) attached to Cas9 (page 215, ¶3; Fig 4). Roche2 teaches a CXCR4 donor DNA having a HindIII insert region and a single stop codon lying between two homology arms (i.e., a 5’ homology regions with sequence homologous to a sequence 5’ of a target sequence and a 3’ homology region with sequence homologous to a sequence 3’ of a target sequence (page 419, ¶4; Fig 2A, F and legend). Roche2 also teaches a donor DNA with an insert comprising a 6-repeat stop codon and a HindIII site with homology arms flanking that are homologous to the EMX1 locus (Fig 4; page 422, ¶2). Roche2 teaches high donor DNA insertion frequencies using Cas9MAV-biotin-dDNA complexes (page 425, ¶2).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included a dDNA-biotin conjugate together with the 7D12-Cas9NLS-6Cys-MAV fusion protein rendered obvious for claim 2. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that the dDNA-biotin could be transfected with the 7D12-Cas9NLS-MAV-6Cys fusion protein because Roche2 demonstrates transfection with a similar Cas9-MAV protein. The skilled artisan would have been motivated to do so because Roche1 teaches the usefulness of the MAV domain to recruit biotin-labeled DNA to the targeted site.
Regarding claims 107 and 109-110, Roche2 teaches that HDR is improved when the donor ssDNA has asymmetric homology arms (i.e., homology arms of different lengths) compared to when using ssDNA donors have arm lengths that are the same length (page 3, ¶1). Roche2 teaches generating donor DNA with asymmetric homology arms calls Fas1 and Fas2 (page 6, ¶3; Fig 2A and D). Roche2 teaches high HDR rates using the asymmetric biotinylated donor DNAs (page 7, ¶1; Fig 2D).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used a donor with asymmetric homology arms as the biotinylated donor in the 7D12-Cas9NLS-6Cys-MAV-biotin-donor complex rendered obvious for claim 102. It would have amounted to designing donor DNA using known parameters to yield predictable results. The skilled artisan would have predicted that the asymmetric donors could be combined with the 7D12-Cas9NLS-MAV-6Cys fusion protein because Roche2 teaches using the asymmetric donors with a similar composition. One would have been motivated to do so because Roche2 teaches the asymmetric donors with short homology arms are effective for HDR when biotinylated.
Regarding claim 108, Roche2 also teaches the homology arms of the Fas1 donor comprises 93 bp of homology on the 5’ arm of the Cas9 double strand break (i.e., a double strand break of a type II nuclease) and 37 bp on the 3’ arm of the Cas9 double strand break (Fig 2A; page 425, ¶2). Roche2 states that using asymmetric homology arms in ssDNA donors is also resulted in improved HDR frequencies (page 414, ¶3).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used a single stranded donor with asymmetric homology arms as the biotinylated donor in the complex rendered obvious for claim 102. It would have amounted to designing donor DNA using known parameters to yield predictable results. The skilled artisan would have predicted that the asymmetric ssDNA donors could be combined with the 7D12-Cas9NLS-MAV-6Cys fusion protein and been motivated to do so because Roche2 teaches that ssDNA donors with asymmetric homology arms have been used for sequence insertion with Cas9 previously with positive results.
Regarding claim 118, Roche2 teaches the primer for sgRNA sequence comprised GGGCAATGGATTGGTCATCC (i.e., 100% identity to SEQ ID NO 108) (Supp Table 2).
Claim Rejections - 35 USC § 103 – Roche1 in view of Deng, Gill, Genbank, Erazo-Oliveras and Iwasaki
Claim 116 is rejected under 35 U.S.C. 103 as being unpatentable over Roche1 (Roche et al., Receptor Mediated Delivery of Cas9-Nanobody Induces Cisplatin Synthetic Dose Sensitivity. bioRxiv (2018): 389122; of record), Deng (Deng et al., Oncotarget (2017), 8: 38568-38580; of record), and Gill (US 20180371498 A1, published December 27, 2018; of record), as applied to claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-94, 96, 114-115, 122-124, and 126-129, in further view of Genbank (4KRL_B, Chain B, Nanobody/VHH domain 7D12, available August 28, 2013; of record), Erazo-Oliveras (Erazo-Oliveras et al., Pharmaceuticals (2012), 5: 1177-1209; of record), and Iwasaki (Iwasaki et al., Journal of Controlled Release (2015), 210: 115-124; of record). This rejection also addresses the elected PNME nuclease, SEQ ID NO 67, and the EE that is 10His.
The teachings of Roche1, Deng and Gill are recited above and applied as for claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-94, 96, 114-115, 122-124, and 126-129. Briefly, Roche1 teaches Nb(7D12)-Cas9-NLS-6Cys in which the Nb(7D12) is conjugated to the N-terminus. Deng teaches genetically fusing Nb(7D12) to a protein of interest for delivery to cells. The obviousness of creating a 7D12-Cas9-Cys6 fusion protein is recited above for claim 1. Gill teaches the Mad7 nuclease. The obviousness of substituting Mad7 for Cas9 is recited above for claims 87-88. Gill also teaches the amino acids sequence of MAD7 in SEQ ID NO 7 (Table 6). Gill also teaches a possible NLS sequence to use with Mad7 is PKKKRKV and two or more NLSs can be used ([0085]).
Roche1, Deng and Gill do not disclose the sequence of the 7D12 VHH nanobody. Roche1, Deng and Gill do not teach a fusion protein having SEQ ID NO 67, which according to the Specification comprises IL-2 secretion sequence – 7D12 – GGGSGGGS linker – Mad7 – NLS sequence (PKKKRKVEDPKKKRKV) – TEV cleavage sequence – EE (HHHHHHHHHH).
Regarding the NLS sequence in SEQ ID NO 67, it would have been obvious to one skilled in the art before the effective filing date to have specifically used two SV40 NLSs with PKKKRKV disclosed in Gill. It would have amounted to using a known NLSs that Gill teaches are amenable to fusing Cas nuclease. The skilled artisan would have predicted that PKKKRKVPKKKRKV could be included in the obvious 7D12-Mad7-NLS-EE fusion, and been motivated to have do so because Gill suggests using the two SV40 NLSs when delivering MAD7.
Regarding the sequence of the CRD, Genbank teaches the amino acid sequence of the 7D12 VHH domain nanobody (page 2). It would have been obvious to specifically use the sequence of the 7D12 nanobody provided in Genbank when constructing the 7D12-Cas fusion protein since Genbank teaches that is the accepted sequence of the nanobody.
Regarding the use of the 10His domain as an endosomal escape domain, Erazo-Oliveras teaches cell penetrating peptides (CPPs) can deliver cell-impermeable therapeutic cargos into cells, but they often get trapped in endocytic organelles (Abstract). Erazo-Oliveras teaches incorporating histidine residues into the cargo can facilitate endosomal escape (page 1187, ¶2). Erazo-Oliveras teaches polyhistidine is known to disrupt membranes upon acidification and to enhance macromolecule release from endosomes (page 1187, ¶2). Iwasaki teaches appending 10-24 histidines into a hybrid peptide and monitoring endocytosis (Table 1). Iwasaki teaches the addition of histidines facilitates cellular uptake in a variety of cell types (Fig 2-3). Iwasaki demonstrates fusion of 16His onto a peptide, which is endocytosed and localizes to the cytoplasm (i.e., escapes the endosomal compartments) (Section 3.6). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have added at least 10 histidines onto the 7D12-Cas9-6Cys fusion protein rendered obvious for claim 1. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that the 10His tag could be added since histidines are standard amino acids and therefore genetically encoded like the 6Cys tag. One would have been motivated to do so for the purpose of increasing endosomal escape of the endocytosed 7D12-Cas9 protein as taught by Erazo-Oliveras and Iwasaki.
The sequences of the protein domains rendered obvious above is provided in OA Appendix provided in the previous office action (page 1). An alignment between the sequence of the fusion protein rendered obvious above is provided in OA Appendix provided in the previous office action (pages 2-3). The obvious fusion protein (7D12-Mad7-2xNLS-H10) comprises all of the amino acids of SEQ ID NO 47 except for 41 amino residues. Thus the obvious protein is 1415/1456, or 97.2% identical to SEQ ID NO 67.
Claim Rejections - 35 USC § 103 – Roche1 in view of Deng, Roche2 and Ruano-Gallego
Claim 125 is rejected under 35 U.S.C. 103 as being unpatentable over Roche1 (Roche et al., Receptor Mediated Delivery of Cas9-Nanobody Induces Cisplatin Synthetic Dose Sensitivity. bioRxiv (2018): 389122; of record), Deng (Deng et al., Oncotarget (2017), 8: 38568-38580; of record) and Roche2 (Roche et al., CRISPR Journal (2018), 1(6): 414-430; of record), as applied to claims 1-2, 8-10, 12, 15-28, 30-33, 37, 45, 48-49, 57, 59-60, 72-79, 81-82, 84-86, 89-94, 96, 102-104, 107-110, 112, 114-115, 118, 122-124, and 126-129 above, and further in view of Ruano-Gallego (Ruano-Gallego et al., Microbial Cell Factories (2019), 18: 47; of record).
Although Roche1, Deng, and Roche2 teaches producing the 7D12-Cas9-6Cys, Cas9MAV fusions, and 7D12-fusions in E. coli, Roche1, Deng, and Roche2 do not teach fusion proteins are secreted from the cell.
Ruano-Gallego teaches producing VHH nanobodies in E. coli (Abstract). Ruano-Gallego teaches the hemolyisin (hly) Secretion system has been used for one-step translocation of recombinant proteins from the bacterial cytoplasm to the extracellular medium (Abstract). Ruano-teaches fusing the coding sequence for the HlyA secretion signal to the coding sequence of the nanobody in a vector (Fig 1). Ruano-Gallego teaches producing recombinant nanobodies for secretion out of the E. coli host cell using the Hly system (Fig 4). Ruano-Gallego teaches that recombinant protein secretion allows the researcher to directly screen culture supernatants for the proteins of interest (page 6, last ¶).
Regarding claim 125, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included a HlyA secretion signal on to the 7D12-Cas9-6Cys fusion protein rendered obvious above for claim 1 such that the 7D12-Cas9-6Cys protein would be secreted when expressed in E. coli. It would have amounted to a simple combination of known protein domains for producing proteins by known techniques to produce to yield predictable results. The skilled artisan would have predicted that a HlyA-7D12-Cas9-6Cys fusion protein could be produced because Ruano-Gallego teaches that HylA can be genetically conjugated to other nanobodies. The skilled artisan would have been motivated to do so in order directly screen culture supernatants for the proteins of interest, as taught in Ruano-Gallego.
Response to Arguments - §103
Applicant argues that it would not have been obvious to modify Roche1 by creating a fusion protein comprising all the domains (i.e., domains linked by peptide bonds from N- to C- terminus) because Roche1 does not teach including the 7D12 nanobody in a fusion protein. Applicant also argues that the fusion protein is unexpected(ly) superior to the post-translational conjugates (pages 26-28). This argument is persuasive as it pertains to the previous §103 rejection over just Roche1. However, it is not persuasive for overcoming the rejection of the claims over Roche1 in view of Deng. Deng teaches genetically fusing the nanobody to a protein of interest with successful delivery of the fusion protein to cells of interest. Thus, the “superior” qualities of the claimed fusion protein containing the nanobody are already taught by Deng.
Applicant argues that the orientation of the nanobody is important for function and that Roche1 cannot control the site of chemical conjugation, which could affect the functionality of the targeting antibody once fused (Remarks, pages 29-30). This argument has been fully considered but is not persuasive as it pertains to the current rejection in view of Deng. Deng teaches 7D12-protein fusions comprising a flexible linker between the nanobody and protein of interest are successfully targeted the intended cell.
It is noted that Applicant does not specifically provide arguments to any of the claims that were previously rejected in view of Deng, including claims 9, 16, 18, 20, 120, 122-124, 126 and 128-129 (See Remarks, pages 30-32).
Conclusion
No claims are allowable.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635