Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
The Examiner spoke with attorney Brian Hellwig to clarify the species election of a “DNA molecule encoding a specific combination” on 10/20/2025. Applicant’s species election of a DNA molecule encoding a cap gene sequence (claim 4) over the phone is acknowledged.
Applicant's original election with traverse of a DNA molecule encoding a specific combination in the reply filed on 09/09/2025 is acknowledged. The traversal is on the ground(s) that little evidence was provided in the way of distinctness between the species. This is not found persuasive because this traversal was in support of an improper species election that was later clarified over the phone on 10/20/2025.
Applicant's original election with traverse of a host cell comprising CARE, L4-22K, and AAV Rep in the reply filed on 09/09/2025 is acknowledged. The traversal is on the ground(s) that little evidence was provided in the way of distinctness between the species. This is found to be moot as amendments to the claims filed 09/09/2025 result in all claims now reading on the elected species.
The requirement is still deemed proper and is therefore made FINAL.
Claims 1-10 and 20-22 are pending and under consideration.
Priority
Applicant’s claim for the benefit of a prior-filed foreign application GB2001484.1 filed on 02/04/2020 and PCT/GB2021/050237 filed 02/03/2021 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 8/18/2022, 12/06/2022, 10/10/2023, and 05/02/2024 are considered by the examiner.
Claim Objections
Claims 1, 5, 6, and 20 are objected to because of the following informalities: the “CARE” acronym should be spelled out prior to using the acronym. See, for example, claim 8 “Major Late Promoter (MLP)”.
Claims 5 and 6 are objected to because of the following informalities: the article (the), in “the L4 22K”, should be “a”.
Claim 6 recites “an viral Rep polypeptide” instead of “a viral Rep polypeptide” in lines 8-9.
Claim 20 is objected to because of the following informalities: “Step” in line 2 does not need to be capitalized.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-10 and 20-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1, 5, and 6 recite a “CARE element” and a “L4 22K polypeptide or variant thereof”.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The specification provides the following guidance on a “CARE element” and “L4 22K polypeptide or a variant thereof”:
“As used herein, the term "CARE" element refers to a Cis-Acting Replication Element. The CARE element is a DNA element which is capable of promoting the replication of an operably-linked DNA molecule. This replication is dependent upon the presence of the adenovirus L4 22K polypeptide or a variant thereof and optionally an E2A polypeptide or variant thereof. Without being bound by theory, it is thought that the L4 22K polypeptide or variant thereof may bind to the CARE element at one or more tttg motifs.
CARE elements comprise a Rep binding site (RBS; gcccgagtgagcacgc SEQ ID NO: 4) and a trs-like element.
The wild-type AAV CARE element comprises the AAV p5 promoter. The TATA box within the CARE element has been shown to be required for CARE amplification. The CARE element is preferably an AAV CARE element.
In the wild-type AAV genome, the CARE element includes the AAV p5 promoter, Rep binding site, the trs element and a 5' portion of the AAV rep gene. Examples of such CARE elements have previously been described by Tessier, J., et al. J. Virol. 2001; 375-383; Chadeuf, G., et al. J. Gene Med. 2000; 2:260-268; and in US2004/0014031, inter alia. The AAV CARE element is reported to be located between nucleotides 190 to 540 of wild-type AAV2 (Nony, P. et al. J ViroL 2001).
In some preferred embodiment, the CARE element is the 171 nucleotide region corresponding to nucleotides 190-361 of the AAV-2 genome. Preferably, the CARE element has the nucleotide sequence as given in SEQ ID NO: 5 or variant thereof having at least 50%, 60%, 70%, 80%, 90% or 95% sequence identify thereto and which is capable of promoting the amplification of an operably-linked DNA molecule in the presence of a L4 22K polypeptide and optionally an E2A polypeptide…In any variant of SEQ ID NO: 5, the sequences of the RBS, TATA box, and trs elements are preferably
maintained.” (pg. 14-15)
“The L4 series of transcripts encode the 100K, 33K, 22K, pVll proteins. These proteins are involved in a range of functions…The 22K protein is known to be involved in virus encapsidation. L4 genes are required for successful virus assembly, but not genomic DNA replication. It has now been found that the L422K polypeptide is involved in promoting the amplification of an operably-linked DNA molecule in a CARE-dependent manner.
As used herein, the term "L422K polypeptide" refers to the gene product of an
adenoviral L4 adenoviral L422K gene, or a variant or derivative thereof. Most preferably, the L422K polypeptide is an adenoviral L4 adenoviral L422K polypeptide. The molecular weight of the wild-type adenoviral L4 adenoviral L422K polypeptide is 22kDa” (pg. 17)
“The nucleotide sequence encoding the L422K polypeptide is preferably the nucleotide sequence given in SEQ IDNO: 7 or a nucleotide sequence encoding the polypeptide of SEQ ID NO: 6 or 8; or a variant thereof which has a nucleotide sequence having at least
80%, 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 7 or at least 80%, 90%,
95% or 99% nucleotide sequence identity to a nucleotide sequence encoding the
polypeptide of SEQ IDNO: 6 or 8, and which encodes a DNA-binding protein. Preferably, the L422K polypeptide has the amino acid sequence given in SEQ ID NO: 6
or 8, or a variant thereof which has at least 70%, 75%, 80%, 85%, 90%, 95% or 99%
amino acid sequence identity with SEQ ID NO: 6 or 8 and which is capable of promoting
the amplification of a DNA molecule operably-linked to a CARE element.” (pg. 18)
No further guidance is provided on what is considered a “variant thereof” of L4 22K.
The breadth of the claimed genus of “CARE elements” reasonably encompasses an enormously vast number of structures and reads on any DNA structure which is capable of promoting the replication of an operably-linked DNA molecule (see above from specification) (i.e., defined by function, not structure). For example, since instant SEQ ID NO: 5 is 350 nucleotides in length, the genus of “at least 50%” sequence identity to SEQ ID NO: 5 means that 175 nucleotides can be modified anywhere in the sequence (and other nucleic acids could be added).
4^175 = an enormously vast genus of about 2.29 x 10^105 possible variants sharing at least 50% identity to SEQ ID NO: 5 (www.calculator.net/exponent-calculator; last visited January 7th, 2026).
The specification does not teach how any of SEQ ID NO: 5 can be modified and still maintain the same function (i.e., how can the structure of the sequence change?). Can parts (if any) of SEQ ID NO: 5 be deleted? Substituted? Where in the sequence would these modifications occur? Can any nucleotides be added to the sequence? If so, where would these insertions be in the sequence? With the provided specification, one of ordinary skill in the art cannot determine what parts of SEQ ID NO: 5 must be conserved in order to maintain the functions of SEQ ID NO: 5. Altering 50% of a sequence (i.e., altering the structure) could significantly impact or change the resulting function.
Additionally, the specification (pg. 14-15, recited above) also discloses embodiments where the CARE element is a 171 nt region corresponding to nts 190-361 of the AAV2 genome, which is less than half the length of instant SEQ ID NO: 5 (350 nts). This sequence corresponds to the sequence taught by Salvetti (teachings discussed below) that was inserted into a CMVLacZ cassette to generate CARE.A.LacZ. As noted above, Salvetti teaches that this nt 190-361 sequence comprises the RBS and trs signals. Further, Salvetti teaches “a cis-acting replication element (CARE) was found to be comprised between nucleotides (nt) 190 and 540 of AAV-2 genome (Example 7), more precisely between nt 190 and 361 (Example 12).” [0012].
Additionally, the specification does not provide further guidance on what structures are required to be present in order for an element to be considered a “CARE” element. The specification recites that “the CARE element includes the AAV p5 promoter, Rep binding site, the trs element and a 5' portion of the AAV rep gene”. Are all these structure required to be present? Would a structure still be considered a “CARE” element if a trs element is not present (which, according to Salvetti, falls within nts 190-361 of the AAV-2, corresponding to the first 171 nts of SEQ ID NO: 5), for example? If an AAV p5 promoter is present in a plasmid, does this read on a CARE element being present in a plasmid? What 5’ portion of the AAV rep gene is required? Can any of these structures be modified in any way?
With the guidance provided by the specification and prior art, a “CARE element” reads on (and is not limited to) a nucleotide sequence of anywhere from 171 to 350 nucleotides in length, for example.
The breadth of the claimed genus of L4 22K polypeptides or “variant[s] thereof” reasonably encompasses an enormously vast number of structures and reads on any DNA structure which is capable of promoting the amplification of a DNA molecule operably-linked to a CARE element (see above from specification) (i.e., defined by function, not structure). The specification recites that preferably, the L4 22K polypeptide has an amino acid sequence that shares at least 70% identity with instant SEQ ID NO: 6 or 8, or has a nucleotide sequence that shares at least 80% identity with SEQ ID NO: 7. For example, since instant SEQ ID NO: 8 is 194 amino acids in length, the genus of “at least 70%” sequence identity to SEQ ID NO: 8 means that about 58 amino acids can be modified anywhere in the sequence (and other nucleic acids could be added).
20^58 = an enormously vast genus of about 2.88 x 10^75 possible variants sharing at least 70% identity to SEQ ID NO: 8 (www.calculator.net/exponent-calculator; last visited January 7th, 2026).
The specification does not teach how any of SEQ ID NO: 8 can be modified and still maintain the same function (i.e., how can the structure of the sequence change?). Can parts (if any) of SEQ ID NO: 8 be deleted? Substituted? Where in the sequence would these modifications occur? Can any nucleotides be added to the sequence? If so, where would these insertions be in the sequence? With the provided specification, one of ordinary skill in the art cannot determine what parts of SEQ ID NO: 8 must be conserved in order to maintain the functions of SEQ ID NO: 8. Altering 30% of a sequence (i.e., altering the structure) could significantly impact or change the resulting function.
Ng et al (Predicting the Effects of Amino Acid Substitutions on Protein Function, Annual Review Genomics Human Genetics 7: 61-80, 2006) is considered relevant prior art for having taught that non-synonymous nucleotide changes which introduce amino acid changes in the corresponding protein have the largest impact on human health. Most algorithms to predict amino acid substation consequences of protein function indicate about 25% to 30% of amino acid changes negatively affect protein function (Abstract). Existing prediction tools primarily focus on studying the deleterious effects of single amino acid substitutions through examining amino acid conservation at the position of interest among related sequences, an approach that is not directly applicable to multiple amino acid changes, including insertions or deletions. Ng et al taught that 83% of disease-causing mutations affect protein stability (e.g. pg. 63, col. 1), which in this case, would affect the ability of the enormously vast genus of about 20^58 structurally undisclosed sequence variants so as to necessarily and predictably achieve the recited biological functional properties such as being capable of amplifying a DNA molecule operably-linked to a CARE element.
Ng et al taught that while multiple sequence alignment of the homologous sequences reveals what positions have been conserved throughout evolutionary time, and these positions are inferred to be important for function (e.g. pg. 63, col. 1), Users should be cautious even with proteins that are judged to be orthologous based on phylogeny. Orthologous genes in different species are derived from a common ancestor, but they may not necessarily have the same function. If function has changed, then amino acids that are important for the function of one protein may not necessarily be important for the function of the ortholog. 2% of disease-causing mutations in human genes are identical to the sequences of their respective mouse orthologs, suggesting that even though these positions have huge phenotypic effects on human health, they have different roles or are no longer important in mice. If the orthologs in alignment have slightly different functions, then the positions that differentiate function among orthologs may be incorrectly predicted. (e.g. pg. 68, col. 1). When there are many missense mutations in the gene(s) of interest, assaying all missense mutations, which introduce amino acid changes, can be expensive and time-consuming (e.g. pg. 74, col. 1). Prediction accuracy has gradually improved, but few head-to-head comparisons exist. Moreover, as the number of servers providing AAS prediction increases, it will become increasingly difficult for investigators to interpret the predictions. (e.g. pg. 74, col. 2). Ng et al taught that the error rate of functional annotations in the sequence database is considerable, making it even more difficult to infer correct function from a structural comparison of a new sequence with a sequence database (e.g. Table 1, error rates of about 40% to 60%).
Prediction of protein structure by homology and/or algorithm is notoriously difficult, as one of ordinary skill in the art would immediately understand.
Consequently, the gap between the number of as-yet to be discovered sequences of the claimed, but not structurally disclosed, enormously vast genus of regulatory element sequence variants is considered to be tremendous, notoriously difficult, slow, very laborious and time-consuming for the ordinary artisans to determine for themselves that which Applicant has failed to disclose.
As taught by Guimet below, it is well-known in the prior art the importance of L4 22K for viral genome packaging and expression. However, the relationship between L4 22K and CARE elements is not well known in the art. The specification does not provide one of ordinary skill of the art enough guidance for what structures of a L4 22K polypeptide are required to maintain functionality.
US2004/0014031 (Salvetti, published 01/22/2004; cited in specification) is considered relevant prior art for describing a CARE element and variants of the element that may be used (i.e., different structures).
Salvetti defines a “CARE” as “a nucleotide sequence derived from the sequence from nucleotide position 190 to nucleotide position 540 of the wild-type AAV-2 genome, that promotes the replication of a nucleotide sequence to which it is operably linked, in the presence of Rep proteins (for example, Rep68) and a CARE-dependent replication inducer (CARE-DRI)” [0025] (see also [0095]). Salvetti further describes CARE in Example 12 [0144]:
“As shown in Example 7, CARE is comprised in a sequence derived from a fragment of the genome of wild-type AAV-2, including nucleotides 190 to 540 of AAV-2. A shorter sequence, corresponding to nucleotides 190 to 361 of AAV-2, and comprising the RBS and trs signals, was inserted upstream from the CMVLacZ expression cassette, generating the CARE.A.LacZ sequence. In vitro replication of this plasmid was evidenced in the presence of Rep68. To the contrary, the nucleotide sequence consisting of nucleotides 361 to 540 (referred to as CARE.B) could no longer enable Rep-dependent replication. Therefore, the CARE activity can be attributed to region A (nucleotides 190 to 360). “
Salvetti also notes “Alternatively, or complementarily, homologous recombination can be hindered by using functional variants of CARE. The functionality of such variants can be assayed for example by cloning said variant into a plasmid” [0039]. No specific sequence/SEQ ID NO for CARE is disclosed by Salvetti (other than the sequence being derived from the sequence from nucleotide position 190 to nucleotide position 540 of the wild-type AAV-2 genome). Salvetti does not disclose the use of L4 22K.
In summary, Salvetti teaches that there are different variants/structures of CARE that may have different functions, and that the term “CARE element” does not refer to a specific sequence or structure.
Chadeuf, Gilliane, et al. "Efficient recombinant adeno‐associated virus production by a stable rep‐cap HeLa cell line correlates with adenovirus‐induced amplification of the integrated rep‐cap genome." The journal of gene medicine 2.4 (2000): 260-268. (cited in specification) (referred to as Chadeuf (2000)) is considered relevant prior art for producing recombinant AAV by transiently transfecting a AAVCMVLacZ vector and supplying the adenoviral helper activities by either wild-type adenovirus or an adenoviral plasmid (pAdc) (Abstract). Chadeuf (2000) teaches a pspRC construct harbors the ITR-deleted AAV genome. In this configuration, rep gene expression is dependent upon the presence of adenoviral proteins, particularly the E1A proteins which, by trans-activating the AAV p5 promoter, initiate the cascade of events leading to AAV gene expression (pg. 263, col 1, para 1).
Although Chadeuf (2000) is cited in the specification as teaching a CARE element, there is no recitation of the a “CARE” element or cis-acting replication element found in Chadeuf (2000), or all of the components that may be included in a CARE element as described in the instant specification (e.g., trs element). Therefore, Chadeuf (2000) does not provide the ordinary artisan any further guidance on the structure of a CARE element. Additionally, Chadeuf (2000) does not specifically mention L4 22K.
Chadeuf, Gilliane, et al. "Evidence for encapsidation of prokaryotic sequences during recombinant adeno-associated virus production and their in vivo persistence after vector delivery." Molecular Therapy 12.4 (2005): 744-753. (referred to as Chadeuf (2005)) is considered relevant prior art for teaching a 350-bp sequence embedded in the p5 promoter of the AAV-2 rep gene containings a cis-acting replication element responsible for the Rep-dependent replication and packaging into AAV-2 capsids of a transiently transfected rep–cap sequence (pg. 744, col 2). Chadeuf (2005) teaches plasmid pRC, which comprises an ITR-deleted AAV2 rep-cap genomes in a plp72 plasmid (i.e., comprises a CARE element), and plasmid pDG, comprising both the AAV rep–cap genes, in which the p5 promoter region of the rep gene was partially replaced with the MMTV promoter, and the adenovirus E2a, E4, and VA1 sequences (pg. 751, “Cell Lines, Plasmids, and Viruses”). Table 1 teaches three different configurations in which the vector plasmid remained unchanged while the packaging and adenovirus helper functions (e.g., Ad.dl324, where E1 is deleted, and pXX6, which contains a mini-adenovirus genome including the E2a, E4, and VA1 sequences) varied. Chadeuf (2005) conducted a small-scale production and purified rAAV-2 particles. The results indicated that the ampR sequence was found packaged under all three conditions and represented 1 to 6% of the total vector genomes. In contrast, we found rep–cap sequences packaged at levels that were much lower, ranging from 0.3 to 1.2% of the vector genomes (data not shown) (pg. 745, col 2).
The teachings of Chadeuf (2005) are relevant to the instant case as the pDG plasmid, which has an almost complete deletion of the p5 promoter (i.e., lacks a complete CARE element), was relatively poorly encapsidated, compared to the ITR-containing vector plasmid (Table 1), supports a relationship between replication efficiency and the level of plasmid backbone sequence encapsidation in AAV-2 particles (pg. 746, col 1, para 2). Additionally, the results of Chadeuf (2005) demonstrate varying results of produced rAAV2 particles based on the AAV plasmid and help plasmids (e.g., adenovirus) used in the method with the same rep-cap plasmid (i.e., CARE element present). However, Chadeuf (2005) fails to specifically recite or teach a “CARE element” and provides no further guidance on the structures/sequences that would read on a CARE element. Additionally, Chadeuf (2005) does not specifically mention L4 22K.
Nony, Pascale, et al. "Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences." Journal of Virology 75.20 (2001): 9991-9994. (cited in specification) is considered relevant prior art for identifying the adeno-associated virus type 2 (AAV-2) rep gene (nucleotides 190 to 540 of wild-type AAV-2) as a cis-acting Rep-dependent element able to promote the replication of transiently transfected plasmids (Abstract).
Nony investigated if a rep-cap-containing plasmid was able to replicate following transient transfection into adenovirus-infected cells. 293 cells were transfected with plasmid pRCtag containing the rep-cap genome with the ITRs deleted, ligated to a 3’ tag sequence, and then mock or adenovirally infected (pg. 9991, col 1, para 2).
To identify the cis element(s) involved in pRCtag replication, Nony focused on the 5’ portion of the rep gene which includes a Rep binding site (RBS). (nucleotides [nt] 260 to 284 of wild-type AAV-2) and a trs-like motif (nt 287 of wild-type AAV-2). The presence of both elements in the ITRs is known to be essential for wild-type AAV-2 replication (pg. 9991, col 2, para 1). Additionally, the RBS and the trs-like elements contained in the p5 region were individually mutated in the pCARE.LZ1 plasmid (Fig. 4A). When tested in a replication assay, mutation of either the RBS or the trs element impaired replication of the pCARE.LZ1 plasmid despite the presence of Rep proteins and adenovirus (Fig. 4B, lanes 9 and 12). The same result was obtained upon transfection in HeRC32 cells (data not shown) (pg. 9992, col 2).
Further, to determine if CARE could also induce the amplification of an integrated sequence, a stable cell line (HeCARE.LZ) was obtained by cotransfection of pCARE.LZ1 and the PGK-Neo plasmids into HeLa cells. An increase in the lacZ copy number was observed in HeCARE.LZ cells upon adenovirus infection and transfection of plasmid pRep, but not in control He.LZ cells (Fig. 5, lanes 8 and 4). Importantly, neither adenovirus infection alone nor expression of the rep gene under the control of either the p5 (plasmid pRep) or the cytomegalovirus (CMV) promoter (plasmid pCMVRep) was sufficient to induce lacZ gene
amplification in HeCARE.LZ cells (Fig. 5, lanes 6, 7, and 13). (pg. 9993, col 1, para 2).
These results indicated that integration of CARE can lead to the amplification of an heterologous adjacent sequence and that Rep proteins are necessary together with adenovirus for
this phenomenon to occur. This finding suggests that the amplification of an integrated rep-cap genome, which shares this dual requirement, is also CARE dependent (pg. 9993, col 2).
Regarding the structure of a CARE element, the teachings of Nony point to nt 190 to 540 (350 bps) of wild-type AAV-2 (a 5’ portion of the rep gene; nt 260-284 = Rep binding site (RBS), nt 287 = trs-like motif) as “behav[ing] as a CARE element” (pg. 9991, col 2- pg. 9992, col 1). Nony notes that “these results support and extend the observation made by Tullis and Shenk (10), who demonstrated the presence of a positive cis-acting element between nt 194 and
1882 of AAV-2. Furthermore, CARE features resembled those already described for the chromosome 19 AAVS1 region that also contains an RBS and a trs element” (pg. 9993, col 1, para 1).
Further, the CARE element taught by Nony (Figure 4, lower line) shares 100% identity with nucleotides (nts) 27-100 of instant SEQ ID NO:5 (upper line), comprising at least two ‘TTTG’ motifs (bold), a TATA box (bold, underlined), an AAV-2 Rep binding site (underlined), and an AAV-2 trs-like motif (italicized, underlined), as shown below:
Qy 27 TTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACG 86
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACG 60
Qy 87 CAGGGTCTCCATTT 100
||||||||||||||
Db 61 CAGGGTCTCCATTT 74
Nony does not teach how the sequence above, or how nt 190 to 540 of wild-type AAV-2 may be altered and still be considered a CARE element, nor if there are other structures (such as the chromosome 19 AAVS1 region mentioned above) that read on the term “CARE”.
While Nony teaches the requirement of adenovirus in order for CARE to function, Nony does not specifically mention adenoviral L4 22K.
Guimet, Diana, and Patrick Hearing. "The adenovirus L4-22K protein has distinct functions in the posttranscriptional regulation of gene expression and encapsidation of the viral genome." Journal of virology 87.13 (2013): 7688-7699. is considered relevant prior art for teaching that the packaging of the viral genome into an empty capsid requires the L4-22K protein to bind to packaging sequences in cooperation with other viral proteins. Additionally, the L4-22K protein is important for the temporal switch from the early to late phase of infection by regulating both early and late gene expression (Abstract).
In addition, the adenoviral (Ad) major late promoter (MLP) drives transcription from the (major late transcription unit) MLTU regions L1 to L5, producing all late mRNAs by alternative splicing and polyadenylation of a primary transcript. The Ad L4-22K protein is thought to be the minimal factor required for MLP activation, but additional components, such as IVa2, are required to obtain the maximum activation observed at late times of infection (pg. 7688, col 1). Guimet also teaches that a novel, intermediate- phase Ad5 promoter, the L4 promoter (L4P) directs the expression of the L4-22K and L4-33K proteins independent from the MLP. L4P is active in its natural context, and the amount of L4-22K protein expressed via L4P is sufficient to induce the early-to-late transition in MLTU activity (pg. 7688, col 2). Guimet cites Wu (discussed below, reference (12) in Guimet) for teaching the construction of the delta22 virus used in the experiments, which describes the plasmid comprising the N-terminal 173 amino acids of Ad5 L4-22K, with a stop codon at the end, were under the control of the tetracycline-response element and a minimal cytomegalovirus (CMV) promoter (pg. 10475, “Cells and viruses.”, para 2 of Wu) (pg. 7690, col 1, para 1 of Guimet).
Guimet teaches the importance of the L4 22K polypeptide for viral genome packaging and viral gene expression at the posttranscriptional level, and that MLP and L4P (part of an Ad5 promoter) present in the adenoviral genome drive L4 22K expression. Guimet does not teach any relationship between CARE elements, or Ad-AAV vectors.
In light of the teachings of Guimet, it would be obvious to the ordinary artisan to include a nucleic acid encoding L4-22K in a method of making virus particles (pg. 7697, “Discussion”, para 1 and 3). Additionally, Guimet teaches using a heterologous promoter (e.g., CMV) to drive expression of L4 22K in a method of making virus particles.
Wu, Kai, Diana Orozco, and Patrick Hearing. "The adenovirus L4-22K protein is multifunctional and is an integral component of crucial aspects of infection." Journal of virology 86.19 (2012): 10474-10483. (cited in IDS) is considered relevant prior art for teaching the importance of L4-22K for temporal control of viral gene expression not only because it activates late gene expression but also because it suppresses early gene expression (Abstract).
E1A, the immediate early gene product, is expressed and transactivates the Ad early genes (E1B, E2, E3, and E4) whose products function to optimize the cellular milieu for viral replication, counteract a variety of antiviral defenses, and promote viral DNA replication. With the onset of viral DNA replication, the major late promoter (MLP) is fully activated and late gene products (L1 to L5) are synthesized to produce progeny viruses (pg. 10474, col 1, para 1).
L4-22K protein binds to viral packaging sequences in vivo and is essential to recruit two other packaging proteins, IVa2 and L1-52/55K, to this region (Abstract).
The Ad genome is packaged into the capsid, utilizing cis-acting packaging sequences (PS) located at the left end of the viral genome. The PS overlap with the E1A transcriptional enhancer region, and Ad proteins IVa2, L1-52/55K, and IIIa bind to the PS in vivo (pg. 10474, col 2, para 2).
As discussed above in Guimet, Wu teaches constructing a plasmid comprising the N-terminal 173 amino acids of Ad5 L4-22K, with a stop codon at the end, were under the control of the tetracycline-response element and a minimal cytomegalovirus (CMV) promoter in their experiments indicating that L4-22K is essential for Ad genome packaging and critical for the production of infectious progeny (pg. 10475, “Cells and viruses.”, para 2; pg. 10481, col 2, last para; pg. 10477, col 1, para 2).
Wu teaches the connection between L4 gene products (including L4 22K) and MLP, and that L4-22K aids in the function of Iva2 and L2-52/55K, which bind to cis-acting packaging sequences, while using a plasmid comprising L4-22K operably-linked to a heterologous promoter (e.g., CMV) in methods of producing viral particles. Wu does not teach a relationship between L4 22K and an AAV CARE element (i.e., another type of cis-acting element).
Recently, the U.S. Court of Appeals for the Federal Circuit (Federal Circuit) decided Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017), which concerned adequate written description for claims drawn to antibodies. These claims are usually handled in Technology Center 1600. The Federal Circuit explained in Amgen that when an antibody is claimed, 35 U.S.C. § 112(a) requires adequate written description of the antibody itself. Amgen, 872 F.3d at 1378-79. The Amgen court expressly stated that the so-called "newly characterized antigen" test, which had been based on an example in USPTO-issued training materials and was noted in dicta in several earlier Federal Circuit decisions, should not be used in determining whether there is adequate written description under 35 U.S.C. § 112(a) for a claim drawn to an antibody. Citing its decision in Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., the court also stressed that the "newly characterized antigen" test could not stand because it contradicted the quid pro quo of the patent system whereby one must describe an invention in order to obtain a patent. Amgen, 872 F.3d at 1378-79, quoting Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1345 (Fed. Cir. 2010). In view of the Amgen decision, adequate written description of a newly characterized antigen alone should not be considered adequate written description of a claimed antibody to that newly characterized antigen, even when preparation of such an antibody is routine and conventional. Id. The Amgen decision will be added to the MPEP in due course.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the CARE element is capable of promoting the replication of an operably-linked DNA molecule does not tell you anything at all about the structure (i.e., sequences) of the enormously vast genus of about 4^175 structurally and functionally undisclosed CARE elements having the functional property of being capable of promoting the replication of an operably-linked DNA molecule.
In the instant case, knowing that the L4 22K polypeptide is capable of promoting amplification of a DNA molecule operably-linked to a CARE element does not tell you anything at all about the structure (i.e., sequences) of the enormously vast genus of about 20^58 structurally and functionally undisclosed L4 22K polypeptides or variants thereof having the functional property of being capable of promoting amplification of a DNA molecule operably-linked to a CARE element.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Accordingly, this limited information is not deemed sufficient to reasonably convey to one skilled in the art that the applicant is in possession of the enormously vast genus of structurally and functionally undisclosed CARE elements and L4 22K polypeptides and variants thereof.
Claim 22 recites “wherein the MLP comprises one or more repressor elements which are capable of regulating or controlling transcription of the adenoviral late genes”.
Either this is an inherent property of (that naturally flows from) the repressor elements of claim 22, or it is not.
The claim denotes that not all of the structures/method steps of the independent claim are able to achieve the functional property(ies) recited in the dependent claim(s).
To the extent it is not an inherent property (that naturally flows) from the product/method of the independent claim, then something must change. The claim is considered to lack adequate written description for failing to recite the structure/method step(s) that are necessary and sufficient to cause the recited properties.
The limitation of “capable of regulating or controlling transcription of the adenoviral late genes” merely state a characteristic without providing any indication about how the characteristic is provided (i.e., what repressor elements lead to the recited properties). The characteristic does not follow from (is not an inherent property of) the structure recited in the claim, so it is unclear whether the claim requires some other structure to be added to the composition to provide the characteristic. The specification fails to disclose what structures (or which repressor elements) are necessary and sufficient to cause the recited properties (e.g., regulating or controlling transcription of the adenoviral late genes) and thus the ordinary artisan would not know what modification(s) must be made in order to fulfill the instant recitation.
The claims fail to recite, and the specification fails to disclose a first repressor element that is unable to regulate or control transcription of the adenoviral late genes, as opposed to a second repressor element that is necessarily and predictably capable of regulating or controlling transcription of the adenoviral late genes, for example.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function…does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not clarify the nature of the corresponding structure(s) and/or method step(s) that is/are necessary and sufficient to cause the recited functional language.
Claim Rejections - 35 USC § 112(a) – Scope of Enablement
Claims 1-10 and 20-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for
A method of amplifying a DNA molecule in a host cell, wherein the DNA molecule is operably-linked to a CARE element consisting of SEQ ID NO: 5, the method comprising the step of culturing a host cell which comprises:
(a) a first nucleic acid molecule comprising the DNA molecule operably-linked to a CARE element consisting of SEQ ID NO: 5;
(b) a second nucleic acid molecule comprising a heterologous promoter operably- associated with an amino acid sequence encoding a L4 22K polypeptide consisting of SEQ ID NO: 8, and
(c) a third nucleic acid molecule comprising a nucleotide sequence encoding an AAV Rep polypeptide, and
A process for producing virus particles, the process comprising the steps:
(a) introducing, into a host cell, an adenoviral vector comprising:
(i) a nucleic acid molecule comprising a heterologous promoter operably- associated with amino acid sequence encoding a L4 22K polypeptide consisting of SEQ ID NO: 8;
(ii) a Transfer Plasmid comprising 5'- and 3'-viral ITRs flanking a transgene;
(iii) helper genes for packaging a viral Transfer Plasmid,
the host cell comprising:
a CARE element consisting of SEQ ID NO: 5, operably-linked to
(i) an AAV cap gene; and
(ii) a nucleic acid molecule comprising a nucleotide sequence encoding a viral Rep polypeptide;
(b) culturing the host cell under conditions such that virus particles are assembled within the host cell; and
(c) harvesting packaged virus particles from the host cell or from the culture medium
does not reasonably provide enablement for
A CARE element of any structure
An L4 2KK polypeptide of any structure
The method of claim 6 (specifically, an adenoviral vector comprising a nucleic acid molecule comprising a heterologous promoter operably associated with a nucleotide sequence encoding a L4 22K polypeptide or variant thereof, and a nucleic acid molecule comprising a nucleotide sequence encoding a viral Rep polypeptide)
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention. If not, whether an artisan would have required undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make or use the invention based on the content of the disclosure is “undue” (In re Wands, 858 F.2d 731, 737, 8 USPQ2ds 1400, 1404 (Fed. Cir. 1988)). Furthermore, USPTO does not have laboratory facilities to test if an invention will function as claimed when working examples are not disclosed in the specification. Therefore, enablement issues are raised and discussed based on the state of knowledge pertinent to an art at the time of the invention. And thus, skepticism raised in the enablement rejections are those raised in the art by artisans of expertise.
The factors to be considered in determining whether undue experimentation is required are summarized in In re Wands, 858 F.2d 731, 737, 8 U.S.P.Q.2d 1400, 1404 (Fed. Cir. 1988) (a) the breadth of the claims; (b) the nature of the invention; (c) the state of the prior art; (d) the level of one of ordinary skill; (e) the level of predictability in the art; (f) the amount of direction provided by the inventor; (g) the existence of working examples; and (h) the quantity of experimentation needed to make or use the invention based on the content of the disclosure. While all of these factors are considered, a sufficient number are discussed below so as to create a prima facie case.
The Examiner incorporates herein the analysis discussed above in the 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection.
The Breadth of the Claims and The Nature of the Invention
The claims are directed toward methods of amplifying a DNA molecule in a host cell and processes for producing viral particles.
The claims are broad for reasonably encompassing an enormous genus of structures of host cells, CARE elements, and adenoviral vectors. The claims generically recite culturing the host cell “under conditions such that virus particles are assembled within the host cell”.
Claim 1, directed to a method of amplifying a DNA molecule in a host cell, only recites one method step: culturing the host cell (with no culturing conditions recited). The method steps of claims 5 and 6 are also generically recited.
The State of the Prior Art, The Level of One of Ordinary Skill and The Level of Predictability in the Art
The prior art teaches many methods for amplifying DNA molecules in a host cell/producing viral particles that comprise adenoviral vectors and AAV Rep-cap genes.
Zhang, Hongwei, et al. "Adenovirus–adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production." Human gene therapy 20.9 (2009): 922-929. is considered relevant prior art for reviewing the adenovirus-AAV infection method for scaleable rAAV production (Abstract). Zhang teaches that initially, most of the stable rep-cap cell lines were generated from parental cells that do not contain the adenovirus E1A-E1B genes that are essential to activate p5, p19, and p40 transcription units of the rep-cap genes (pg. 924, col 1, para 4). Zhang notes that it is well known in the art that adenovirus E1, E2a, E4, and VARNA genes are critical helper genes for AAV replication and packaging (pg. 924, “Helper adenovirus”). Additionally, Trans-acting factors responsible for rep-cap gene amplification were first characterized by Tessier and colleagues (2001). Their study demonstrated that host cellular DNA polymerase, but not adenoviral polymerase, was essential to rep-cap gene amplification; however, adenovirus DNA-binding protein (E2B) and Rep protein also were required for rep-cap gene amplification (pg. 925, “Trans-acting factors responsible for rep/cap gene amplification”).
Further, when investigating whether there was another cryptic cis element in the remaining AAV rep-cap sequence responsible for rep-cap gene amplification. Nony and colleagues have led the effort to address this issue, and indeed have identified this cis element in a region of the AAV2 rep gene (Nony et al., 2001). This region spans nucleotides 190 to 540 of the AAV2 genome, and functions as a cis-acting Rep-dependent element (CARE) that is capable of promoting the amplification of not only the rep-cap gene, but also of adjacent heterologous DNA sequences. Importantly, adenovirus infection and Rep protein are indispensable for the function of CARE (Nony et al., 2001) (pg. 926, col 1, para 2).
Zhang does not teach a relationship between a CARE element and a L4 22K polypeptide for amplifying DNA or producing viral particles. However, Zhang does teach that CARE requires adenovirus infection and a Rep polypeptide to function.
WO 2019020992 A1 (by Applicant, published 01/31/2019) is considered relevant prior art for teaching an adenoviral vector comprising a repressible Major Late Promoter (MLP), wherein the MLP comprises one or more repressor elements which are capable of regulating or controlling transcription of the adenoviral late genes, and wherein one or more of the repressor elements are inserted downstream of the MLP TATA box (claim 1), and a process for producing a modified mammalian cell, comprising the step of infecting the mammalian cell, which contains an AAV genome integrated in the genome of the cell, with the adenoviral vector (which may comprise a transgene which encodes an AAV Rep polypeptide, an AAV Cap polypeptide or an AAV Rep- Cap polypeptide) (claims 24-26).
Additionally, WO2019 teaches “The L4 series of transcripts encode the 100K, 33K, 22K, pVII proteins… The 22K protein is involved in virus encapsidation. L4 genes are required for successful virus assembly but not genomic DNA replication” (pg. 9), and that L4 is transcribed from the MLP (pg. 7).
Further, WO2019 teaches various methods for production of rAAV/the construction of rAAV packaging cell lines, including:
“the co-transfection of three DNA plasmid vectors into producer cell lines. The cis plasmids contain: the 1) rAAV ITRs and transgene; 2) a trans DNA plasmid encoding the AAV rep and cap; and 3) a trans DNA plasmid encoding sequences from a helper virus (e.g. adenovirus)…
A third method involves the construction of rAAV packaging cell lines where the rep and cap gene sequences are integrated into host cell genome. Typically, rAAV is produced from this method by transfection of the DNA cis plasmid encoding the AAV ITRs and transgene, followed by introduction of the helper agent (e.g. infection with helper adenoviruses). Alternatively, the helper viruses carrying the cis DNA AAV ITRS and transgenes (e.g. hybrid Ad/AAV) can be introduced into producer cell lines for production of rAAV (see US 5,856,152). The disadvantage of this method is that it requires complex engineering of producer cell lines wherein the AAV rep and cap are stably integrated and expressed to a sufficient amount…
A fourth method of producing rAAV involves the use of helper agents (e.g. helper adenoviruses) for delivery of the AAV rep and cap genes. In this method, the recombinant adenoviruses comprise rep and cap genes which are inserted into the genome of the helper virus (typically, in the E1 region of a recombinant adenovirus). These are subsequently used for infection into packaging cell lines that may contain the cis AAV DNA sequence (e.g. AAV ITRs and transgene) or the cis DNA plasmids can be introduced by methods of transfection (Zhang et al., 2001 Gene. Ther. 8(9), 704-712).” (pg. 19).
WO2019 differs from the claimed invention as it does not specifically recite “CARE elements”, only cis DNA sequences/cis DNA AAV ITRs and transgenes.
The Existence of Working Examples and The Amount of Direction Provided by the Inventor
The specification fails to provide any evidence that the method(s) as written, with a CARE element of any structure, a L4 22K polypeptide or a variant thereof, any adenoviral vector that comprises any heterologous promoter operably-associated with L4 22K or a variant thereof and a viral Rep polypeptide predictably and reliably amplify a DNA molecule in a host cell or produce viral particles. Specifically, the specification fails to provide evidence that the combination of L4 22K, a CARE element, and an AAV Rep polypeptide together are required to predictably and reliably amplify a DNA molecule in a host cell or produce viral particles.
The specification and working examples provide little guidance on the connection/relationship between L4 22K and a CARE element. The specification states:
“adenoviral late genes, i.e. L4 22K, is fundamentally required” (pg. 5) in CARE-dependent replication. “This 22K protein was previously known only as being involved in virus encapsidation. The identification of this specific inducer and its precise mechanism of action facilitates the production of novel methods of amplifying genes to which the CARE element has been juxtaposed, i.e. by the supply of L422K polypeptide” (pg. 5). Further,
“The Applicants subsequently found, however, that inhibiting the Late adenoviral genes
by repressing the Major Late Promoter in the manner described in W02019/020992 (discussed above) had the undesirable effect of inhibiting DNA amplification of the rep and cap genes from the host cell via inhibition of the CARE-dependent replication mechanism. This was result
was entirely unexpected because there are no reports that adenoviral Late gene
products are involved in CARE-dependent replication. The identification of the L422K polypeptide as the CARE element induction factor thus enables the use of an AAV production system which utilises the invention described in W020199/020992, wherein the L422K polypeptide is supplied in cis or in trans.” (pg. 5-6).
However, from the specification and prior, it is unclear how one of ordinary skill in the art would come to the conclusion that the L4 22K is a CARE element induction factor, nor what structures of an L4 22K polypeptide are required to be present to induce a CARE element. Further, the working examples provide little guidance on the matter. The working examples (beginning pg. 37) describe generating control Ad5-E1 and TERA-E1 (a recombinant replicating adenovirus wherein its modified major late promoter transcribes the repressor protein TetR, and wherein transcription from the modified major late promoter is repressed by the TetR) by molecular cloning methods and produced from HEK293. HELARC32 cells are transfected with plasmid pSF-AAV-EGFP and infected, in the presence of doxycycline or DMSO, with Ad5-E1 or TERA-E1. AAV2 particles are then harvested. Example 5 describes the same, except the HeLaRC32 cells were transfected with plasmids transcribing adenovirus L4 genes under control of the CMV promoter, and infected with TERA-E1. AAV Cap DNA was then quantified.
The plasmids and vectors of the working examples are described generically. For example, in Example 5, how would an ordinary artisan know that a CARE element is present, as the plasmids do not recite comprising such, or even any AAV sequences. Further, there is no working example that explicitly discloses a host cell comprising a CARE element, L4 22K polypeptide, and AAV Rep polypeptide, nor an adenoviral vector comprising a nucleotide sequence encoding a L4 22K polypeptide and a nucleotide sequence encoding a viral Rep polypeptide. The examples disclose AAV2 particles being quantified, but the methods do not recite what AAV genome is prevalent in the plasmid of Example 1, for example. Additionally, the structure of TERA-E1 is generically described and unclear. The specification references the invention of W020199/020992, but WO2019 does not teach what a TERA-E1 vector is (e.g., is this the TERA of Example 13, where the TERA was modified in the virus E1 deleted region to encode an rAAV genome, AAV2 ITRs flanking an EGFP expression cassette under control of the CMV promoter?). The specification of the instant case also does not provide any guidance on the structure of a TERA-E1 vector.
The specification fails to make up for the deficiencies of the global scientific community.
The Quantity of Any Necessary Experimentation to Make or Use the Invention
Thus, the quantity of necessary experimentation to make or use the invention as claimed, based upon what is known in the art and what has been disclosed in the specification, will create an undue burden for a person of ordinary skill in the art to necessarily and predictably use the claimed method comprising the broadly claimed genus of adenoviral vectors and host cells (e.g., comprising broadly claimed CARE elements, transfer plasmids, etc.) that is capable of amplifying DNA or producing viral particles.
It is generally recognized in the art that biological compounds often react unpredictably under different circumstances (Nationwide Chem. Corp. v. Wright, 458 F. supp. 828, 839, 192 USPQ95, 105(M.D. Fla. 1976); Affd 584 F.2d 714, 200 USPQ257 (5th Cir. 1978); In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970)). The relative skill of the artisan and the unpredictability of the pharmaceutical art are very high. Where the physiological activity of a chemical or biological compound is considered to be an unpredictable art (Note that in cases involving physiological activity such as the instant case, "the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved" (See In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970))), the skilled artisan would have not known how to extrapolate the examples and results provided in the instant specification to carry out the method recited in claims 1, 5, and 6 to obtain amplified DNA or produce viral particles (i.e., what must the adenovirus vector comprise? What helper genes are required? What culturing conditions must be present in order for viral particles to be assembled?).
The instant portion of the invention, as claimed, falls under the "germ of an idea" concept defined by the CAFC. The court has stated that "patent protection is granted in return for an enabling disclosure, not for vague intimations of general ideas that may or may not be workable". The court continues to say that "tossing out the mere germ of an idea does not constitute an enabling disclosure" and that "the specification, not knowledge in the art, that must supply the novel aspects of an invention in order to constitute adequate enablement". (See Genentech Inc v. Novo Nordisk A/S 42 USPQ2d 1001, at 1005). The resulting amplified DNA in host cells and produced viral particles of the claimed method comprises a genus of structurally undisclosed and variable structurally and functionally different cells and particles constitutes such a "germ of an idea".
The courts have stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in patent application. 27 USPQ2d 1662 Exparte Maizel. In the instant case, in view of the lack of guidance, working examples, breadth of the claims, the level of skill in the art and state of the art at the time of the claimed invention was made, it would have required undue experimentation to make and/or use the invention as claimed.
If little is known in the prior art about the nature of the invention and the art is unpredictable, the specification would need more detail as to how to make and use the invention in order to be enabling. See, e.g., Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1326 (Fed. Cir. 2004) ("Nascent technology, however, must be enabled with a 'specific and useful teaching.' The law requires an enabling disclosure for nascent technology because a person of ordinary skill in the art has little or no knowledge independent from the patentee's instruction. Thus, the public's end of the bargain struck by the patent system is a full enabling disclosure of the claimed technology." (citations omitted)).
As In re Gardner, Roe and Willey, 427 F.2d 786,789 (C.C.P.A. 1970), the skilled artisan might eventually find out how to use the invention after “a great deal of work”. In the case of In re Gardner, Roe and Willey, the invention was a compound which the inventor claimed to have antidepressant activity, but was not enabled because the inventor failed to disclose how to use the invention based on insufficient disclosure of effective drug dosage. The court held that “the law requires that the disclosure in the application shall inform them how to use, not how to find out how to use for themselves”.
In conclusion, the specification fails to provide any guidance as to how an artisan would have dealt with the art-recognized limitations of the claimed method(s). While amplifying a DNA molecule in a host cell, and producing viral particles, specifically producing AAV particles expressing Rep and Cap polypeptides using adenovirus-AAV hybrid systems is enabled, the prior art does not teach that L4 22K is specifically required for the functionality of CARE, what structures of CARE and L4 22K are required to maintain functionality, nor that L4 22K and a CARE element together are required to amplify DNA or produce viral particles, and therefore the claims lack enablement. Those of ordinary skill in the art would immediately recognize that the instant specification fails to establish the nexus between the broadly claimed host cell and adenoviral vector structures and the generically recited method steps of culturing and harvesting, and necessarily and predictably achieve a real-world result of amplifying DNA in the host cell and producing viral particles.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-10 and 20-22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “under conditions such that the second and third, and optionally additionally one or more of the further nucleic acid molecules, are expressed”. Claims 5 and 6 recite “culturing the host cell under conditions such that virus particles are assembled within the host cell”. The metes and bounds of these “conditions” are not clearly and precisely defined. What culturing conditions are required for the virus particles to be assembled within the host cell, vs. what culturing conditions would not result in the virus particles being assembled within the host cell? It is unclear how the recitations of “under conditions such that…” further limits the claimed invention.
Claim 10 recites “the nucleic acid molecule [comprising the nucleotide sequence encoding a viral Rep polypeptide] is not operably-associated with any other functional promoter”. It is unclear to what promoter “any other” is in reference to. For example, is the promoter referring to the “heterologous promoter” in the adenoviral vector? It is unclear what promoter the nucleic acid molecule comprising the nucleotide sequence encoding a viral Rep polypeptide may be operably-associated with. For examination purposes, claim 10 is interpreted to read on a nucleic acid molecule comprising the nucleotide sequence encoding a viral Rep polypeptide
The terms “sufficient” in claims 5 and 6, “baseline and minimal” in claim 10, and “functional” in claims 10, 20, and 21 are relative terms which renders the claims indefinite.
The terms “sufficient”, “baseline or minimal”, and “functional” are not defined by the claims, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention.
That which is “sufficient”, as opposed to not sufficient, is an arbitrary and subjective determination.
That which is “baseline or minimal”, as opposed to not baseline or minimal, is an arbitrary and subjective determination.
That which is “functional”, as opposed to not functional, is an arbitrary and subjective determination. While it is clear that the art recognizes promoters to drive transcription of its gene, the claim language encompasses promoters with very little transcriptional activity (as opposed to no transcriptional activity). While no transcriptional activity is understood to fulfill ‘not a functional promoter’, what degree of transcription of a mutant promoter falls within “functional”?
It is unclear what the metes and bounds of the claims are, as the claims and specification do not provide clarification for what would be considered “sufficient”, “baseline or minimal”, or “functional”.
Claim 21 recites the limitation " wherein the nucleotide sequence is not operably-associated with a functional promoter". There is insufficient antecedent basis for this limitation in the claim. The recitation is indefinite because there is prior reference to two different nucleotide sequences in claim 6, from which claim 21 depends upon. It is unclear which nucleotide sequence claim 21 is referring to in claim 6. Therefore, the metes and bounds of the claim is not clearly and precisely defined. It would be remedial to amend claim 21 to clarify which nucleotide sequence is being referred to. For examination purposes, claim 21 is interpreted to refer to either nucleotide sequence of claim 6.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 1-4 is/are rejected under 35 U.S.C. 103 as being unpatentable over Xiao (Xiao, Xiao, Juan Li, and Richard Jude Samulski. "Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus." Journal of virology 72.3 (1998): 2224-2232.), and further in view of Weger (Weger, Stefan, Eva Hammer, and Regine Heilbronn. "Differential contribution of adeno-associated virus type 2 Rep protein expression and nucleic acid elements to inhibition of adenoviral replication in cis and in trans." Journal of Virology 88.24 (2014): 14126-14137), Nony (Nony, Pascale, et al. "Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences." Journal of Virology 75.20 (2001): 9991-9994.), and Morris (Morris, Susan J., and Keith N. Leppard. "Adenovirus serotype 5 L4-22K and L4-33K proteins have distinct functions in regulating late gene expression." Journal of virology 83.7 (2009): 3049-3058.).
Regarding claim 1, Xiao teaches a method of producing AAV virus particles, the method comprising the step(s) of culturing a host cell comprising:
a) a first nucleic acid encoding a CARE element (e.g. Figure 1a, AAV p5 promoter) operably linked to a nucleic acid encoding AAV Rep and Cap polypeptides (e.g. Figure 1a), whereby the endogenous AAV p5 promoter inherently and naturally comprises the endogenous AAV CARE element (of instant SEQ ID NO:5);
b) a second nucleic acid encoding an adenoviral L4-22K polypeptide operably linked to an endogenous promoter, and one or more adenoviral Early gene products (e.g. Figure 1B); and
c) harvesting packaged AAV virus particles from the host cell culture medium (e.g. pgs. 2227-2228, joining para, “more rAAV particles being released into the cell culture media”; Figure 5).
Weger teaches that the AAV p5 promoter operably linked to AAV Rep- and Cap-encoding nucleic acids starts at coordinate 154 of the AAV genome (e.g. Figure 1).
Nony teaches that coordinates 227-294 of the AAV genome encoding the p5 promoter (e.g. Figure 4a) inherently and naturally comprises a CARE element that is 100% identical to nucleotides 27-100 of instant SEQ ID NO:5 (upper line), comprising at least two ‘TTTG’ motifs (bold), a TATA box (bold, underlined), an AAV-2 Rep binding site (underlined), and an AAV-2 trs-like motif (italicized, underlined), as shown below:
Qy 27 TTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACG 86
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACG 60
Qy 87 CAGGGTCTCCATTT 100
||||||||||||||
Db 61 CAGGGTCTCCATTT 74
Xiao does not teach the adenoviral L4-22K polypeptide is operably linked to a heterologous promoter.
However, prior to the effective filing date of the instantly claimed invention, Morris taught a method of producing virus particles, the method comprising the use of a nucleic acid encoding adenoviral L4-22K operably linked to a heterologous promoter, e.g. a CMV promoter (e.g. pg 3050, col. 2, Methods, Plasmids; pg 3051, col. 1-2, joining para, Results; pg 3052, col. 2, “a stable L4-22K-complementing cell line”, “production of L4-22K- virus was confirmed”).
It would have been obvious to one of ordinary skill in the art to substitute a first nucleic acid encoding adenoviral L4-22K operably linked to an endogenous promoter with a second nucleic acid encoding adenoviral L4-22K operably linked to a heterologous promoter operably linked to a nucleic acid encoding adenoviral L4-22K in a method of producing virus particles with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
An artisan would be motivated to make this substitution because Morris made a producer host cell that stably expresses L4-22K for use in a method of producing virus particles.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Regarding claim 2, the L4-22K expression vector of Morris is independently present in the producer host cell than the adenoviral vector, is a plasmid stably integrated into the host cell genome.
Regarding claim 3, Xiao teaches
a) the first nucleic acid encoding a CARE element (e.g. Figure 1a, AAV p5 promoter) operably linked to a nucleic acid encoding AAV Rep and Cap polypeptides (e.g. Figure 1a); and
b) a second nucleic acid encoding an adenoviral L4-22K polypeptide operably linked to an endogenous promoter, and one or more adenoviral Early gene products (e.g. Figure 1B).
Regarding claim 4, Xiao teaches the first nucleic acid encoding a CARE element (e.g. Figure 1a, AAV p5 promoter) operably linked to a nucleic acid encoding AAV Rep and Cap polypeptides (e.g. Figure 1a).
Claim(s) 5-10 and 20-22 is/are rejected under 35 U.S.C. 103 as being unpatentable over Xiao, Weger, Nony, and Morris, as applied to claims 1-4, and further in view of WO2019 (WO-2019020992-A1, published 01/31/2019).
The teachings of Xiao, Morris, Weger, and Nony for the rejection of claim 1-4 are incorporated below.
Regarding claims 5 and 6, Xiao, Morris, Weger, and Nony do not teach the adenoviral vector comprising a heterologous promoter operably-associated with L4 22K and a Transfer Plasmid comprising 5'- and 3'-viral ITRs flanking a transgene (i.e., in the same expression cassette).
Xiao teaches (b) culturing the host cell under conditions such that virus particles are assembled within the host cell; and (c) harvesting packaged virus particles from the host cell or from the culture medium (pg. 2226, “Production and measurement of titers of rAAV vectors.”).
Morris teaches the plasmids pCMV199KFLAG and pCMV-22/33KFLAG (expresses L4-22K and L4-33K) (pg. 3050, “Plasmids”). Morris teaches “our previous studies of the early to late transition in MLTU expression utilized plasmid pBiL1-3NheI, in which MLTU genomic sequence encoding the tripartite leader and regions L1 to L3 was placed under the control of a heterologous promoter. Full late pattern expression could be induced from this plasmid by cytomegalovirus (CMV) expression vectors encoding L4-33K and L4-100K proteins. The “33K” plasmid utilized was also capable of L4-22K expression, although L4-22K had not been proven to exist at that time” (pg. 3052, “Results”, para 1).
WO 2019020992 A1 (by Applicant, published 01/31/2019) teaches an adenoviral vector comprising a repressible Major Late Promoter (MLP), wherein the MLP comprises one or more repressor elements which are capable of regulating or controlling transcription of the adenoviral late genes, and wherein one or more of the repressor elements are inserted downstream of the MLP TATA box (claim 1), and a process for producing a modified mammalian cell, comprising the step of infecting the mammalian cell, which contains an AAV genome integrated in the genome of the cell, with the adenoviral vector (which may comprise a transgene which encodes an AAV Rep polypeptide, an AAV Cap polypeptide or an AAV Rep- Cap polypeptide) (claims 24-26).
Additionally, WO2019 teaches “The L4 series of transcripts encode the 100K, 33K, 22K, pVII proteins… 100K protein is involved in both aiding virus hexon assembly and nuclear import but may also play a role in shifting cell mRNA translation to cap-independent translation. In one embodiment of the invention, the 100K protein may be provided in trans within a cell rather than from within the virus genome. The 22K protein is involved in virus encapsidation. The 22K protein is involved in virus encapsidation. L4 genes are required for successful virus assembly but not genomic DNA replication” (pg. 9), and that L4 is transcribed from the MLP (pg. 7). Further, WO2019 teaches the adenoviral vector comprising adenovirus L4 100K protein and wherein the L4 100K protein is not under control of the MLP (claim 12).
Additionally, WO2019 teaches an adenoviral vector comprising:
(i) a nucleic acid molecule comprising a heterologous promoter operably- associated with a nucleotide sequence which encodes a L4 polypeptide or a variant thereof;
(ii) a Transfer Plasmid comprising 5'- and 3'-viral ITRs flanking a transgene (or a viral Rep polypeptide), and
(iii) sufficient helper genes for packaging a viral Transfer Plasmid (claims 2, 12, 18; Fig. 16; Example 13).
It would have been obvious to one of ordinary skill in the art to combine the teachings of WO2019 and Morris of nucleic acids encoding adenoviral L4 proteins operably-associated with heterologous promoters to arrive at a nucleic acid encoding an adenoviral L4-22K protein operably-associated with a heterologous promoter in an adenoviral vector. For example, an artisan could substitute the nucleic acid encoding adenoviral L4-100K in the vector taught by WO2019 with a nucleic acid encoding adenoviral L4-22K taught by Morris with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. Additionally, Morris teaches that the proteins are formed from alternative splicing of the major late transcription unit, and that the 22K protein is smaller (Fig. 1A).
M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
An artisan would be motivated to make this substitution because Morris made a producer host cell that stably expresses L4-22K for use in a method of producing virus particles. Additionally, Morris previously taught plasmids comprising L4-33K and L4-100K with a heterologous promoter, L4-22K and L4-33K with a heterologous promoter, and L4-100K with a heterologous promoter.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Regarding claim 7, WO2019 teaches the AAV cap gene being integrated into the host cell genome under the control of a promoter that is activated by a polypeptide that is encoded within the adenoviral vector (claims 25, 26).
Regarding claim 8, WO2019 teaches the adenoviral vector comprising a repressible Major Late Promoter (MLP) (claim 1).
Regarding claim 9, WO2019 teaches the nucleotide sequence encoding the viral Rep polypeptide being inserted into the El region of an E1/E3-deleted adenoviral vector (claims 13, 18).
Regarding claim 10, WO2019 teaches a nucleotide sequence encoding the viral Rep polypeptide (claims 13, 18).
Regarding claims 20 and 21, WO2019 teaches “preferably, the transgene [e.g., Rep] is operably associated with one or more transcriptional and/or translational control elements (e.g. an enhancer, promoter, terminator sequence, etc.)” (pg. 17, para 1). However, as written, the teachings of WO2019 also read on the nucleotide sequence encoding a viral Rep polypeptide (or a nucleotide sequence in claim 6) not being operably- associated with a functional promoter, as “preferably” does not mean required, and the transgene may be operably associated with a terminator but not promoter, for example, as written.
Regarding claim 22, WO2019 teaches the MLP comprising one or more repressor elements which are capable of regulating or controlling transcription of the adenoviral late genes, and wherein one or more of the repressor elements are inserted downstream of the MLP TATA box (claim 1).
Citation of Relevant Prior Art
Xiao, Xiao, Juan Li, and Richard Jude Samulski. "Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus." Journal of virology 72.3 (1998): 2224-2232. is considered relevant prior art for teaching an AAV helper plasmid which utilizes translational control of AAV Rep genes in order to obtain higher titers.
Additionally, Xiao teaches a rAAV production method which is completely free of adenovirus (Ad) helper virus. The production system uses a plasmid construct which contains a mini-Ad genome capable of propagating rAAV in the presence of AAV Rep and Cap genes. This construct is missing some of the early and most of the late Ad genes and is incapable of producing infectious Ad (Abstract; Fig. 1). Xiao hypothesized that because deletion of
promoter p5 as a cis-acting element can cause down-regulation of AAV promoters p19 and p40,
the addition of an extra copy of the p5 promoter element may up-regulate the expression of p19 and p40, resulting in the construction of plasmid pXX2, which also comprises CMV (pg. 226, “Generation of Ad helper plasmids for rAAV production”, para 1; Fig. 1). Additionally, Ad helper plasmids with E1 and E3 deletions (pBHG10), plasmids with E1 deletion, E3 deletion, and a deletion of an 8-kb DNA fragment, resulting in the destruction of hexon, penton, core protein, and Ad DNA polymerase genes (pXX5), and plasmids with the same deletions as pXX5 also comprising an additional 8.5-kb deletion at the left-hand end of the Ad genome, including the major late promoter which regulates all Ad late genes (pXX6) (pg. 2226, col 2, para 3; Fig. 1). By supplying the Ad helper functions from a defective Ad miniplasmid, Xiao completely prevented the generation of Ad particles, and this modification to the vector production scheme did not result in a decrease in rAAV production (pg. 2229, col 2, para 1).
Ostapchuk, Philomena, et al. "The L4 22-kilodalton protein plays a role in packaging of the adenovirus genome." Journal of virology 80.14 (2006): 6973-6981. is considered relevant prior art for teaching that truncation of the L4 22-kDa protein in the context of the viral genome did not reduce viral gene expression or viral DNA replication but eliminated the production of infectious virus (Abstract). Ostapchuk also demonstrated that the product of an unspliced L4 transcript, encoding the L4 22-kDa protein, is synthesized in Ad-infected cells (pg. 6978, “Discussion”).
Morris, Susan J., and Keith N. Leppard. "Adenovirus serotype 5 L4-22K and L4-33K proteins have distinct functions in regulating late gene expression." Journal of virology 83.7 (2009): 3049-3058. is considered relevant prior art for teaching the construction of expression plasmids for C-terminal FLAG-tagged L4-22K and L4-33K (pCMV-22KFLAG and pCMV-33KFLAG) in order to study the function of L4-22K and L4-33K in regulating late gene expression (pg. 3050, “Plasmids”).
293 cells transfected with L4-22K- genome showed a decrease in late structural protein production (hexon, penton, IIIa, V, and fiber) compared to cells transfected with wild-type (wt) genome (Fig. 2A and B). Expression of all late proteins from the L4-22K- genome was restored to wt levels when cells were cotransfected with an expression plasmid for L4-22KFLAG (Fig. 2A), confirming that the reduced late protein expression seen from L4-22K- genome was due solely to the lack of L4-22K expression (pg. 3051, col 2, para 2 and 3).
Morris notes that their results on late gene expression in the absence of L4-22K differ from those previously reported using the L4-22K- genome. Ostapchuk and colleagues reported no differences from the wt in replication, DBP, L1-52/55K, hexon, or penton protein levels (31). In this study we also detected no differences in replication or DBP levels, but we did detect a clear reduction in the levels of L1-52/55K, penton, and to a lesser extent, hexon. We believe the previous data do in fact show some differences in L1-52/55K and penton levels but to a considerably lesser degree than our data indicate. Morris remarks that possibly, culture conditions or HeLa cell strain differences affect the expression of host cell factors with which L4-22K needs to interact to upregulate late gene expression and hence modulate the severity of the phenotype observed. Alternatively, differences between the two studies in the effective time postinfection/posttransfection that assays were conducted may provide an explanation, since the defect in late gene expression that Morris observed diminished as the time to assay was extended (pg. 3057, col 1, para 2).
Backström, Ellenor, et al. "Adenovirus L4-22K stimulates major late transcription by a mechanism requiring the intragenic late-specific transcription factor-binding site." Virus research 151.2 (2010): 220-228. teaches a heterologous promoter (e.g., pIX, E4) operably linked to a nucleotide sequence encoding L4 22K (pg. 223, “3.3. L4-22K stimulates transcription in vitro”). Specifically, Backstrom studied the effect of the L4-22K protein on three RNA polymerase II promoters (MLP (not heterologous), pIX, and E4 (the latter two are considered heterologous promoters according to pg. 20 of specification) in one experiment. L4-22K was found to stimulate MLP transcription approximately 4-fold, activate the pIX promoter about 2-fold, while the E4 promoter was slightly repressed by the addition of L4-22K, suggesting that L4-22K is a transcriptional regulator of MLP, but its effects are not restricted to MLP (pg. 224, col 1, para 1).
Weger, Stefan, Eva Hammer, and Regine Heilbronn. "Differential contribution of adeno-associated virus type 2 Rep protein expression and nucleic acid elements to inhibition of adenoviral replication in cis and in trans." Journal of Virology 88.24 (2014): 14126-14137. compared the contributions of AAV-2 protein expression and AAV-2 nucleic acid elements to the inhibition of adenoviral replication in rAd/AAV-2 hybrid vector generation and in AAV-2–adenovirus coinfection. HEK-293 cells were transfected with pAdEasy-AAV-2 plasmids (Fig. 1 and 2). Weger teaches that inhibition of rAd/AAV-2 hybrid vector propagation mostly involves a 3’ nucleic acid element in the rep gene, while inhibition of an adenoviral genome in trans requires the Rep proteins and the AAV ITRs (“Importance”).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALLISON M JOHNSON whose telephone number is (703)756-1396. The examiner can normally be reached Monday-Friday 9am-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at (571) 272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
ALLISON M. JOHNSON
Examiner
Art Unit 1638
/ALLISON MARIE JOHNSON/ Examiner, Art Unit 1638
/Tracy Vivlemore/ Supervisory Primary Examiner, Art Unit 1638