DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 36-38, 40-42 and 49 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 10/3/25.
SEQ ID NOs: 1176 and 1185 (guide strands) and 1835 (passenger strand) in claims 1(54) and SEQ ID NO: 1915 in claim 11 are free of the prior art of record.
Upon further consideration, SEQ ID NO: 392 in claims 1 and 54 has been rejoined with the elected species and examined. A sequence search for SEQ ID NO: 392 does not appear to result in a hit against any sequence set forth in instant claim 11(61). Thus, no sequence has been rejoined from claim 11 and 61.
The non-elected SEQ ID NOs: in claims 1, 11, 54, and 61-62 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/3/25.
Specification
The amendment to the specification filed on 3/26/26 has been entered, but for future amendments please refer to paragraph and page number to assist the Office in determining where the amendments were made since there are no paragraph numbers in the specification.
The use of the term “Qiagen”; “Seqmatic”, “Triton”, “Tween”, “Bio-Rad”, “Nextflex” which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. There are over 350 pages in the specification and there are possible additional trademarks in the specification that are not mentioned above, as a courtesy to the Office due to time constraint, please review the entire specification for any additional trademarks.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See https://sispotr.icts.uiowa.edu/sispotr/tools/lookup/evaluate.html and https://ccb- web.cs.uni-saarland.de/tissueatlas/ cited in the specification. Please review the entire specification for any other hyperlinks or codes.
Response to Arguments
Any rejection or objection not reiterated herein has been overcome by amendment or applicant’s arguments. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
The period in claim 32 is used as symbol (abbreviation) for a well-known AAV vector and complies with MPEP 608.01(m).
Improper Markush Rejection
Claims 1, 54, and 61-62 and claims dependent therefrom are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
The Markush grouping of the guide and passenger strand sequence in claims 1, 54 and 62 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: it is acknowledged that the instant SEQ ID NOs: could share a common use (inhibit ATXN2 expression), however, the sequences do not share a single structural similarity because each SEQ ID NO: is directed to targeting a different microRNA (see pages 181-197 and 263-347 of the specification). For example, a sequence search for SEQ ID NO: 1185 in claim 1 does not result in a hit for any other SEQ ID NO: in the claim. Moreover, since the nucleic acid sequences are not homologous to each other, they fail to share a common structure i.e., a significant structural element. The sugar-phosphate backbone cannot be considered a significant structural element, since it is shared by all nucleic acid and/or dsRNA molecules. Therefore, the nucleic acid molecules do not share any significant structural element.
The Markush grouping of the artificial miRNA in claims 11 and 61 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: it is acknowledged that the instant SEQ ID NOs: could share a common use (inhibit ATXN2 expression), however, the sequences do not share a single structural similarity because each SEQ ID NO: is directed to targeting a different microRNA (for example, see pages 181-197 and 263- 347 of the specification). For example, a sequence search for SEQ ID NO: 1915 in claim 11 does not appear to result in a hit for any other SEQ ID NO: in the claim. Since the nucleic acid sequences are not homologous to each other, they fail to share a common structure, i.e., a significant structural element. The sugar-phosphate backbone cannot be considered a significant structural element, since it is shared by all nucleic acid and/or dsRNA molecules.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Dependent claims 3, 5, 7, 13, 15-26, 29-32, 34, 35, 56, and 57 are also rejected because they depend on these claims.
Response to Arguments
Applicant's arguments filed 3/26/26 have been fully considered but they are not persuasive.
Applicant argues that the instant claims are analogous to the issue set forth in BPAI Ex parte Narva (Appeal No. 2018-0061668) and in view of the Board decision the claims are considered a proper markush group.
Applicant’s argument is not found persuasive because Ex Parte Narva is a board decision and is not precedential and has no binding effect on examination. Applicant is reminded that each application is examined on its own merits. In addition, a search of the MPEP for determining a proper markush group does not indicate that this Board decision was cited for patent examination policy regarding markush groups. Also, there are other cases from the Board that might be considered to indicate that the claims contain an improper markush group. See Ex Parte Chettier (Appeal No. 2016-003639). In view of the guidelines set forth in MPEP 2117 for Markush claims, the claims are not considered a proper markush group.
Furthermore, the sugar-phosphate backbone and/or an antisense strand and sense strand of a dsRNA cannot be considered a significant structural element, since it is shared by all nucleic acid molecules and/or dsRNA molecules. In addition, the claimed sequences appear to be directed miRNA sequences and these sequences are well-known in the prior art to target several genes based on the seed sequence for each miRNA is complementarity with multiple genes. See Fang et al. Molecular Cell 60, 131-145, 2015 cited on an IDS. Even though they bind to a region of ATNX2 nucleotide sequence, they are also could bind to other nucleotide sequences. Tables 11-12 show a list of miRNA guide sequences with at least 25(50)% knockdown of ATXN2 and several of the instant SEQ ID NOs: do not appear to be listed in this table possibly indicating that these guide sequences have less than 25% or possibly 0% knockdown of ATNX2. If the instant SEQ ID NOs: were not listed because they had 0% knockdown, then that would also show that the dsRNA do not share a common use (inhibits activity or expression of ATXN2). Thus, the sequences do not share a single structural similarity and common use.
Applicant also argues that in view of the Board decision Ex parte Buyyarapu (Appeal 2018-0066665), the instant claims are considered a proper markush group.
Applicant’s argument is not found persuasive because Ex Parte Buyyarapu is a board decision and is not precedential and has no binding effect on examination. Applicant is remined that each case is examined on its own merits. In addition, a search of the MPEP for determining a proper markush group does not indicate that this Board decision was cited for patent examination policy regarding markush groups. Also, there are other cases from the Board that might be considered to indicate that the claims contain an improper markush group. See Ex Parte Chettier (Appeal No. 2016-003639). In view of the guidelines set forth in MPEP 2117 for Markush claims, the claims are not considered a proper markush group.
The sugar-phosphate backbone and/or an antisense strand and sense strand of a dsRNA cannot be considered a significant structural element, since it is shared by all nucleic acid molecules and/or dsRNA molecules. In addition, the claimed sequences appear to be directed miRNA sequences and these sequences are well-known in the prior art to target several genes based on the seed sequence for each miRNA is complementarity with multiple genes. See Fang et al. (supra). Even though they bind to a region of ATNX2 nucleotide sequence, they are also could bind to other nucleotide sequences. Thus, the sequences do not share a single structural similarity and common use.
In response to applicant’s argument that there is a very clear relationship between the guide and passenger strand sequences recited in the amended independent claims because the recited SEQ ID NOs: are within the same recognized chemical class of inhibitory nucleic acids comprising a guide strand and a passenger strand which form a double stranded RNA that inhibits ATXN2 activity similarly, the argument is not found persuasive because the nucleic acid sequences are not homologous to each other, they fail to share a common structure, i.e., a significant structural element. The sugar-phosphate backbone and/or an antisense strand and sense strand of a dsRNA cannot be considered a significant structural element, since it is shared by all nucleic acid molecules and/or dsRNA molecules. In addition, the claimed sequences appear to be directed miRNA sequences and these sequences are well-known in the prior art to target several genes based on the seed sequence for each miRNA is complementarity with multiple genes. See Fang et al. (supra). Even though they bind to a region of ATNX2 nucleotide sequence, they are also could bind to other nucleotide sequences. Tables 11-12 of the specification show a list of miRNA guide sequences with at least 25(50)% knockdown of ATXN2 and several of the instant SEQ ID NOs: do not appear to be listed in these tables possibly indicating that these guide sequences have less than 25% or possibly 0% knockdown of ATNX2. If the instant SEQ ID NOs: were not listed because they has 0% knockdown then that would also show that the dsRNA do not share a common use (inhibits activity or expression of ATXN2). Thus, the sequences do not share a single structural similarity and common use.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 13, 15-26, 29-32, and 34-35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The instant claims embrace an isolated nucleic acid comprising an expression construct encoding an inhibitory nucleic acid that inhibits expression or activity of ATXN2, wherein the nucleic acid comprises a guide strand comprising a nucleic acid sequence set forth in any one of several SEQ ID NOs:, wherein the nucleic acid molecule is a siRNA, duplex, miRNA, shRNA, dsRNA.
Page 64 of the as-filed specification discloses that the inhibitory nucleic acid could be an isolated miRNA. The miRNA may be a pri-miRNA, pre-miRNA, mature miRNA, or artificial miRNA. A pri-miRNA, a pre-miRNA, or a mature miRNA are found in nature (Fang et al. Molecular Cell 60, 131-145, 2015, cited on an IDS).
A search of the prior art does not disclose that SEQ ID NO: 1185 in claim 1 is a sequence for a miRNA found in nature. See miR Base in Kozomara et al. Nucleic Acid Research Vol. 47, D155- D162, 2019, cited on an IDS. Thus, it appears that none of the SEQ ID NOs: in claim 1 are directed to a known miRNA found in nature.
The specification produced nucleotide sequences that comprise a common region of nucleotides between several known species of atxn2 sequences. Then, performed a search of the sequences against known miRNA sequences looking for sequences that had a seed sequence 2-7 nts of a miRNA to find any seed sequences that were present. The specification discloses that the nucleotide sequences designed in the specification read on a sequence of a known miRNA. For example, SEQ ID NO: 1185 reads on a sequence from a miR-100. See pages 265-266 of the specification. Next, the applicant made siRNA duplexes based on those results. However, as stated above, a sequence search of publicly available miRNA sequences (SEQ ID NO: 1185) does not appear to disclose any miRNA that are 100% hits against these SEQ ID NOs: The specification does not appear to provide written description for an miRNA found in nature comprising SEQ ID NO: 1185 or any other instant SEQ ID NO:. With respect to the definition of a miRNA embracing pri-mRNA or pre-miRNA, the specification does not appear to disclose a microRNA having a hairpin comprising the instant SEQ ID NO:. A pre-miRNA or pri-miRNA has sequences that are not complementary (bulges) to a sequence. The specification does not disclose these bulges. In addition, these species of miRNA comprise a hairpin having a 5' arm and 3' arm. The specification does not describe a hairpin comprising a 5' and a 3' arm comprising SEQ ID NO: 1185. While the specification appears to have description for siRNA duplex, shRNA, dsRNA and artificial miRNA comprising these SEQ ID NOs:, the specification has written support for artificial miRNAs, but does not appear to have possession of a genus of miRNA (including miRNA found in nature) comprising any of the instant SEQ ID NOs:.
Response to Arguments
Applicant's arguments filed 3/26/26 have been fully considered but they are not persuasive because the amendment to claim 1 and the argument that the critical feature of the instant invention is the ability of the inhibitory molecule to inhibit expression or activity of ATXN2 via the combination of the guide and passenger strand does not address of the claims reading on an artificial and miRNA found in nature. A search of the prior art does not result in any miRNA found in nature having the sequences set forth in amended claim 1. The specification does not disclose that any nucleic acid molecule in amended claim 1 is directed to miRNA found in nature, but the molecules are directed to artificial miRNAs. Suggest amending claim 3 to recite “artificial miRNA”.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 11 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 11 depends on claim 1 directed to a double stranded nucleic acid molecule having a passenger and guide strand, however, claim 11 is directed to a miRNA which embraces a double stranded nucleotide sequence having a miRNA backbone. The SEQ ID NOs in claim 11 do not appear to embraced both the guide and passenger strands comprising the SEQ ID NOs: in claim 1. For example, a sequence search for a nucleic acid molecule comprising a guide strand comprising SEQ ID NO: 392 or 1176 and a passenger strand having any nucleic acid sequence set forth in SEQ ID NOs: or 1-10 insertions deletions, substitutions, mismatches, wobbles, or any combination thereof the nucleic acid set forth in SEQ ID NO: in amended claim 1 does not result in any SEQ ID NO: listed in claim 11.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 35 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). In view of pages 27 and 34 of the specification for the term "a host cell", the broadest reasonable interpretation of the term 'host cell' reads on an in vitro human cell or human comprising the nucleic acid molecule in claim 1. The claimed invention is directed to using the nucleic acid to treat a disease in humans. Thus, when the claimed nucleic acid molecule is administered to a human, the human would contain the product.
Suggest amending the term "host cell" to read on an “isolated host cell” to exclude the cell from reading a human comprising the cell.
Response to Arguments
Applicant's arguments filed 3/26/26 have been fully considered but they are not persuasive.
The arguments and cited case law (Regenxbio, Inc. v. Sarepta Therapeutics, Inc. 2026 WL 479224, Fed. Cir. Feb. 20, 2026) are directed to the claimed cell not reading on a product found in nature. It is acknowledged that the claimed cell does not read on a product found in nature. However, the rejection is not based on the claimed cell reading on a product found in nature, but the broadest reasonable interpretation of the term ‘host cell’ embraces a human having the cell. See MPEP 2105(III) Human organise are nonstatutory subject matter: Leahy-Smith America Invents Act (AIA ), Public Law 112-29, sec. 33(a), 125 Stat. 284. The term “a” before host cell is not limited to a singular cell, but reads on at least one cell having the nucleic acid molecule of claim 1. As discussed in the specification of the instant disclosure, the claimed nucleic acid molecule can be used in a human to treat a neurodegenerative disorder. Page 34 discloses that the cell is a cell of the CNS, such as a neuron, glial cell, astrocyte and microglial cell. Thus, any neuron, glial cell, astrocyte, microglial cell in a human that is administered the product would read on the human having the cell having the nucleic acid molecule and would be embraced by the claimed product. Indicating that any human having this cell comprising the nucleic acid molecule would be claimed by the applicant. The claim embraces any human having the claimed nucleic acid. In view of the breadth of the claimed product and applicant’s argument, it appears that applicant is claiming any human having a cell having this claimed nucleic acid molecule.
Claim Rejections - 35 USC § 102
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 54, 56, and 62 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bentwich (US 20070259349). ‘349 claims a hairpin, a pri-miRNA, a pre-miRNA, and a miRNA comprising a sequence selected from any one of SEQ ID NO: 1-8611 (claim 3). SEQ ID NO: 5772 (Db) of ‘349 is 100% complementary to instant SEQ ID NO: 392 (Qy). See pages 1-12 of ‘349.
Qy 1 AUAACUUCCAGUUUCGGCAAGC 22
Db 49 ATAACTTCCAGTTTCGGCAAGC 28
SEQ ID NO: 5772 and the sequence complementary thereto would read on the instant claims because hairpin RNA, pre-miRNA, and miRNA embrace a double stranded RNA comprising SEQ ID NO: 5772 and its complement. The term “artificial miRNA” in instant claim 54 does not provide any patentable weight over the nucleic acid taught by ‘349 because the claimed product embraces a miRNA comprising a sequence comprising SEQ ID NO: 392 and the sequence complementary thereto. The limitation after “optionally” in instant claim 62 is not required because it is optional.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1, 3, 5, 15, 22, 23, and 34-35 are rejected under 35 U.S.C. 103 as being unpatentable over Bentwich (‘349) as applied to claims 54, 56, and 62 above.
Bentwich teaches a dsRNA comprising instant SEQ ID NO: 392 and a sequence complementary thereto, wherein the sequence is associated with bladder cancer (abstract).
Bentwich does not specifically teach a construct comprising a sequence comprising instant SEQ ID NO: 392 and a complementary sequence thereof
Any one of the nucleic acids in claim 3 of ‘349 would embrace a double stranded nucleic acid comprising instant SEQ ID NO: 392 and the complementary sequence thereto. See Figure 1 of ‘349. The guide strand recited in instant claim 1 reads on the sequence that is complementary to SEQ ID NO: 392. ‘349 teaches a construct comprising the nucleic acid or cell comprising the nucleic acid. As shown by instant claim 15, the expression construct is broader than an expression construct having a promoter operably linked to the nucleic acid sequence encoding the inhibitory nucleic acid. The term “expression construct” is considered an intended use of the claimed product or a nucleic acid that is capable of being transcribed because the claim does not require a promoter operably linked to the nucleic acid. See paragraph 100 of the specification.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to make a construct comprising SEQ ID NO: 5772 to express in a cell (pages 3-7 of ‘349). ‘349 teaches making a vector comprising promoter operably linked to the nucleic acid (pages 4-7). The vector can be used to express the nucleic acid in a cell. It would have been obvious to one of ordinary skill in the art to make a pharmaceutical composition comprising the nucleic acid to deliver or store the nucleic acid for future usage (page 9). The limitation after the term ‘optionally’ is not required to be made obvious because the limitation is optional.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 16, 18, 19, 20, 24, 25, 26, and 29-30 are rejected under 35 U.S.C. 103 as being unpatentable over ‘349 as applied to claims 1, 3, 5, 15, 22, 23, and 34-35 above, and further in view of University of Massachusetts (WO 20161725008, of record).
‘349 disclose dsRNAs associated with bladder cancer and also teaches making a vector comprising a promoter operably linked to the nucleic acid (pages 4-7), but does not specifically teach an AAV vector comprising the dsRNA.
'008 teaches using a AAV vector to deliver a transgene to a cell or a subject, wherein the transgene is flanked by a 5' AAV ITR and a 3' AAV ITR. For example, see pages 2-3 and 13-72. The oligonucleotide can be a dsRNA, siRNA, shRNA, miRNA, or AmiRNA (page 13). The transgene can be operably linked to a promoter (pages 14-15). The AAV vector can be in a rAAV particle comprising a capsid protein (page 14). '008 discovered that transgenes comprising a hairpin-forming nucleic acids with decreased thermostability are useful for replacing mutant ITRs in self-complementary AAV vectors (pages 23-24). Hairpin-forming RNA are useful for translational expression and/or gene silencing. Hairpin-forming RNA can be a microRNA or artificial microRNA (AmiRNA). The rAAV vectors can comprise a AmiRNA having a guide strand that targets a gene related to diseases (pages 33-35). Embedding antisense RNA into endogenous miRNA scaffold to improve small RNA processing and reduce toxicity (page 43-44).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of '349 taken with '008 as a simple substitution for making an AAV comprising instant SEQ ID NO: 392 and a complementary strand thereof operably linked to a promoter to study the dsRNA in bladder cancer. See MPEP 2143(I)B. Furthermore, one of ordinary skill in the art would have been motivated to use a rAAV viral vector or a plasmid comprising an oligonucleotide comprising instant SEQ ID NO: 392 and its complement to control expression of the sequence, reduce toxicity of the vector, or decrease the exposure of the oligonucleotide to nucleases in a cell or a subject (pages 43-44 of '008). In addition, '008 teaches making a shRNA comprising an RNA molecule and it would have been simple substitution to try a dsRNA comprising the oligonucleotide comprising instant SEQ ID NO: 392 and a passenger strand to study bladder cancer. '008 teaches making rAAV vectors having an antisense embedded in a pre-miRNA backbone (pages 44-46). '008 teaches that the AAV vector can be a self-complementary (sc) AAV and serotype selected from AAV2, AAV6, AAV8, AAV9, AAVrh10 (page 55). An AAV ITR can be mutated at its terminal resolution site (TR) which inhibits replication at the vector terminus wherein the TR has been mutates resulting in a self-complementary AAV (page 15). A person of ordinary skill in the art would use AAV ITRs in the AAV vector for replication, packaging and integration of a construct comprising the dsRNA. '008 teaches rAAV comprising a pri-miRNA scaffold driven by Pol III H1 promoter and the promoter is used in the prior art to successfully express dsRNA (page 60).
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
NOTE: SEQ ID NOs: 1176 and 1185 (guide strands) and 1835 (passenger strand) in instant claim 1(54) and SEQ ID NO: 1915 in instant claim 11 are free of the prior art of record.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 5, 7, 11, 13, 15-20, 22-26, 29-32, 34-35, 54, 56-57, and 61-62 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-11, 15, 17-22, 24, 26, 28, 29, 30, 33, 34, 36, and 39 of co-pending Application No. 18263118 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of '118 recite an AAV viral vector comprising SEQ ID NO: 1. SEQ ID NO: 1 is 100% identical to instant SEQ ID NO: 1185 and SEQ ID NO: 5 is 100% identical to instant SEQ ID NO: 1835 in claim 18 of '118. In addition, SEQ ID NO: 9 in claim 18 of '118 is 100% identical to SEQ ID NO: 1915 in claims 11 and 61. Claims 22-33 of '118 make obvious dependent claims 11, 18-20, 22-26, and 29-35 directed to an rAAV particle comprising an AAV9 capsid that is capable of crossing the blood brain barrier (BBB) and 5' and 3' AAV ITRs. The claims 30-39 of '118 also make obvious a cell or composition comprising the nucleic acid. Claim 20 of '118 makes obvious making a viral vector comprising a H1 promoter as set forth in instant claims 16 and 17 because the nucleotides 113-343 of SEQ ID NO: 52 appear to comprise 113-203 to SEQ ID NO: 1552 or 1798-1888 of SEQ ID NO: 1521 in instant claim 17.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
Applicant's arguments filed 3/26/26 have been fully considered but they are not persuasive because other than stating that the applicant will address the rejection once the claims are in condition for allowance, the applicant does not address the meris of the rejection. The remarks to the provisional NSDP rejection do not comply with 37 CFR 1.111(B) and MPEP 714.02; see also 707.07(a), but is still considered a bona fide attempt and accepted as a complete response in the interest of compact prosecution.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Prosecution Insights