Prosecution Insights
Last updated: May 29, 2026
Application No. 17/796,563

COMPOSITIONS AND METHODS FOR TREATING NEURODEGENERATIVE DISEASES

Final Rejection §101§102§103§112
Filed
Jul 29, 2022
Priority
Feb 07, 2020 — provisional 62/971,873 +1 more
Examiner
WHITEMAN, BRIAN A
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Maze Therapeutics Inc.
OA Round
2 (Final)
68%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
85%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allowance Rate
784 granted / 1149 resolved
+8.2% vs TC avg
Strong +17% interview lift
Without
With
+17.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
34 currently pending
Career history
1190
Total Applications
across all art units

Statute-Specific Performance

§101
1.9%
-38.1% vs TC avg
§103
43.3%
+3.3% vs TC avg
§102
15.5%
-24.5% vs TC avg
§112
11.0%
-29.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1149 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant's election with traverse of Group I (claims 1, 3-5, 7, 13, 15-26, 29-32, 34, 35, 40-42, 49, 54, 56, 57 and 62) in the reply filed on 10/3/25 is acknowledged. The traversal is on the ground(s) that claims 11 and 61 comprise a guide strand of claim 1 or 54. This is found persuasive because applicant’s statement that a sequence (SEQ ID NO: 185) in claim 1 reads on a miRNA (SEQ ID NO: 1915) in claim 11 and 54 and group II is rejoined with group I. Applicant provides no arguments between group I and group II (now group I) and group III (now group II) and the claims in group II remain withdrawn for the reasons of record. The requirement is still deemed proper and is therefore made FINAL. Claims 36-38, 40-42 and 49 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 10/3/25. Applicant’s election without traverse of species (SEQ ID NOs: 1185, 1835 and 1915) in the reply filed on 10/3/25 is acknowledged. Upon further consideration SEQ ID NO: 1176 in claims 1, 54, and 62 has been rejoined with the elected species. The non-elected SEQ ID NOs: in Claims 1, 4, 11, 54, and 61-62 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/3/25. Drawings The drawings were received on 10/3/25. These drawings are acceptable. Specification The amendment to the specification filed on 10/3/25 has been entered. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See page 171. Claim Objections Claims 11 and 32 are objected to because of the following informalities: A hyphen is missing from line 3 between 1405-1520 and 1908-2007 in claim 11. The period in the term “AAVrh.10” should be removed in claim 32 because only one period should be at the end of the claim. Appropriate correction is required. Improper Markush Rejection Claims 1, 4, 54 and 61-62 and claims dependent therefrom are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of the guide strand sequence in claims 1, 54 and 62 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: it is acknowledged that the instant SEQ ID NOs: share a common use (inhibit ATXN2 expression), however, the sequences do not share a single structural similarity because each SEQ ID NO: is directed to targeting a different microRNA (see pages 181-197 and 263-347 of the specification). For example, a sequence search for SEQ ID NO: 1185 in claim 1 does not result in a hit for any other SEQ ID NO: in the claim. Moreover, since the nucleic acid sequences are not homologous to each other, they fail to share a common structure i.e., a significant structural element. The sugar-phosphate backbone cannot be considered a significant structural element, since it is shared by all nucleic acid molecules. Therefore, the nucleic acid molecules do not share any significant structural element. The Markush grouping of the artificial miRNA in claims 11 and 61 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: it is acknowledged that the instant SEQ ID NOs: share a common use (inhibit ATXN2 expression), however, the sequences do not share a single structural similarity because each SEQ ID NO: is directed to targeting a different microRNA (for example, see pages 181-197 and 263-347 of the specification). For example, a sequence search for SEQ ID NO: 1915 in claim 11 does not appear to result in a hit for any other SEQ ID NO: in the claim. Since the nucleic acid sequences are not homologous to each other, they fail to share a common structure, i.e., a significant structural element. The sugar-phosphate backbone cannot be considered a significant structural element, since it is shared by all nucleic acid molecules. The Markush grouping of the passenger strand sequence in claim 4 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: The sequences appear to be sequences of a ATXN2 sequence but do not share a single structural similarity or common use. The passenger strand is a homologous to a region of a ATXN2 sequence and does not have any activity since the guide strand hybridizes to the ATXN2 sequence and not the passenger strand. In addition, the sequences in the passenger strand even though the sequences are homologous to different regions of an ATXN2 sequence they do not share a common nucleotide sequence because each SEQ ID NO: is directed to targeting a different microRNA (for example, see pages 181-197 and 263-347 of the specification). For example, a sequence search for SEQ ID NO: 1185 and 1835 in claim 4 does not appear to result in a hit for any other duplex in the claim. Since the nucleic acid sequences are not homologous to each other, they fail to share a common structure, i.e., a significant structural element. The sugar-phosphate backbone cannot be considered a significant structural element, since it is shared by all nucleic acid molecules. To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Dependent claims 3, 5, 7, 13, 15-26, 29-32, 34, 35, 56, and 57 are also rejected because they depend on these claims. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 3, 4, 13, 15-26, and 29-35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The instant claims embrace an isolated nucleic acid comprising an expression construct encoding an inhibitory nucleic acid that inhibits expression or activity of ATXN2, wherein the nucleic acid comprises a guide strand comprising a nucleic acid sequence set forth in any one of several SEQ ID NOs:, wherein the nucleic acid molecule is a siRNA, duplex, miRNA, shRNA, dsRNA. Page 64 of the specification discloses that the inhibitory nucleic acid is an isolated miRNA. The miRNA may be a pri-miRNA, pre-miRNA, mature miRNA, or artificial miRNA. A pri-miRNA, a pre-miRNA, or a mature miRNA are found in nature (Fang et al. Molecular Cell 60, 131-145, 2015, cited on an IDS). A search of the prior art does not disclose that SEQ ID NO: 1185 in claim 1 is a sequence for a miRNA found in nature. See miR Base in Kozomara et al. Nucleic Acid Research Vol. 47, D155-D162, 2019, cited on an IDS. Thus, it appears that none of the SEQ ID NOs: in claim 1 are directed to a miRNA found in nature. Instant SEQ ID NO: 1185 ucggguugaa aucugaagug ug Human miR-100 PNG media_image1.png 128 420 media_image1.png Greyscale Mouse miR-100 PNG media_image2.png 126 396 media_image2.png Greyscale The specification produced nucleotide sequences that comprise a common region of nucleotides between several known species of atxn2 sequences. Then, performed a search of the sequences against known miRNA sequences looking for sequences that had a seed sequence 2-7 nts of a miRNA to find any seed sequences that were present. The specification discloses that the nucleotide sequences designed in the specification read on a sequence of a known miRNA. For example, SEQ ID NO: 1185 reads on a sequence from a miR-100. See pages 265-266 of the specification. Next, the applicant made siRNA duplexes based on those results. However, as stated above, a sequence search of publicly available miRNA sequences (SEQ ID NO: 1185) does not appear to disclose any miRNA that are 100% hits against these SEQ ID NOs:. The specification does not appear to provide written description for an endogenous miRNA comprising SEQ ID NO: 1185 or any other instant SEQ ID NO:. With respect to the definition of a miRNA embracing pri-mRNA or pre-miRNA, the specification does not appear to disclose a microRNA having a hairpin comprising the instant SEQ ID NO:. A pre-miRNA or pri-miRNA has sequences that are not complementary (bulges) to a sequence. The specification does not disclose these bulges. In addition, these species of miRNA comprise a hairpin having a 5’ arm and 3’ arm. The specification does not describe a hairpin comprising a 5’ and a 3’ arm comprising SEQ ID NO: 1185. While the specification appears to have description for siRNA duplex, shRNA, dsRNA and artificial miRNA comprising these SEQ ID NOs:, the specification does not appear to have possession of a miRNA comprising any of the instant SEQ ID NOs:. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1, 13, 22, and 34-35 are rejected under 35 U.S.C. 101 because the claimed invention is directed to nucleic acid (SEQ ID NO: 1185) found in nature without significantly more. The claimed product reads on a composition of matter, which is one of the four statutory categories. SEQ ID NO: 1185 appears to be a sequences derived from miR-100 (pages 265-6 of the specification). A nucleotide sequence comprising SEQ ID NO: 1185 reads on a genomic sequence found in nature. See for example SEQ ID NO: 2663 in paragraph 18 of US 20140161721 that is directed to a RNA transcript found in nature. Furthermore, instant SEQ ID NO: 4 in claim 1 reads on a segment of an Ataxin 2 gene, see page 25 of US 20200140893, SEQ ID NO: 3. The courts have identified this product as a law of nature or a natural phenomenon. See Ambry Genetics, 774 F.3d at 760-61, 113 USPQ2d at 1244 in MPEP 2106.04(c). Thus, the claims recite an isolated nucleic acid that read on a sequence found in nature. The term ‘isolated’ in claim 1 does not change the structure of the claimed nucleic acid from a nucleic acid found in nature because the term does not provide any additional structures that distinguish the product from the product found in nature. Paragraph 100 of the specification provides an example of what an expression construct embraces including any type of genetic construct containing a nucleic acid (e.g., transgene) in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The broadest reasonable interpretation of the term ‘an expression construct’ does not impose any limitations on the construct and reads on a cell found in nature or any vector (e.g., plasmid, vector comprising a promoter) comprising the nucleic acid. Page 29 of the specification refers to “inhibitory nucleic acid” as a nucleic acid that comprises a guide strand sequence that hybridizes to at least a portion of a target nucleic acid, e.g., ATXN2 RNA, mRNA, pre-mRNA, or mature mRNA and inhibits is expression or activity. The term ‘inhibitory nucleic acid” and functional limitation ‘an inhibitory nucleic acid that inhibits expression or activity of Ataxin-2’ do not add any structural limitations that would distinguish the claimed product from reading on a nucleic acid found in nature because any nucleic acid sequence comprising SEQ ID NO: 1158 would inherently read on these limitations. Page 31 of the specification describes the term “guide strand” or “antisense strand sequence” as a sequence that is substantially complementary (e.g., at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary) to a region of about 10-50 nucleotides (e.g., about 15- 30, 16-25, 18-23, or 19-22 nucleotides) of the mRNA of the gene targeted for silencing. The antisense sequence is sufficiently complementary to the target mRNA sequence to direct target-specific silencing, e.g., to trigger the destruction of the target mRNA by 10 the RNAi machinery or process. In some embodiments, the antisense sequence or guide strand sequence refers to the mature sequence remaining following cleavage by Dicer. The term ‘guide strand’ does not change the structure of the nucleic acid from reading on a nucleic acid found in nature because any nucleic acid sequence comprising SEQ ID NO: 1158 would inherently have these limitations. A guide strand embraces a nucleic acid sequence that has a region that is about 10-50 nucleotides complementary to a region of mRNA or gene. The term does not limit the size of the nucleotide sequence. Thus, none of the limitations in clam 1 recite additional elements in additional to the SEQ ID NOs: that amount to significantly more than the judicial exception. Dependent claim 13 does not add any additional structural limitations because the location of the nucleic acid in a construct does not add any structural limitations to distinguish the nucleic acid from reading on a region of a nucleotide sequence found in nature. Dependent claims 22 and 34-35 read on a cell found in nature because the broadest reasonable interpretation of the term ‘vector’ or ‘pharmaceutical composition” could read on a cell comprising a genomic sequence comprising a miRNA or a region of a nucleotide sequence reading on the expression construct and does not impose any limits on the vector or composition. In addition, the nucleic acid must be placed in a composition in order to store and use it, merely reciting a construct or a vector comprising the construct thus fails to meaningfully limit the claim because it is at best the equivalent of merely adding the words “apply it” to the judicial exception. The limitation ‘a pharmaceutical acceptable carrier’ after optionally in claim 34 is not required because it is optional. Thus, the claims 1, 13, 22, and 34-35 are not patent eligible. With respect to claims 1, 3, 4, 5, 54, 56, and 62, these claims also embrace a pri-miRNA or a miRNA having two strands (a guide and passenger strand) or a mature miRNA (single stranded, guide strand), but a sequence search against publicly available database for instant SEQ ID NO: 1185 does not appear to indicate that the sequences are directed to a miRNA or a double stranded RNA found in nature. In addition, the human miR-100 and murine miR-100 are provided below to show that SEQ ID NO: 1185 does not read on either miR found in nature. See miR Base in Kozomara et al. Nucleic Acid Research Vol. 47, D155-D162, 2019, cited on an IDS. Instant SEQ ID NO: 1185 ucggguugaa aucugaagug ug Human miR-100 PNG media_image1.png 128 420 media_image1.png Greyscale Mouse miR-100 PNG media_image2.png 126 396 media_image2.png Greyscale Claim 3 indicates that the nucleic acid molecule is a miRNA. Page 64 of the specification discloses that a miRNA may be a pri-miRNA, pre-miRNA, mature miRNA, or artificial miRNA. A pri-miRNA, a pre-miRNA, or a mature miRNA are found in nature, but the search of the prior art does not disclose that SEQ ID NO: 1185 is a sequence for a miRNA found in nature. With respect to dependent claims 4, 5, and 7; these claims do not read on a pri-miRNA or a miRNA having two strands (a guide and passenger strand) found in nature because these even though a miRNA sequence can comprise a hairpin sequence which have two stem sequences, including a backbone sequence, wherein the two stem comprise one sequence which is complementary to the other sequence (passenger strand and guide strand). See Figure 1 of Fang (Molecular Cell, 60, 131-145, 2015), cited on an IDS. The passenger sequences in these claims do not appear to be the complementary sequence to the guide sequence set forth in claim 1 that would read on a miRNA found in nature. For example, SEQ ID NO: 1915 in claim 4 is not the complement sequence of SEQ ID NO: 1185 in claim 1, but a sequence that is complementary to SEQ ID NO: 1185 because the last nucleotide in both strands is a uridine. In addition, in view of a search of publicly available dates, the sequences in claims 11 and 61 do not appear to read on any nucleotide sequence (miRNA or dsRNA) found in nature Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 35 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). In view of page 34 of the specification for the term “host cell”, the broadest reasonable interpretation of the term ‘host cell’ reads on an in vitro or in vivo human cell comprising the nucleic acid molecule in claim 1. The claimed invention is directed to treating a disease in human. Thus, when the claimed product is administered to a cell in a human, the human would contain the product. Suggest amending to the term “host cell” to read on an isolated host cell to exclude the cell from reading a human comprising the cell. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3, 4, 5, 7, 11, 13, 15-20, 22-26, 29-32, 34-35, 54, 56-57, and 61-62 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-11, 15, 17-22, 24, 26, 28, 29, 30, 33, 34, 36, and 39 of co-pending Application No. 18263118 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of ‘118 recite an AAV viral vector comprising SEQ ID NO: 1. SEQ ID NO: 1 is 100% identical to instant SEQ ID NO: 1185 and SEQ ID NO: 5 is 100% identical to instant SEQ ID NO: 1835 in claim 18 of ‘118. In addition, SEQ ID NO: 9 in claim 18 of ‘118 is 100% identical to SEQ ID NO: 1915 in claims 11 and 61. Claims 22-33 of ‘118 make obvious dependent claims 11, 18-20, 22-26, and 29-35 directed to an rAAV particle comprising an AAV9 capsid that is capable of crossing the blood brain barrier (BBB) and 5’ and 3’ AAV ITRs. The claims 30-39 of ‘118 also make obvious a cell or composition comprising the nucleic acid. Claim 20 of ‘118 makes obvious making a viral vector comprising a H1 promoter as set forth in instant claims 16 and 17 because the nucleotides 113-343 of SEQ ID NO: 52 appear to comprise 113-203 to SEQ ID NO: 1552 or 1798-1888 of SEQ ID NO: 1521 in instant claim 17. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 22, 23 and 24 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by GenBank No. BQ308197.1, MR0-BT4501-280601-203-d08 BT4501 Homo sapiens cDNA, mRNA sequence retrieved on-line 12/2/25 from National Library of Medicine, 2010, 2 pages. GenBank No. BQ308197.1 disclose a nucleic acid sequence comprising instant SEQ ID NO: 1185 (Qy) Qy 1 UCGGGUUGAAAUCUGAAGUGUG 22 Db 145 TCGGGTTGAAATCTGAAGTGTG 166 The sequence was placed into PUC18 vector (plasmid) which would read on the vector in claims 22 and 23 and the pharmaceutical composition in claim 24. Paragraph 100 of the specification provides an example of what an expression construct embraces including any type of genetic construct containing a nucleic acid (e.g., transgene) in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The broadest reasonable interpretation of the term ‘an expression construct’ on a plasmid comprising SEQ ID NO: 1185. The functional limitation ‘an inhibitory nucleic acid that inhibits expression or activity of Ataxin-2’ does not add any structural limitations that would distinguish the claimed product from reading on a nucleic acid found in nature. The term ‘guide strand’ does not change the structure of the nucleic acid from reading on a nucleic acid designated GenBank No. BQ3081971. The term ‘guide strand’ does not change the structure of the nucleic acid from reading on a nucleic acid set forth above because any nucleic acid sequence comprising SEQ ID NO: 1158 would inherently have these limitations. A guide strand embraces a nucleic acid sequence that has a region that is about 10-50 nucleotides complementary to a region of mRNA or gene. The term does not limit the size of the nucleotide sequence. Although the sequence set forth in GenBank No. BQ3081971. is silent with respect to the functional limitations (an inhibitory nucleic acid that inhibits expression of ATXN2, wherein the inhibitory nucleic acid comprises a guide strand) of the nucleic acid recited in the instant claims, the sequence anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product set forth in the GenBank No. Where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 3, 13, 15, 16, 18-20, 22-26, 29-32, 34, 35, 54, 56, 57, and 62 are rejected under 35 U.S.C. 103 as being unpatentable over Ionis Pharmaceuticals (US 20170175113) taken with University of Massachusetts (WO 20161725008). ‘113 contemplates making an antisense compound consisting of 12 to 30 linked nucleotides, wherein the antisense compound is at least 90% complementary to an Ataxin 2 (ATXN2) nucleic acid, wherein the oligonucleotide is not complementary to a CAG repeat expansion in the ATXN2 nucleic acid, wherein the ATXN2 nucleic acid has the sequence of any of SEQ ID NO: 1, 2, or 3 (pages 6-10 and 122). Nucleotides 589 to 610 of SEQ ID NO: 3 (Db) would read on SEQ ID NO: 1176 (Qy). Qy 1 UACCACAACAAAGUCUGAACAU 22 Db 610 TACCACAACAAAGTCTGAACAT 589 The antisense compound can be antisense oligonucleotide, siRNA, shRNA, ssRNA (page 2). A pharmaceutical composition can comprise the compound and a sterile aqueous solution (page 5). The compounds can be tested in an animal model or a cell line to assess its ability to inhibit ATXN2 expression (pages 16-17) However, ‘113 does not specifically teach an expression construct comprising an oligonucleotide that comprises instant SEQ ID NO: 1176. ‘008 teaches using a AAV vector to deliver a transgene to a cell or a subject, wherein the transgene is flanked by a 5’ AAV ITR and a 3’ AAV ITR. For example, see pages 2-3 and 13-72. The oligonucleotide can be a dsRNA, siRNA, shRNA, miRNA, or AmiRNA (page 13). The transgene can be operably linked to a promoter (pages 14-15). The AAV vector can be in a rAAV particle comprising a capsid protein (page 14). ‘008 discovered that transgenes comprising a hairpin-forming nucleic acids with decreased thermostability are useful for replacing mutant ITRs in self-complementary AAV vectors (pages 23-24). Hairpin-forming RNA are useful for translational expression and/or gene silencing. The duplex can be about 14 to 35 nucleotides in length. Hairpin-forming RNA can be a microRNA or artificial microRNA (AmiRNA). The rAAV vectors can comprise a AmiRNA having a guide strand that targets a gene related to diseases (pages 33-35). Embedding antisense RNA into endogenous miRNA scaffold to improve small RNA processing and reduce toxicity (page 43-44). It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘113 taken with ‘008 and try making an antisense oligonucleotide comprising instant SEQ ID NO: 1176, namely to arrive at the claimed invention. See MPEP 2143(I)E. In addition, targeting a region that is not a CAG repeat expansion region of ATXN2 would reduce the number of possible oligonucleotides for targeting ATNX2 and would include nucleotides 589 to 610 of SEQ ID NO: 3. One of ordinary skill in the art would have been motivated to try any antisense oligonucleotide that is at least 90% complementary to SEQ ID NO: 3, including antisense oligonucleotide that comprises instant SEQ ID NO: 1176 to determine any oligonucleotides that can be used to inhibit ATXN2 expression in a cell. Furthermore, one of ordinary skill in the art would have been motivated to use a rAAV viral vector or a plasmid comprising an antisense oligonucleotide comprising SEQ ID NO: 1176 to control expression of the sequence, reduce toxicity of the vector, or decrease the exposure of the oligonucleotide to nucleases in a cell or a subject (pages 43-44 of ’008). In addition, ‘008 teaches making a shRNA comprising an antisense RNA and it would have been simple substitution to try a dsRNA comprising the antisense oligonucleotide comprising SEQ ID NO: 1176 and a passenger strand to study inhibiting expression of ATXN2. See MPEP 2143(I)B. ‘008 teaches making rAAV vectors having an antisense embedded in a pre-miRNA backbone selected from miR-21, miR-375, miR-30a, miR-26a, miR-451, miR-33, pri-miR-99, pri-miR-194, and pri-miR-155 (pages 44-46). ‘008 teaches that the AAV vector can be a self-complementary (sc) AAV and serotype selected from AAV2, AAV6, AAV8, AAV9, AAVrh10 (page 55). AAVrh10 is known to cross the blood: brain barrier. An AAV ITR can be mutated at its terminal resolution site (TR) which inhibits replication at the vector terminus wherein the TR has been mutates resulting in a self-complementary AAV (page 15). ‘008 teaches rAAV comprising a pri-miRNA scaffold driven by Pol III Ha promoter (page 60). A host cell can comprise an rAAV vector (page 19). Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over Ionis Pharmaceuticals (US 20170175113) taken with University of Massachusetts (WO 20161725008) as applied to claims 1, 3, 13, 15, 16, 18-20, 22-26, 29-32, 34, 35, 54, 56, 57, and 62 above, and further in view of Robbins et al. (US 200402201310). ‘113 taken with ‘008 do not specifically teach that H1 promoter comprising nucleotides 113-203 of SEQ ID NO: 1522. However, Robbins teach using H1 promoter comprising SEQ ID NO: 20 to express a dsRNA (pages 5 and 25). SEQ ID NO: 20 (Db) is 100% identical to nucleotides 1798-1888 of instant SEQ ID NO: 1521 (Qy). Qy 1 ATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATT 60 Db 2 ATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATT 61 Qy 61 TGGGAATCTTATAAGTTCTGTATGAGACCAC 91 Db 62 TGGGAATCTTATAAGTTCTGTATGAGACCAC 92 It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘113 and ‘008 taken with Robbins to try a H1 promoter comprising nucleotides 113-203 of SEQ ID NO: 1152 (See MPEP 2143(I)E) or a simple substitution (See MPEP 2143(I)B) to use the H1 promoter taught by Robbins in the vector to express the dsRNA comprising SEQ ID NO: 1176 with a reasonable expectation of success because the H1 promoter taught by Robbins is an identifiable and predictable H1 promoter, namely to arrive at the claimed invention. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over ‘113 and ‘008 as applied to claims 1, 3, 13, 15, 16, 18-20, 22-26, 29-32, 34, 35, 54, 56, 57, and 62 above, and further in view of Wang (US 20190076550). ‘113 and ‘008 make obvious making an AAV vector comprising the nucleotide sequence, wherein the AAV vector is selected from AAV2, AAV6, AAV8, AAV9, AAVrh10. ‘113 taken with ‘008 do not specifically teach the 5’ ITR comprises nucleotides 1-106 of SEQ ID NO: 2577 and the 3’ ITR comprises nucleotides 2192-2358 of SEQ ID NO: 2257. However, the sequences for AAV 5’ ITR and 3’ ITR were known in the prior art. SEQ ID NO: 3 in Wang (US 20190076550) teaches that the 5’ ITR is from AAV2. SEQ ID NO: 9 in Wang teaches that the sequence for the 3’ ITR in the instant claim is from AAV2. Wang further teaching making an AAV particle comprising a AAVrh10 capsid and AAV2 ITRs and a transgene and can successfully deliver and express a transgene in a cell (page 3). It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘113 and ‘008 taken with Wang as a simple substitution (See MPEP 2143(I)B) to use the instant AAV2 ITRs to make the AAV viral vector comprising SEQ ID NO: 1185, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to determine which AAV is the most efficient at producing the transgene comprising SEQ ID NO: 1185. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Conclusion Other than a provisional NSDP rejection over applicant’s co-pending application (filed after the EFD of the instant application), the prior art of record does not teach or suggest the elected species directed to the a construct comprising the elected nucleotide sequence (SEQ ID NO: 1915) in claims 11 and 61. A sequence search of the publicly available databases does not result in any sequence with 100% identity to SEQ ID NO: 1915 or a sequence that can be modified to arrive at the instant SEQ ID NO:. With respect to SEQ ID NO: 1185 in claims 1, 54 and 62 and claims dependent therefrom, SEQ ID NO: 2524309 (Db) in US 20050244851 is 100% to instant SEQ ID NO: 1185, however, there is nothing in ‘851 that leads a skilled artisan to this sequence and placing it in a construct. Qy 1 UCGGGUUGAAAUCUGAAGUGUG 22 Db 2 TCGGGTTGAAATCTGAAGTGTG 23 The disclosure of ‘851 does not define the SEQ ID NO: or how to use it. While the prior art teaches a composition comprising an oligonucleotide comprising SEQ ID NO: 1185; a construct comprising an oligonucleotide comprising a guide strand comprises SEQ ID NO: 1185 and a passenger strand set forth in SEQ ID NO: 1835 in claim 4 is free of the art of record. The prior art does not teach or suggest making a double stranded oligonucleotide comprising SEQ ID NO: 1185 or comprising these two SEQ ID NOs. The specification discloses that the passenger strand (SEQ ID NO: 1835) was modified compared to a sequence that is fully complementary to the guide strand set forth in SEQ ID NO: 1185. Without looking at the specification for the modification, a person of ordinary skill in the art would not have been motivated to make the modifications to the nucleotide sequence of the complement of SEQ ID NO: 1185 and arrive at instant SEQ ID NO: 1835 See attached PTO-326 for disposition of claims. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 29, 2022
Application Filed
Dec 31, 2025
Non-Final Rejection mailed — §101, §102, §103
Mar 26, 2026
Response Filed
May 26, 2026
Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12630826
RNAi Agents for Inhibiting Expression of Xanthine Dehydrogenase (XDH), Pharmaceutical Compositions Thereof, and Methods of Use
3y 6m to grant Granted May 19, 2026
Patent 12624355
DOUBLE-STRANDED OLIGONUCLEOTIDE, COMPOSITION AND CONJUGATE COMPRISING DOUBLE-STRANDED OLIGONUCLEOTIDE, PREPARATION METHOD THEREOF AND USE THEREOF
3y 7m to grant Granted May 12, 2026
Patent 12618072
METHODS OF TREATMENT OF SCN2A-RELATED DISORDERS
1y 7m to grant Granted May 05, 2026
Patent 12612627
COMPOSITIONS AND METHODS FOR INCREASING SODIUM CURRENT IN CARDIAC CELLS
3y 6m to grant Granted Apr 28, 2026
Patent 12606826
MODULATION OF TRANSTHYRETIN EXPRESSION
3y 4m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
68%
Grant Probability
85%
With Interview (+17.0%)
2y 8m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1149 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month