Prosecution Insights
Last updated: April 19, 2026
Application No. 17/800,371

AAV-Mediated Targeting of MIRNA in the Treatment of X-Linked Disorders

Non-Final OA §102§103§112
Filed
Aug 17, 2022
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF VIRGINIA PATENT FOUNDATION
OA Round
1 (Non-Final)
43%
Grant Probability
Moderate
1-2
OA Rounds
4y 2m
To Grant
98%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +54% interview lift
Without
With
+54.4%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.5%
-33.5% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's preliminary amendment filed on November 11, 2025 is acknowledged. Claims 9 and 22-27 have been canceled. Claims 1-8, 10, 11, 13-18, and 20 were amended. Claims 1-8 and 10-21 are pending. It is noted that the amendment to the claims filed on November 11, 2025 does not comply with the requirements of 37 CFR 1.121(c) because previously pending claims 28-31 are not present. However, in the interest of compact prosecution, the amendment to the claims has been entered. Election/Restrictions Applicant’s election of Group II (claims 9-15, 16 (in part), and 27-31) and the following species (Rett syndrome) in the reply filed on November 11, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Applicant’s reply indicates that the Examiner did not include pending claims 27-31 in any of the recited claim Groups; however, it should be noted that previous pending claims 27-31 were included in Group II in the restriction requirement as reproduced below. PNG media_image1.png 120 804 media_image1.png Greyscale Claims 17-21 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1-8 and 10-16 are examined on the merits herein. Priority PNG media_image2.png 44 474 media_image2.png Greyscale Information Disclosure Statement The information disclosure statement (IDS) submitted on January 3, 2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The drawings were received on August 17, 2022. The drawings are objected to because the y axis of FIG. 10A appears to be cut off. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification Applicant is reminded of the proper language and format for an abstract of the disclosure. The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details. The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided. The abstract of the disclosure is objected to because the abstract is less than 50 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b). Claim Objections Claims 2, 4, 5, 13, and 14 are objected to because of the following informalities: Claim 2 recites in part “a tandem multiplexes”. To improve the grammar of the claim, the claim should recite “a tandem multiplex”. Claim 4: There are two (2) instances of the limitation “at least 2 or more nucleotide sequences that target one or more miRNA of interest”. Claim 4 is redundant at the recitation of “at least 2 or more”, “at least 3 or more”, and “at least 4 or more”. The claim should recite “at least 2” or “2 or more”; “at least 3” or “3 or more”; and “at least 4” or “4 or more”. Claim 5 recites “nucleotide sequences” and should recite “nucleotide sequence”. Claim 13 recites “nucleotide sequences” and should recite “nucleotide sequence”. Claim 14 recites “the vector” and should recite “the rAAV”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 10, 11, and 13 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 10, 11, and 13 recite the limitation "the genome". There is insufficient antecedent basis for this limitation in the claims. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 16 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 16 recites a composition comprising the rAAV of claim 1. Claim 16 does not add anything additional to the product of claim 1; therefore, claim 16 fails to further limit the claim which it depends on. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-5 and 14-16 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Banfi et al. (WO 2019/202162; reference cited by Applicant). Regarding claims 1, 2, 4, 5, 14, and 16, Banfi et al. teaches AAV vectors (serotype 2) expressing a "sponge" construct for miR-181 inhibition under the control of the cytomegalovirus (CMV) constitutive promoter. Banfi et al. also teaches designing 6 miRNA binding sites (MBS) antisense to miRNA181a and 6 MBS antisense to miRNA181b with a central mismatch ("bulge") at position 9-12 of the miR-181a or b sequences. The bulge was created by changing the nucleotides at position 9-12 to reduce the chances of base paring (including G-U wobbling). The two MBS will be separated by a 4 nt sequence ("spacer"). Sponge oligonucleotide duplexes (double strand) were cloned in a vector containing an expression cassette with a miRNA binding sponge sequence inserted into the 3' UTR of a GFP reporter gene [Example 8, page 79 bridging to page 80]. Regarding claim 3, Banfi et al. teaches that a sponge is composed of a high affinity miRNA antisense binding site (MBS) which includes a sequence complementary to the target miRNA, and a "bulge" region, i.e. a mismatched region in nucleotides 9 to 12 of the MPS sequence. Suitably, the complementary region is at least 75%, 80%, 85% , 90%, 95%, 99% or 100% identical to the target miRNA [page 44, second full paragraph]. Regarding claim 15, Banfi et al. teaches a vector comprising at least one inhibitor of miR-181 and a promoter sequence, preferably the vector is a viral vector, preferably an adeno-associated viral vector capable of treating and/or preventing a mitochondrial disorder [page 9, first paragraph]. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) as applied to claims 1-5 and 14-16 above, and further in view of Dylla et al. (PLoS ONE 2013). Regarding claim 6, the teachings of Banfi et al. are discussed above. However, Banfi et al. does not teach that the microRNA sponge cassette comprises one or more nucleotide sequences that target miR106a. Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines [abstract]. Dylla et al. also teaches that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma. Further, blockade of the miR-106a~363 cluster represents a possible new strategy for inhibition of Ewing Sarcoma growth [page 9, left column, last paragraph bridging to right column]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to substitute miR-181 with miR106a with a reasonable expectation of success. One would have made such a substitution in order to achieve the predictable result of inhibiting Ewing Sarcoma growth. Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) and Dylla et al. (PLoS ONE 2013) as applied to claims 1-6 and 14-16 above, and further in view of Luo et al. (US 2015/0232810) and Ebert et al. (Current Biology 2010). Regarding claim 7, the teachings of Banfi et al. and Dylla et al. are discussed above. However, Banfi et al. and Dylla et al. do not teach that the nucleotide sequence that targets the miRNA of interest comprises the nucleotide sequence of SEQ ID NO: 2. Luo et al. teaches SEQ ID NO: 73 (designated as Db) which is complementary to instant SEQ ID NO: 2 (designated as Qy) as shown in the alignment below. According to the sequence listing (reproduced below), SEQ ID NO: 73 is a mmu-miR-106a sequence. Query Match 100.0%; Score 23; DB 1; Length 23; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTACCTGCACTGTTAGCACTTTG 23 ||||||||||||||||||||||| Db 23 CTACCTGCACTGTTAGCACTTTG 1 PNG media_image3.png 208 670 media_image3.png Greyscale Ebert et al. teaches that effective sponges should be easy to evolve as they require only short stretches of complementarity to miRNA seeds in regions of relatively unstructured RNA [page R858, right column, first full paragraph]. Ebert et al. also teaches that the higher the expression of the sponge RNA, the more binding sites it contains, and the more extensive the complementarity at the binding sites, the greater the expected effect of sponge RNA on miRNA [page R861, left column, first paragraph]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. and Dylla et al. by incorporating the nucleotide sequence of SEQ ID NO: 2. One of skill in the art would have been motivated to make such a modification because Luo et al. taught a mmu-miR-106a sequence, Ebert et al. taught that the more extensive the complementarity at the binding site the greater the expected effect of sponge RNA on miRNA, Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines, and Dylla et al. taught that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma. Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) as applied to claims 1-5 and 14-16 above, and further in view of Ebert et al. (Nature Methods 2007). Regarding claim 10, the teachings of Banfi et al. are discussed above. However, Banfi et al. does not teach a U6 promoter. Ebert et al. constructed a second class of microRNA sponges to take advantage of strong RNA polymerase III promoters (Pol III), which are known to drive expression of the most-abundant cellular RNAs [page 722, left column, first full paragraph]. Specifically, U6 sponges were constructed by subcloning the microRNA binding site region into a vector containing a U6 snRNA promoter with 5’ and 3’ stem-loop elements as shown in Figure 1C (reproduced below). PNG media_image4.png 116 326 media_image4.png Greyscale It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the cytomegalovirus (CMV) constitutive promoter with a U6 promoter with a reasonable expectation of success. One of skill in the art would have made such a substitution in order to achieve the predictable result of driving gene expression. Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) as applied to claims 1-5 and 14-16 above, and further in view of Gao et al. (WO 2021/072201). Regarding claim 11, the teachings of Banfi et al. are discussed above. However, Banfi et al. does not teach a stuffer sequence. Gao et al. teaches that a recombinant AAV vector also includes conventional control elements which are operably linked with elements of the transgene in a manner that permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus. In some embodiments, an isolated nucleic acid comprises one or more non-functional “stuffer sequences”. A stuffer sequence may comprise between about 10 and about 2000 contiguous nucleotides, and generally functions to ensure proper viral vector packaging [page 14, first full paragraph]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. by incorporating a stuffer sequence because Banfi et al. and Gao et al. both teach the provision of AAV vectors and Gao et al. teaches that it is within the skill of the art to include a stuffer sequence. One of skill in the art would have been motivated to make such a modification because Gao et al. taught that a stuffer sequence ensures proper viral vector packaging. Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) and Gao et al. (WO 2021/072201) as applied to claims 1-5, 11, and 14-16 above, and further in view of Kaspar et al. (WO 2015/031392). Regarding claim 12, the teachings of Banfi et al. and Gao et al. are discussed above. However, Banfi et al. and Gao et al. do not teach a stuffer sequence wherein the stuffer sequence comprises the nucleotide sequence of SEQ ID NO: 11. Kaspar et al. teaches SEQ ID NO: 22 which is a 1607 bp stuffer sequence. Kaspar et al. also teaches that a DNA construct containing the SOD1 shRNA expression cassette, followed by the stuffer sequence was synthesized from Genscript [0092]. Kaspar et al. SEQ ID NO: 22 (designated as Db) has a match to instant SEQ ID NO: 11 (designated as Qy) as shown in the alignment below. Query Match 100.0%; Score 1350; Length 1607; Best Local Similarity 100.0%; Matches 1350; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 258 ACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC 317 Qy 61 CGCCTGCAGGGACGTCGACGGATCGGGAGATCTCCCGATCCCCTATCTGCTCCCTGCTTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 318 CGCCTGCAGGGACGTCGACGGATCGGGAGATCTCCCGATCCCCTATCTGCTCCCTGCTTG 377 Qy 121 TGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 378 TGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTT 437 Qy 181 GACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGGCGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 438 GACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGGCGC 497 Qy 241 GCCTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTGCTACGCCTGAATAAGTGATA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 498 GCCTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTGCTACGCCTGAATAAGTGATA 557 Qy 301 ATAAGCGGATGAATGGCAGAAATTCGCCGGATCTTTGTGAAGGAACCTTACTTCTGTGGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 558 ATAAGCGGATGAATGGCAGAAATTCGCCGGATCTTTGTGAAGGAACCTTACTTCTGTGGT 617 Qy 361 GTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAATGTAAGCAGACAGTTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 618 GTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAATGTAAGCAGACAGTTT 677 Qy 421 TATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 678 TATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACAC 737 Qy 481 AACGTGGCTTTCCCCCCCCCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 738 AACGTGGCTTTCCCCCCCCCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGC 797 Qy 541 GCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 798 GCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGA 857 Qy 601 AGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 858 AGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTT 917 Qy 661 CGAACCCCAGAGTCCCGCTCAGGGCGCGCCGGGGGGGGGGGCGCTGAGGTCTGCCTCGTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 918 CGAACCCCAGAGTCCCGCTCAGGGCGCGCCGGGGGGGGGGGCGCTGAGGTCTGCCTCGTG 977 Qy 721 AAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 978 AAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGA 1037 Qy 781 GGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTCCTGCAGGAGCATAAAGT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1038 GGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTCCTGCAGGAGCATAAAGT 1097 Qy 841 GTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1098 GTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGC 1157 Qy 901 CCGCTTTCCAGTCGGGAAACCTGTCGTGCCCGCCCAGTCTAGCTATCGCCATGTAAGCCC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1158 CCGCTTTCCAGTCGGGAAACCTGTCGTGCCCGCCCAGTCTAGCTATCGCCATGTAAGCCC 1217 Qy 961 ACTGCAAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1218 ACTGCAAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTA 1277 Qy 1021 GCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGTCTGGTTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1278 GCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGTCTGGTTC 1337 Qy 1081 GAGGCGGGATCAGCCACCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1338 GAGGCGGGATCAGCCACCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAA 1397 Qy 1141 AGTTAACTGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1398 AGTTAACTGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGC 1457 Qy 1201 GGCCGATCCACCGGTCGCCACCAGCGGCCATCAAGCACGTTATCGATACCGTCGACTAGA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1458 GGCCGATCCACCGGTCGCCACCAGCGGCCATCAAGCACGTTATCGATACCGTCGACTAGA 1517 Qy 1261 GCTCGCTGATCAGTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1518 GCTCGCTGATCAGTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAC 1577 Qy 1321 AATAGCAGCTGCAGAAGTTTAAACGCATGC 1350 |||||||||||||||||||||||||||||| Db 1578 AATAGCAGCTGCAGAAGTTTAAACGCATGC 1607 It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. and Gao et al. by incorporating a stuffer sequence as taught by Kaspar et al. One of skill in the art would have been motivated to make such a modification because Kaspar et al. taught the stuffer sequence and Gao et al. taught that a stuffer sequence ensures proper viral vector packaging. Allowable Subject Matter Claim 8 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Aug 17, 2022
Application Filed
Jan 22, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
43%
Grant Probability
98%
With Interview (+54.4%)
4y 2m
Median Time to Grant
Low
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month