Prosecution Insights
Last updated: October 02, 2026
Application No. 17/800,371

AAV-Mediated Targeting of MIRNA in the Treatment of X-Linked Disorders

Final Rejection §103§112
Filed
Aug 17, 2022
Priority
Feb 18, 2020 — provisional 62/978,285 +1 more
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Virginia Patent Foundation
OA Round
2 (Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
32 granted / 62 resolved
-8.4% vs TC avg
Strong +48% interview lift
Without
With
+48.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
54 currently pending
Career history
114
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
35.0%
-5.0% vs TC avg
§102
11.8%
-28.2% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 62 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's amendments and remarks filed on May 15, 2026 are acknowledged. Claims 6, 9, 11, and 22-31 have been canceled. Claims 1, 2, 4, 5, 13, 14, and 16 were amended. Claims 1-5, 7, 8, 10, and 12-21 are pending. Election/Restrictions Applicant’s election of Group II (claims 9-15, 16 (in part), and 27-31) and the following species (Rett syndrome) in the reply filed on November 11, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 17-21 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1-5, 7, 8, 10, and 12-16 are examined on the merits herein. Priority PNG media_image1.png 44 474 media_image1.png Greyscale Withdrawn Objections In view of Applicant’s amendments and response, the objection to the drawings is withdrawn. In view of Applicant’s amendments and response, the claim objections are withdrawn. Withdrawn Rejections In view of Applicant’s amendments and response, the 35 U.S.C 112(b), 35 U.S.C 112(d), and 35 U.S.C 102 rejections are withdrawn. Drawings The drawings were received on May 15, 2026. These drawings are found acceptable by the examiner. Specification It is noted that the amendment to the abstract filed on May 15, 2026 does not comply with the requirements of 37 CFR 1.121(b) because the full text of the abstract is not shown with markings relative to the immediate prior version. Specifically, the immediate prior version of the abstract reads in part “This gene therapy…”; however, the amended abstract reads in part “The gene therapy” with no markings to indicate the change from “This” to “The”. Therefore, the amendment to the abstract has not been entered. Applicant is reminded of the proper language and format for an abstract of the disclosure. The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details. The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided. The abstract of the disclosure is objected to because the abstract is less than 50 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b). Response to Arguments Applicant's arguments filed May 15, 2026 have been fully considered but they are not persuasive. It is noted that the amendment to the abstract filed on May 15, 2026 does not comply with the requirements of 37 CFR 1.121(b) because the full text of the abstract is not shown with markings relative to the immediate prior version. Specifically, the immediate prior version of the abstract reads in part “This gene therapy…”; however, the amended abstract reads in part “The gene therapy” with no markings to indicate the change from “This” to “The”. Therefore, the amendment to the abstract has not been entered. New Grounds of Rejections Necessitated by Amendment Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 12 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 12 recites in part “The rAAV of claim 11”; however, claim 11 is canceled. Claim 12 depends on a canceled claim and thus is incomplete. However, in the interest of compact prosecution, the Examiner is interpreting claim 12 to be dependent on claim 1. Applicant is required to respond with claims that are in proper form. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-5 and 14-16 are rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) in view of Dylla et al. (PLoS ONE 2013; reference previously cited by the Examiner) and Gao et al. (WO 2021/072201; reference previously cited by the Examiner). Regarding claims 1, 2, 4, 5, 14, and 16, Banfi et al. teaches AAV vectors (serotype 2) expressing a "sponge" construct for miR-181 inhibition under the control of the cytomegalovirus (CMV) constitutive promoter. Banfi et al. also teaches designing 6 miRNA binding sites (MBS) antisense to miRNA181a and 6 MBS antisense to miRNA181b with a central mismatch ("bulge") at position 9-12 of the miR-181a or b sequences. The bulge was created by changing the nucleotides at position 9-12 to reduce the chances of base paring (including G-U wobbling). The two MBS will be separated by a 4 nt sequence ("spacer"). Sponge oligonucleotide duplexes (double strand) were cloned in a vector containing an expression cassette with a miRNA binding sponge sequence inserted into the 3' UTR of a GFP reporter gene [Example 8, page 79 bridging to page 80]. Regarding claim 3, Banfi et al. teaches that a sponge is composed of a high affinity miRNA antisense binding site (MBS) which includes a sequence complementary to the target miRNA, and a "bulge" region, i.e. a mismatched region in nucleotides 9 to 12 of the MPS sequence. Suitably, the complementary region is at least 75%, 80%, 85% , 90%, 95%, 99% or 100% identical to the target miRNA [page 44, second full paragraph]. Regarding claim 15, Banfi et al. teaches a vector comprising at least one inhibitor of miR-181 and a promoter sequence, preferably the vector is a viral vector, preferably an adeno-associated viral vector capable of treating and/or preventing a mitochondrial disorder [page 9, first paragraph]. However, Banfi et al. does not teach that the microRNA sponge cassette comprises one or more nucleotide sequences that target miR106a. Banfi et al. also does not teach a stuffer sequence. Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines [abstract]. Dylla et al. also teaches that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma. Further, blockade of the miR-106a~363 cluster represents a possible new strategy for inhibition of Ewing Sarcoma growth [page 9, left column, last paragraph bridging to right column]. Gao et al. teaches that a recombinant AAV vector also includes conventional control elements which are operably linked with elements of the transgene in a manner that permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus. In some embodiments, an isolated nucleic acid comprises one or more non-functional “stuffer sequences”. A stuffer sequence may comprise between about 10 and about 2000 contiguous nucleotides, and generally functions to ensure proper viral vector packaging [page 14, first full paragraph]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. wherein the microRNA sponge cassette comprises one or more nucleotide sequences that target miR106a because Banfi et al. taught AAV vectors (serotype 2) expressing a "sponge" construct for miR-181 inhibition under the control of the cytomegalovirus (CMV) constitutive promoter and Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines. Dylla et al. also taught that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma and blockade of the miR-106a~363 cluster represents a possible new strategy for inhibition of Ewing Sarcoma growth. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. by incorporating a stuffer sequence because Banfi et al. and Gao et al. both teach the provision of AAV vectors and Gao et al. teaches that it is within the skill of the art to include a stuffer sequence. One of skill in the art would have been motivated to make such a modification because Gao et al. taught that a stuffer sequence ensures proper viral vector packaging. Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) in view of Dylla et al. (PLoS ONE 2013; reference previously cited by the Examiner) and Gao et al. (WO 2021/072201; reference previously cited by the Examiner) as applied to claims 1-5 and 14-16 above, and further in view of Luo et al. (US 2015/0232810; reference previously cited by the Examiner) and Ebert et al. (Current Biology 2010; reference previously cited by the Examiner). Regarding claim 7, the teachings of Banfi et al., Dylla et al., and Gao et al. are discussed above. However, Banfi et al., Dylla et al., and Gao et al. do not teach that the nucleotide sequence that targets the miRNA of interest comprises the nucleotide sequence of SEQ ID NO: 2. Luo et al. teaches SEQ ID NO: 73 (designated as Db) which is complementary to instant SEQ ID NO: 2 (designated as Qy) as shown in the alignment below. According to the sequence listing (reproduced below), SEQ ID NO: 73 is a mmu-miR-106a sequence. Query Match 100.0%; Score 23; DB 1; Length 23; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTACCTGCACTGTTAGCACTTTG 23 ||||||||||||||||||||||| Db 23 CTACCTGCACTGTTAGCACTTTG 1 PNG media_image2.png 208 670 media_image2.png Greyscale Ebert et al. teaches that effective sponges should be easy to evolve as they require only short stretches of complementarity to miRNA seeds in regions of relatively unstructured RNA [page R858, right column, first full paragraph]. Ebert et al. also teaches that the higher the expression of the sponge RNA, the more binding sites it contains, and the more extensive the complementarity at the binding sites, the greater the expected effect of sponge RNA on miRNA [page R861, left column, first paragraph]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al., Dylla et al., and Gao et al. wherein the nucleotide sequence that targets miRNA of interest comprises the nucleotide sequence of SEQ ID NO: 2. One of skill in the art would have been motivated to make such a modification because Luo et al. taught a mmu-miR-106a sequence, Ebert et al. taught that the more extensive the complementarity at the binding site the greater the expected effect of sponge RNA on miRNA, Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines, and Dylla et al. taught that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma. Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) in view of Dylla et al. (PLoS ONE 2013; reference previously cited by the Examiner) and Gao et al. (WO 2021/072201; reference previously cited by the Examiner) as applied to claims 1-5 and 14-16 above, and further in view of Ebert et al. (Nature Methods 2007; reference previously cited by the Examiner). Regarding claim 10, the teachings of Banfi et al., Dylla et al., and Gao et al. are discussed above. However, Banfi et al., Dylla et al., and Gao et al. do not teach a U6 promoter. Ebert et al. constructed a second class of microRNA sponges to take advantage of strong RNA polymerase III promoters (Pol III), which are known to drive expression of the most-abundant cellular RNAs [page 722, left column, first full paragraph]. Specifically, U6 sponges were constructed by subcloning the microRNA binding site region into a vector containing a U6 snRNA promoter with 5’ and 3’ stem-loop elements as shown in Figure 1C (reproduced below). PNG media_image3.png 116 326 media_image3.png Greyscale It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the cytomegalovirus (CMV) constitutive promoter with a U6 promoter with a reasonable expectation of success. One of skill in the art would have made such a substitution in order to achieve the predictable result of driving gene expression as taught by Ebert et al. Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over Banfi et al. (WO 2019/202162; reference cited by Applicant) in view of Dylla et al. (PLoS ONE 2013; reference previously cited by the Examiner) and Gao et al. (WO 2021/072201; reference previously cited by the Examiner) as applied to claims 1-5 and 14-16 above, and further in view of Kaspar et al. (WO 2015/031392; reference previously cited by the Examiner). Regarding claim 12, the teachings of Banfi et al., Dylla et al., and Gao et al. are discussed above. However, Banfi et al., Dylla et al., and Gao et al. do not teach that the stuffer sequence comprises the nucleotide sequence of SEQ ID NO: 11. Kaspar et al. teaches SEQ ID NO: 22 which is a 1607 bp stuffer sequence. Kaspar et al. also teaches that a DNA construct containing the SOD1 shRNA expression cassette, followed by the stuffer sequence was synthesized from Genscript [0092]. Kaspar et al. SEQ ID NO: 22 (designated as Db) has a match to instant SEQ ID NO: 11 (designated as Qy) as shown in the alignment below. Query Match 100.0%; Score 1350; Length 1607; Best Local Similarity 100.0%; Matches 1350; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 258 ACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC 317 Qy 61 CGCCTGCAGGGACGTCGACGGATCGGGAGATCTCCCGATCCCCTATCTGCTCCCTGCTTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 318 CGCCTGCAGGGACGTCGACGGATCGGGAGATCTCCCGATCCCCTATCTGCTCCCTGCTTG 377 Qy 121 TGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 378 TGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTT 437 Qy 181 GACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGGCGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 438 GACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGGCGC 497 Qy 241 GCCTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTGCTACGCCTGAATAAGTGATA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 498 GCCTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTGCTACGCCTGAATAAGTGATA 557 Qy 301 ATAAGCGGATGAATGGCAGAAATTCGCCGGATCTTTGTGAAGGAACCTTACTTCTGTGGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 558 ATAAGCGGATGAATGGCAGAAATTCGCCGGATCTTTGTGAAGGAACCTTACTTCTGTGGT 617 Qy 361 GTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAATGTAAGCAGACAGTTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 618 GTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAATGTAAGCAGACAGTTT 677 Qy 421 TATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 678 TATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACAC 737 Qy 481 AACGTGGCTTTCCCCCCCCCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 738 AACGTGGCTTTCCCCCCCCCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGC 797 Qy 541 GCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 798 GCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGA 857 Qy 601 AGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 858 AGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTT 917 Qy 661 CGAACCCCAGAGTCCCGCTCAGGGCGCGCCGGGGGGGGGGGCGCTGAGGTCTGCCTCGTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 918 CGAACCCCAGAGTCCCGCTCAGGGCGCGCCGGGGGGGGGGGCGCTGAGGTCTGCCTCGTG 977 Qy 721 AAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 978 AAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGA 1037 Qy 781 GGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTCCTGCAGGAGCATAAAGT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1038 GGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTCCTGCAGGAGCATAAAGT 1097 Qy 841 GTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1098 GTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGC 1157 Qy 901 CCGCTTTCCAGTCGGGAAACCTGTCGTGCCCGCCCAGTCTAGCTATCGCCATGTAAGCCC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1158 CCGCTTTCCAGTCGGGAAACCTGTCGTGCCCGCCCAGTCTAGCTATCGCCATGTAAGCCC 1217 Qy 961 ACTGCAAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1218 ACTGCAAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTA 1277 Qy 1021 GCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGTCTGGTTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1278 GCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGTCTGGTTC 1337 Qy 1081 GAGGCGGGATCAGCCACCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1338 GAGGCGGGATCAGCCACCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAA 1397 Qy 1141 AGTTAACTGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1398 AGTTAACTGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGC 1457 Qy 1201 GGCCGATCCACCGGTCGCCACCAGCGGCCATCAAGCACGTTATCGATACCGTCGACTAGA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1458 GGCCGATCCACCGGTCGCCACCAGCGGCCATCAAGCACGTTATCGATACCGTCGACTAGA 1517 Qy 1261 GCTCGCTGATCAGTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1518 GCTCGCTGATCAGTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAC 1577 Qy 1321 AATAGCAGCTGCAGAAGTTTAAACGCATGC 1350 |||||||||||||||||||||||||||||| Db 1578 AATAGCAGCTGCAGAAGTTTAAACGCATGC 1607 It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al., Dylla et al., and Gao et al. wherein the stuffer sequence comprises the nucleotide sequence of SEQ ID NO: 11 as taught by Kaspar et al. One of skill in the art would have been motivated to make such a modification because Kaspar et al. taught the stuffer sequence comprising the nucleotide sequence of SEQ ID NO: 11 and Gao et al. taught that a stuffer sequence ensures proper viral vector packaging. Response to Arguments Applicant's arguments filed May 15, 2026 have been fully considered to the extent that they might apply to the new ground of rejection set forth above but they are not persuasive. Applicant asserts that Banfi et al. exclusively considers a sponge targeting miR181 family members with no teaching or suggestion of modifying the sponge targeting capacity. Further, Banfi et al. does not consider targeting any additional miR families or miRs and lacks discussion and reasoning for considering particular vector elements and the AAV genome size requirements. Applicant also asserts that the Examiner has not identified the rationale for why the skilled artisan would look to Dylla et al. and Gao et al. and select the particular claim-recited features. Applicant asserts that Banfi et al. and Dylla et al. involve entirely different therapeutic contexts with different disease mechanisms, target tissues, and patient populations thus a skilled artisan would not have been motivated to combine the references. Further, the miR106a~363 cluster identified in Dylla et al. is not equivalent to miR106a alone and the sponges disclosed in Dylla et al. target miR clusters not the individual miRs comprising the clusters. Therefore, Applicant asserts that there is no suggestion to design a sponge that targets certain members of a cluster when all the beneficial effects were generated with a microRNA sponge that targeted an entire cluster. Applicant further asserts that there is no nexus between Banfi et al. and Gao et al. because Gao et al. is directed to an entirely different technology and the reference to stuffer sequences is in the context of ensuring proper packaging of suppressor tRNA constructs. These arguments are not found persuasive. The Banfi et al. reference was used in combination with Dylla et al. and Gao et al. to render obvious the limitations of the instant claims because Banfi et al. does not teach that the microRNA sponge cassette comprises one or more nucleotide sequences that target miR106a and Banfi et al. does not teach a stuffer sequence. Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines. Dylla et al. also teaches that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma. Further, blockade of the miR-106a~363 cluster represents a possible new strategy for inhibition of Ewing Sarcoma growth. Gao et al. teaches that a recombinant AAV vector also includes conventional control elements which are operably linked with elements of the transgene in a manner that permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus. In some embodiments, an isolated nucleic acid comprises one or more non-functional “stuffer sequences”. A stuffer sequence may comprise between about 10 and about 2000 contiguous nucleotides, and generally functions to ensure proper viral vector packaging. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. wherein the microRNA sponge cassette comprises one or more nucleotide sequences that target miR106a because Banfi et al. taught AAV vectors (serotype 2) expressing a "sponge" construct for miR-181 inhibition under the control of the cytomegalovirus (CMV) constitutive promoter and Dylla et al. demonstrated that a miR-blocking sponge directed against the poorly characterized miR-106a~363 cluster is a particularly potent inhibitor of clonogenic growth in a subset of Ewing Sarcoma cell lines. Dylla et al. also taught that members of the miR-106a~363 clusters are upregulated in Ewing Sarcoma and blockade of the miR-106a~363 cluster represents a possible new strategy for inhibition of Ewing Sarcoma growth. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results. Furthermore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Banfi et al. by incorporating a stuffer sequence because Banfi et al. and Gao et al. both teach the provision of AAV vectors and Gao et al. teaches that it is within the skill of the art to include a stuffer sequence. One of skill in the art would have been motivated to make such a modification because Gao et al. taught that a stuffer sequence ensures proper viral vector packaging. With respect to Applicant’s arguments regarding the Dylla et al. reference, amended claim 1 recites the following: PNG media_image4.png 106 630 media_image4.png Greyscale The transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Therefore, Dylla et al. meets the limitation of claim 1 as currently written because Dylla et al. teaches the miR-106a~363 cluster which comprises miR-106a. Furthermore, Dylla et al. teaches that to simulate a potential therapeutic approach, the effects of blockade of these clusters (miR-17~92a, miR-106b~25, and miR-106a~363) and their component miRs were examined [abstract]. With respect to Applicant’s arguments regarding the Gao et al. reference, Gao et al. teaches recombinant AAV vectors and also teaches that a stuffer sequence may comprise between about 10 and about 2000 contiguous nucleotides, and generally functions to ensure proper viral vector packaging. Applicant also asserts the following: PNG media_image5.png 318 792 media_image5.png Greyscale PNG media_image6.png 462 800 media_image6.png Greyscale PNG media_image7.png 162 782 media_image7.png Greyscale PNG media_image8.png 162 774 media_image8.png Greyscale These arguments are not found persuasive. In an assertion of unexpected results, one must compare the claimed subject matter with the closest prior art to be effective to rebut a prima facie case of obviousness. In re Burckel, 592 F.2d 1175, 201 USPQ 67 (CCPA 1979). See MPEP 716.02(e). Furthermore, it is noted that an opinion has been made with respect to the data presented in Dylla et al.; however, no evidentiary support has been provided for the opinion. The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997) ("An assertion of what seems to follow from common experience is just attorney argument and not the kind of factual evidence that is required to rebut a prima facie case of obviousness."). See MPEP 2145(I) and 716.01(c)(II). Allowable Subject Matter Claims 8 and 13 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Aug 17, 2022
Application Filed
Jan 27, 2026
Non-Final Rejection mailed — §103, §112
May 15, 2026
Response Filed
Jul 14, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747438
COMPOSITIONS AND METHODS FOR REPROGRAMMING AGE-RESTRICTED NON-NEURONAL CELLS
4y 5m to grant Granted Sep 29, 2026
Patent 12721858
DOUBLE-STRANDED OLIGONUCLEOTIDE TARGETING DKK1 GENE, CONSTRUCT INCLUDING SAME, AND HAIR LOSS PREVENTION OR HAIR GROWTH COMPOSITION CONTAINING SAME
5y 1m to grant Granted Sep 01, 2026
Patent 12723247
METHODS FOR INHIBITION OF HAO1 (HYDROXYACID OXIDASE 1 (GLYCOLATE OXIDASE)) GENE EXPRESSION
4y 7m to grant Granted Sep 01, 2026
Patent 12649004
HIGHLY EFFICIENT TRANSDUCTION AND LATERAL SPREAD IN THE RETINA BY A NOVEL AAV VIRUS ENHANCED BY RATIONAL DESIGN
4y 10m to grant Granted Jun 09, 2026
Patent 12624362
MUTANT REVERSE TETRACYCLINE TRANSACTIVATORS FOR EXPRESSION OF GENES
5y 1m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+48.2%)
3y 11m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 62 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month