Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
Applicant's election without traverse of Group I and SEQ ID No. 7 in the reply filed on 03/02/2026 is acknowledged.
Status of the Application
Claims 1, 2, 4-13, 19, 20 and 23-25 are pending. 1, 2 and 4-13 are currently under examination. Claims 19, 20 and 23-25 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Information Disclosure Statement
The information disclosure statements filed on 03/02/2026 and 08/26/2026 fail to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because of the following reasons:
In 03/02/2026, the foreign patent documents having numbers 1-3 are not in English and therefore are not considered. In 08/26/2022, the foreign patent document JP 2012-506703 is not in English and therefore has not been considered. The remainder of the documents have been considered by the examiner and signed copies have been placed in the file.
The submission of the Information Disclosure Statements on 03/07/2024, 05/22/2025 and 11/12/2025 are in compliance with 37 CFR 1.97. The information disclosure statements have been considered by the examiner and signed copies have been placed in the file.
With respect to the IDS filed 08/30/2022, it appears to be a duplicate of 08/26/2022 as the listing of documents are identical. No references were filed with the IDS on 08/30/2022.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 2 and 4 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 1 recites the antisense oligomer is selected from (a1) and (b1) and is indefinite because the selection of the antisense appears to indicate it can be both (a1) and (b1), instead of (a1) or (b1).
Claim 1 is further indefinite because it is unclear what the recitation of “(except for an antisense oligomer which consists of a base sequence of any of SEQ ID NOs: 90 and 97 to 126) or a pharmaceutically acceptable salt or hydrate thereof” is in reference to because the sequences are not recited in (a1) and (b1) and therefore are excluded and therefore this is unclear. This limitation will not be further examined on the merits because it cannot be determined, without assumption, what it means in the context of the claim.
Claim 2 recites the antisense oligomer is selected from (e) and (f) and is indefinite because the selection of the antisense appears to indicate it ca be both (e) and (f), instead of (e) or (f). Also the claim is indefinite because the selection of antisense oligomers start with e) instead of (a) and it is unclear if there should be options for a-d.
Claim 2 is further indefinite because it is unclear what the recitation of “(except for an antisense oligomer which consists of a base sequence of any of SEQ ID NOs: 90 and 97 to 126) or a pharmaceutically acceptable salt or hydrate thereof” is in reference to because the sequences are not recited in (a2) and (b2) and therefore are excluded and therefore this is unclear. This limitation will not be further examined on the merits because it cannot be determined, without assumption, what it means in the context of the claim.
Claim 4 recites the antisense oligomer is selected from (a2) and (b2) and is indefinite because the selection of the antisense appears to indicate it has both (a2) and (b2), instead of (a2) or (b2).
Claim 6 is indefinite because it recites “at least one nucleotide constituting the oligonucleotide are/is modified” and the recitation of “are/is” is unnecessary because “and/or” and the “at least one” indicates there could be more that one modified oligonucleotide. For clarity the “are/is” should be changed to “is”.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 2 and 5-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wakayama et al. (US 20180179538).
Regarding claims 1(b1) and 2(f), Wakayama et al. teach an antisense oligonucleotide having SEQ ID No. 44 which is 30 nucleotides in length which comprise instant claimed SEQ ID No. 44 (27 nucleotides) with a deletion of 3 bases.
SEQ 44 2 CGGTAAGTTCTGTCATCAAGGAAGAT 27
SEQ 1 1 CGGTAAGTTCTGTCCTCAAGGAAGAT 26
Regarding claims 5, 12 and 13, Wakayama et al. teach the antisense oligonucleotide can be in a pharmaceutical composition [0045].
Regarding claims 6-10, Wakayama et al. teach the antisense oligonucleotide can comprise a modified sugar, phosphorothioate linkage and be a morpholino oligomer [0022].
Regarding claim 11, Wakayama et al. teach the antisense oligonucleotide can comprise a 5’ end having a chemical formula 1 [0044].
Thus Wakayama et al. anticipates the claims.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 1, 2 and 4-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The MPEP states that the purpose of the written description requirement is to ensure that the inventor had possession, as of the filing date of the application, of the specific subject matter later claimed by him. The courts have stated:
To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention." Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gostelli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) ("[T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious" and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966; Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117.
The MPEP lists factors that can be used to determine if sufficient evidence of possession has been furnished in the disclosure of the application. These include: (1) Actual reduction to practice, (2) Disclosure of drawings or structural chemical formulas, (3) Sufficient relevant identifying characteristics (such as: i. Complete structure, ii. Partial Structure, iii. Physical and/or chemical properties, iv. Functional characteristics when coupled with a known or disclosed structure, and v. Correlation between function and structure), (4) Method of making the claimed invention, (5) Level of skill and knowledge in the art, and (6) Predictability in the art.
Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “…disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between functional and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.” Thus when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.
The claims are drawn to a genus of antisense oligonucleotides comprising a base sequence having a deletion, substitution, insertion and/or addition of 1 to 5 bases of SEQ ID Nos. 1 to 89, 91 and 93 with the function of skipping exon 51.
When determining whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. In the instant case, the specification describes the exon 51 skipping ability of several of the claimed antisense oligonucleotides having the full sequence (Figures 1-21). The specification illustrates these sequences have varying amounts of skipping efficient, some lower than 10% efficiency. The specification does not describe antisense oligonucleotides comprising a base sequence having a deletion, substitution, insertion and/or addition of 1 to 5 bases of SEQ ID Nos. 1 to 89, 91 and 93 with the function of skipping exon 51.
It is then determined whether a representative number of species have been sufficiently described by other relevant identifying characteristics (i.e. other than nucleotide sequence), specific features and functional attributes that would distinguish different members of the claimed genera. In the instant case, the only other identifying characteristics is the ability of the claimed full sequences having some ability to skip exon 51. The disclosure has not described any sequence of these sequences having a deletion, substitution, insertion and/or addition of 1 to 5 bases with the ability to skip exon 51. A review of the specification shows that it provides no description or guidance that would allow one of skill to distinguish the functional species of the recited structural genus from the non-functional members without empirical determination
The prior art of Van Deutekom et al. (Hum. Mol. Gen. 10(15):1547-1554, 2001) indicated that it is difficult to predict the AONs that will bind to the target exon and states The efficacy of AONs is largely determined by their binding affinity for the target sequence. Due to base composition and pre-mRNA secondary or tertiary structure, it is difficult to predict which AONs are capable of binding the target sequence. (See p. 1548).
Aartsma-Rus et al. (Neuromuscular Disorders 12: S71-S77, 2002, of record 08/26/2022) identified 30 potential AONs for 15 different exons. The authors state that there is no significant correlation between effectiveness and the length or sequence content and that effectiveness of proposed AONs to bind to the desired exon needs to be tested empirically:
Of the 30 AONs tested, as many as 20 induced specific exon skipping. There was no significant correlation between the length or sequence content of the AON and its effectiveness (see Table 1). We hypothesize that in most cases the mere accessibility of the targeted RNA region, and thus the capability of the AONs to bind, determines their efficacy. The fact that with the AONs tested so far, we have not been able to induce the skipping of exons 45, 47 and 48 would, in this model, be explained by a less accessible configuration of these exons within the secondary structure of the pre-mRNA. To predict the secondary structure of the targeted pre-mRNA regions, we have used the RNA mfold version 3.1 server. Although this analysis hints at the most favorable local structure which may help in the design of AONs, it is not capable of predicting the overall complex structure of the entire DMD pre-mRNA. We therefore have no insight into the actual position of the targeted sequence within the completely folded RNA structure. Its accessibility, and thus the effectivity of any designed AON, will therefore still have to be tested empirically in the cells, as was done in this study.
See p. S76 (emphasis added). The publication does not make any predictions as to additional AONs that include the skip-causing sequences, but also include additional exon-complementary nucleobases. All the AONs reported to have successfully caused exon skipping are reported as 15-24 nucleobases in length. See Table 1.
Since the disclosure and the prior art fail to describe the common attributes and characteristics concisely identifying members of the proposed genus, and because the claimed genus is highly variant a vast number different types of oligonucleotides comprising deletions, substitutions, insertions and/or additions of bases to the sequence, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus claimed.
"A sufficient description of a genus . . . requires the disclosure of either a representative number of species falling within the scope of the genus or structural features common to the members of the genus so that one of skill in the art can "visualize or recognize" the members of the genus" (AbbVie, 759 F.3d at 1297, reiterating Eli Lilly, 119 F.3d at 1568-69) (emphasis added).
Further, “Possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features.” Ex parte Kubin, 83 USPQ2d 1410, 1417 (Bd. Pat. App. & Int. 2007) citing University of Rochester, 358 F.3d at 927, 69 USPQ2d at 1895. Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116).
The MPEP further states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure of the sequence, it is “not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence.” MPEP 2163. The MPEP does state that for generic claim the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. MPEP 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP 2163. Although the MPEP does not define what constitute a sufficient number of representative, the Courts have indicated what do not constitute a representative number species to adequately describe a broad generic. In Gosteli, the Court determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gosteli, 872 F.2d at 1012, 10 USPQ2d at 1618.
Thus the specification and claims lack written description because it is clear that Applicant did not have possession of every variation of antisense oligonucleotides. The description requirement of the patent statute requires a description of an invention, not an indication of a result that one might achieve if one made that invention. See In re Wilder, 736 F.2d 1516, 1521,222 USPQ 369,372-372 (Fed. Cir. 1984) (affirming rejection because the specification does "little more than outlin[e] goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate."). Accordingly, it is deemed that the specification fails to provide adequate written description for the genus of the claims and does not reasonably convey to one skilled in the relevant art that the inventors, at the time the application was filed, had possession of the entire scope of the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. See In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970);and, In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/forms/. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1, 2 and 4-13 are provisionally rejected under the judicially created doctrine of double patenting over claims 1 and 3-10 of Patent No. 9,988,629. Although the conflicting claims are not identical, they are not patentably distinct from each other because the instant claims and the claims of the patent are drawn to patently indistinguishable subject matter. The instant claims and claims of Application ‘629 are drawn to antisense oligomers having the same modifications and are capable of skipping exon 51. Patent ‘629 are not claimed by a sequence however it would have been obvious to use the instantly claimed sequence to skip exon 51 and obvious to use these sequences in the methods of claim 10.
Sequences free of the prior art
SEQ ID Nos. 7, 8, 10, 16, 21, 24, 31, 42, 67 and 76 have been searched and are free of the prior art. Although the dystrophin gene comprising exon 51 is known, it would not have been obvious to make these sequences because, as taught in the prior art above, Van Deutekom et al. and Aartsma-Rus et al. both teach that in making antisense oligonucleotides there was no significant correlation between the length or sequence content of the antisense oligonucleotide and its effectiveness and it is difficult to predict the antisense oligonucleotide that will bind to the target exon. Thus one of skill in the art would not predictably be capable of making the claimed antisense to exon 51 for the purpose of exon skipping.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/
Primary Examiner Art Unit 1636