DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The amendment filed on 8/22/25 cancelled pending claims 1-17, 19-20 and 30 and added new claims 31-52.
Election/Restrictions
Applicant’s election of group I (new claims 31-39 and 51-52) and species (SEQ ID NO: 17 in claim 31 and double stranded SEQ ID NO: 17 and 18 in claim 32 and 33) in the reply filed on 8/22/25 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 40-50 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 8/22/25.
SEQ ID NOs: 36, 39, 40, 47, and 49 in claim 31 and SEQ ID NOs: 36, 39, 40, 47, 49 in claim 32 and SEQ ID NOs: 34/36, 34/39, 17/40, 46/47, 46/49 in claim 33 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 8/22/25.
Information Disclosure Statement
The report on patentability of the IPEA and/or ISA has been considered by the examiner.
The references cited in the PCT international search report by the US have been considered, but will not be listed on any patent resulting from this application because they were not provided on a separate list in compliance with 37 CFR 1.98(a)(1). In order to have the references printed on such resulting patent, a separate listing, preferably on a PTO/SB/08 form, must be filed within the set period for reply to this Office action.
The listing of references in the PCT international search report is not considered to be an information disclosure statement (IDS) complying with 37 CFR 1.98. 37 CFR 1.98(a)(2) requires a legible copy of: (1) each foreign patent; (2) each publication or that portion which caused it to be listed; (3) for each cited pending U.S. application, the application specification including claims, and any drawing of the application, or that portion of the application which caused it to be listed including any claims directed to that portion, unless the cited pending U.S. application is stored in the Image File Wrapper (IFW) system; and (4) all other information, or that portion which caused it to be listed. In addition, each IDS must include a list of all patents, publications, applications, or other information submitted for consideration by the Office (see 37 CFR 1.98(a)(1) and (b)), and MPEP § 609.04(a), subsection I. states, “the list ... must be submitted on a separate paper.” Therefore, the references cited in the international search report have not been considered. Applicant is advised that the date of submission of any item of information in the international search report will be the date of submission of the IDS for purposes of determining compliance with the requirements for the IDS with 37 CFR 1.97, including all timing statement requirements of 37 CFR 1.97(e). See MPEP § 609.05(a).
Specification
The disclosure is objected to because of the following informalities: the limitation “capital letter nucleotide = RNA nucleotide” in paragraphs 4, 39, 89 and page 40 of the as-filed specification is not correct since all of the nucleotides are capitalized, including T and thymidine (T) is not a RNA nucleotide. It appears to be a typographical error since Thymidine is not a RNA nucleotide.
Appropriate correction is required.
Claim Objections
Claims 31-33 are objected to because of the following informalities: the limitation “T = thymidine ….capital letter nucleotide = RNA nucleotide” at the end of the claim is not consistent with what is a RNA nucleotide since all of the nucleotides are capitalized and thymidine (T) is not a RNA nucleotide. It appears to be a typographical error since Thymidine is not a RNA nucleotide and one of skill in the in art commonly uses it as an overhang for a siRNA sequence (see Sharp et al. US 8853181, column 6 of ‘181). Thus, the two Ts in the sequences will be considered a DNA overhang and the limitation will be considered as “capital letter nucleotide other T = RNA nucleotide”. Claims 34-39 and 51-52 are also objected to because they depend on the claims.
Claims 31 and 32 are objected to because of the following informalities: SEQ ID NO: 40 and 47 appear to be identical sequences. Thus, SEQ ID NO: 47 is redundant.
Claim 37 is objected to because of the following informalities: a comma between a wafer and a nanoparticle is missing.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 33-35 and 51-52 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Several of the double stranded nucleic acids in claim 33 do not require the sense strand from claim 32 (SEQ ID NO: 17) from which claim 33 depends from, e.g., SEQ ID NO: 34 and 36; SEQ ID NO: 34 and 39; SEQ ID NO: 46 and 47; SEQ ID NO: 46 and 49. Claim 33 depends on claim 32 and claim 32 limits the sense strand to SEQ ID NO: 17, thus all of the claims dependent on claim 32 require that the double stranded has SEQ ID NO: 17 as the sense strand.
Claims 34-35 and 51-52 recite that the nucleic acid molecule has at least one nucleotide that is modified or further modified. The claims depend on a claim where the nucleic acid already has a modification. Thus, while the claim is further limited for the phrase ‘further modified’, the limitation ‘at least one nucleotide’ does not further limit the claims because the claims already have at least one modification. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 31-33 and 36 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Dey (US 20210171957, priority to 10/25/19, of record).
Dey teaches a composition comprising double stranded nucleic acid comprising SEQ ID NO: 17 and SEQ ID NO: 18 and a pharmaceutically acceptable carrier. These sequences are identical to instant SEQ ID NOs: 17 and 18 and its chemical modification pattern. For example, see pages 2 and 71.
PNG
media_image1.png
58
267
media_image1.png
Greyscale
The applied reference has a common inventor/assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 34, 35, 37-39, and 51-52 are rejected under 35 U.S.C. 103 as being obvious over Dey (US 20210171957, priority to 10/25/19, of record).
The rejection of claims 31-33 and 36 as being taught by Dey are incorporated herein.
Pages 2 and 9-16 of Dey teach adding nucleic acid modifications to the siRNA, including nucleic acid modifications, phosphorothioate, phosphodiester cap. Pages 26-27 teaches using a liposomal nanoparticle or PEG to assist in delivery of a siRNA to cells.
Dey does not specifically teach adding additional modifications to the double stranded nucleic acid.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to add an additional modification, including a phosphorothioate to increase stability of the nucleic acid, namely to arrive at the claimed invention. Dey teaches adding a polymer to the composition, including PEG or liposomal nanoparticle to assist in delivery of the nucleic acid to a cell.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
The applied reference has a common assignee/inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 31-33 and 36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 15-22, 25, 27-34 of copending Application No. 17/802,905 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace a double stranded nucleic acid (siRNA) comprising SEQ ID NOs: 17 and 18 and having the same chemical modification patterns.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 34, 35, 37-39, and 51-52 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 15-22, 25, 27-34 of copending Application No. 17/802,905 in view of Adami et al. (US 20170020819).
The provisional rejection of claims 31-33 and 36 as being unpatentable the claims of ‘905 is incorporated herein.
The claims form ‘905 do not encompass an additional modification to the siRNA or adding a liposomal nanoparticle or PEG to the siRNA in a composition.
However, ‘819 teaches a siRNA formulated in a liposomal nanoparticle comprising PEG to deliver the siRNA to cells (paragraphs 294-333).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the claims of ‘905 taken with ‘819 to formulate the siRNA in a composition comprising a liposomal nanoparticle comprising PEG to assist in delivery of the siRNA to cells. In addition, it would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to add an additional modification to the siRNA, including a phosphorothioate to increase stability of the nucleic acid, namely to arrive at the claimed invention.
This is a provisional nonstatutory double patenting rejection.
Conclusion
See attached PTO-326 for disposition of claims.
The art made of record and not relied upon is considered pertinent to applicant's disclosure.
Sharp (US 20230203495, priority to 2/27/20, of record). Sharp teaches a composition comprising double stranded nucleic acid comprising SEQ ID NO: 17 and SEQ ID NO: 18 and a pharmaceutically acceptable carrier. These sequences are identical to instant SEQ ID NOs: 17 and 18 and their chemical modification patterns. For example, see pages 7 and 43-44.
PNG
media_image2.png
79
265
media_image2.png
Greyscale
A 102(a)(2) rejection is not applicable because the 102(b)(2)(a) exception applies because the Sharp reference does not name another inventor
While 19 nucleotides of the RNA sequences of instant claims 31 and 32 read on a region of Fidgetin-like 2 nucleotide sequence (Sharp, US 8853181) and pages 22-23 of the specification, the claimed nucleic acid are not found in nature because they are chemically modified sequences and/or are a RNA sequence or a double stranded RNA having TT.
Sharp et al. also discloses an unmodified siRNA comprising nucleotides of 19/21 nucleotides of instant SEQ ID NO: 17 (Qy). The sequence taught by Sharp is a 21-mer. See SEQ ID NO: 3 (Db).
Qy 1 UUACACAGUAUUAAAGCGATT 21
Db 1 UUACACAGUAUUAAAGCGAUU 21
‘171 also teaches a complement of the sequence (See SEQ ID NO: 4, Db). SEQ ID NO: 4 would read on 19/21 nucleotides of the antisense strand, SEQ ID NO: 18 (Qy), 21-mer, except for the last two nucleotides.
Qy 1 TTAAUGUGUCAUAAUUUCGCU 21
Db 1 UUAAUGUGUCAUAAUUUCGCU 21
‘171 does not teach or suggest that the 3’ end of the sense and antisense strand each have a TT overhang.
In addition, ‘171 does not teach or suggest adding a phosphate cap to the antisense strand (SEQ ID NO: 18).
Pages 51-52 of the specification of the instant disclosure provide working examples that display SEQ ID NOs: 17 and 18 improve outcome of radical prostatectomy and wound healing.
One of ordinary skill in the art could substitute UU for TT, since they are both overhangs (see column 6 of ‘181), which are commonly used as an overhang when making siRNA having an overhang on the sense and/or antisense strand.
However, the prior art of record does not teach or suggest the specific nucleotide sequence for the sense and/or the chemical medication for the sense strand in claims 31 and 32. Thus, it would not have been a simple substitution for one of ordinary skill in the art to use the chemical modification pattern for the instant nucleic acid or double stranded nucleic acid.
Furthermore, while ‘181 contemplates chemically modifying the siRNA with at least one nucleotide modification, including 2’-O-methyl and 2-fluorodeoxy nucleotides, ‘171 does not teach or suggest the specific modifications of only the first six nucleotides of the sense strand of the siRNA to arrive at the specific chemical modification pattern in instant SEQ ID NO: 17. While each chemical modification used in the oligonucleotide was known in the prior art, there are hundreds, if not thousands, of chemical modifications and possible chemical modifications patterns for an antisense and/or a sense strand using these modifications. See Dar et al. (Scientific Reports 6, 20031, pages 1-8, 2016). Dar et al. teaches a databank for chemically modified siRNAs, including 4894 chemically modified siRNA sequences comprising 128 unique chemical modifications in different positions with various permutations and combinations. Modifications on sense and antisense strands need to be investigated thoroughly before further investigation of using the siRNA having a particular chemical modification pattern (page 2). The prior art and currently indicate to one of ordinary skill in the art that there was not a reasonable expectation of success for one of ordinary skill in the art to identify chemically modified siRNA with drug-like properties because it requires empirically screening due to intricate interdependence of siRNA sequence and chemistry (see Kluchnikov et al. Molecular Therapy Nucleic Acids, Vol. 36, 2025). Unless the prior art teaches the instant chemically modified siRNA, there is no motivation for one of ordinary skill in the art to select specific chemical modifications and/or a pattern of modifications over another chemical modification or chemical modification pattern and reasonably expect to arrive at the chemically modified nucleic acid recited in the instant claims. See MPEP 2143(I)E. Thus, there is not a finite number of identified and predictable chemical modifications patterns for one of ordinary skill in the art to try to make the chemically modified siRNA set forth in the instant claims 31-33 and claims dependent therefrom based on the teaching of ‘181.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636