Office Action Predictor
Application No. 17/813,021

COMPOSITIONS AND METHODS RELATED TO TRANSFERRIN RECEPTOR-BINDING APTAMERS

Non-Final OA §112
Filed
Jul 15, 2022
Examiner
WHITEMAN, BRIAN A
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children'S Hospital D/B/A Seattle Children'S Research Institute
OA Round
1 (Non-Final)
68%
Grant Probability
Favorable
1-2
OA Rounds
2y 10m
To Grant
85%
With Interview

Examiner Intelligence

68%
Career Allow Rate
773 granted / 1136 resolved
Without
With
+17.1%
Interview Lift
avg trend
2y 10m
Avg Prosecution
52 pending
1188
Total Applications
career history

Statute-Specific Performance

§101
5.9%
-34.1% vs TC avg
§103
29.6%
-10.4% vs TC avg
§102
20.7%
-19.3% vs TC avg
§112
24.6%
-15.4% vs TC avg
Black line = Tech Center average estimate • Based on career data

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The examiner of your application in the PTO has changed. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Brian Whiteman, Art Unit 1636. Election/Restrictions Applicant’s election without traverse of group I (claims 1-8) in the reply filed on 7/21/25 is acknowledged. Claims 9-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7/21/25. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or from applicant on PTO-1449, they have not been considered. Drawings The petition for color drawings filed on 12/5/22 has been granted.Nucleotide and/or Amino Acid Sequence Disclosures Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures 37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted: 1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying: a. the name of the XML file b. the date of creation; and c. the size of the XML file in bytes; or 2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying: a. the name of the XML file; b. the date of creation; and c. the size of the XML file in bytes. SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.831(a) and 1.831(b). However, this application fails to comply with the requirements of 37 CFR 1.831-1.834. The examiner has noted that the sequence (TAAAGGGGGTGTTTGTGCGGTGTGGAGTGCGCG) in claim 1 and page 2 and the 14-mer on page 114 is not in the sequence listing. Applicant must provide: • A replacement “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2., as well as • A statement that identifies the location of all additions, deletions, or replacements of sequence information in the “Sequence Listing XML” as required by 1.835(b)(3); • A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.835(b)(4); • A statement that the “Sequence Listing XML” includes no new matter in accordance with 1.835(b)(5); and • A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(b)(2), consisting of: o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); o A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Applicant can add the sequences in a new sequence listing or remove the sequence between () from claim 1 and pages 2 and 114. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-8 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claimed invention embraces an aptamer that selectively binds to transferrin receptor 1 (TfR1, CD71), wherein the aptamer has a sequence having at least 75% sequence identity to residues 22-54 of SEQ ID NO: 2 and the sequence has a number (N) of nucleotides at each end, wherein N comprises 3 nt to 40 nt. The invention further comprises a sequence having at least 75% identify to SEQ ID NO: 1, 2, 26, or 27. The aptamer in the claimed invention embraces an aptamer which can selectively bind to CD71 from any species (e.g., mouse, human, rat, primate). The specification discloses production of a novel high-affinity DNA aptamer (tJBA8.1) that binds TfR1 a receptor broadly upregulated by cancer cells. The aptamer shares a binding site on TfR1 with holo-transferrin, the natural ligand of TfR1. Paragraph 87 of the specification defines “selectively binds transferrin receptor 1 (TrR1, also known as CD71)” refers to: the capacity of an aptamer as described herein to bind to TfR1/CD71, under conditions that maintain the viability of mammalian cells, with at least 1,000X greater affinity than it binds to CD8 or to CD4, e.g., at least 1,000X greater, at least 5,000X greater, at least 7,500X greater, at least 10,000X greater, at least 15,000X greater, at least 20,000X greater or more. Affinity can be determined, e.g., as described in the Examples herein. Paragraph 242 of the specification of the instant disclosure indicates that several variants of JBA8.1 did not bind to TfR1 besides JBA8.1 (SEQ ID NO: 2) (Fig .19). In addition, JBA8.1 does not target mouse TfR1 (Fig 20A and B). Pages 87-88 of the as-filed specification disclose a study to optimize tJBA8.1 affinity. Three other aptamers in the top 50 sequences of the round 8 cell-SELEX pool, JBA8.10, JBA8.26 (SEQ ID NO: 27), and JBA8.45 (Table 5). These three aptamers are single point variants of JBA8.1. JBA8.26 had the highest fold enrichment of the three aptamers. The specification discloses that the applicant believes that the TfR1 independent binding of tJBA8.1 is mediated by a motif of five consecutive guanines which is shared by multiple aptamers identified from the cell-SELEX, but further studies are required to determine this assertion (Paragraph 258). In addition, guanine motifs are observed in aptamers binding to proteins that are not CD71. See Gelinas et al., Current Opinions in Structure Biology 2016, 38:122-132, cited on an IDS. The specification appears to provide written support aptamer comprising SEQ ID NOs: 1, 2, 26 or 27 that selectively bind to human CD71. SEQ ID NOs: 1 and 26 are truncated versions of the aptamer (SEQ ID NO: 2 or 27), 51 nts in length. SEQ ID NOs: 2 and 27 are 81 nt in length. 75% of residues 22-54 of SEQ ID NO: 2 embraces an aptamer with at least 22 nucleotides in instant claim 1. Instant claim 2 embraces 75% of the aptamer having 51-mer and can have different 13 nucleotides. In addition, 75% of a 81-mer can have 21 different nucleotides. The written description requirement for the claimed genus of aptamers is not satisfied through sufficient description of a representative number of species. The mutations can embrace a point mutation or several mutations at consecutive or non-consecutive nucleotides of the sequences. One single point mutation (SEQ ID NO: 27) and truncated version (SEQ ID NO: 26) is not considered a representative species. Other than one species (SEQ ID NO: 26), the specification does not disclose which nucleotide(s) of SEQ ID NO: 2 may be substituted (deleted, added) and still retain the desired biological activity (selectively bind CD71). One of skill in the art would have to further experiment with aptamers having at least 75% identity to SEQ ID NO: 2(1) or 27(26) and determine if they have the desired biological activity. The as-filed specification does not provide a representative number of species which would adequately describe and be considered representative of the entire genus. US 20250020645 discloses an α4β1 binding aptamer (SEQ ID NOs: 3 and 15) is 100% identical to SEQ ID NO: 1; 97% identity to SEQ ID NOs: 26; 64% identity to SEQ ID NO: 2; and 62% identity to SEQ ID NO: 27. Paragraph 159 of ‘645 appears to disclose that TfR1-binding tJBA8.1 shares an overlapping binding site on α4β1 (Fig. 10A). There is a substantial variation within the genus of aptamers as shown in the specification. The specification does not describe a sufficient variety of species of aptamers to reflect the variation within the genus having the desired biological activity. See Enzo Biochem., 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004)(“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). See also MPEP §2163. In view of the foregoing, it is clear that the specification of the instant disclosure fails to convey to the skilled artisan that the applicant had possession of the claimed genus of aptamers in claims 1-8 as of the effective filing date. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 4-5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 4 recites the limitation "the predicted central loop" in line 2. There is insufficient antecedent basis for this limitation in the claim. Claim 5 is rejected because it depends on claim 4. Conclusion See attached PTO-326 for disposition of claims. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. US20150301058 teaches an EpCam aptamer having 48% identity to nucleotides 22-54 of SEQ ID NO: 2 (Qy). See SEQ ID NO: 118193 (Db). Qy 3 AAGGGGGTGTTTGTGC 18 Db 4 AAGGGGGTGTTTGTGC 19 ‘058 is considered the closest prior art, but it does not teach or suggest making an aptamer that selectively binds CD71, wherein the aptamer comprises a sequence having at least 75% identity residues 22-54 of SEQ ID NO: 2. Co-pending post-filed US application no. 18771737 (SEQ ID NOs: 3, 15, and 38) has sequences which read on instant SEQ ID NO: 2, but they are not recited in the pending claims of ‘737. Co-pending application 18769205 discloses sequences that read on the instant SEQ ID NO: 2, but the application is abandoned. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 15, 2022
Application Filed
Nov 13, 2025
Non-Final Rejection — §112
Mar 19, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology. Study what changed to get past this examiner.

Patent 12595478
CRISPR-CAS SYSTEMS HAVING DESTABILIZATION DOMAIN
2y 5m to grant Granted Apr 07, 2026
Patent 12577568
METHODS FOR CONTROLLING EXTRACORPOREAL MEMBRANE OXYGENATION (ECMO) COAGULATION
2y 5m to grant Granted Mar 17, 2026
Patent 12577562
Treatment Of Glaucoma With Rho Guanine Nucleotide Exchange Factor 12 (ARHGEF12) Inhibitors
2y 5m to grant Granted Mar 17, 2026
Patent 12570984
DNA APTAMER SPECIFICALLY BINDING TO GLUTATHIONE AND USE THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12571004
EXOSOMAL LOADING USING HYDROPHOBICALLY MODIFIED OLIGONUCLEOTIDES
2y 5m to grant Granted Mar 10, 2026

AI Strategy Recommendation

Click below to generate an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
68%
Grant Probability
85%
With Interview (+17.1%)
2y 10m
Median Time to Grant
Low
PTA Risk
Based on 1136 resolved cases by this examiner