DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
[Copied from the Nonfinal Action 15May2025 → ] Applicant’s election of Group I, “at least 200 contiguous nucleotides”, “comprises”, “an RNA transcribed from said target gene”, “SEQ ID NO: 11”, “contacted by”, and part (e) of claim 1 in the reply filed on 07April2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
The claims were amended 07April2025 for consonance with the elections, therefore, no claims are withdrawn.
Withdrawn Objections and/or Rejections
Certain objections and/or rejections made of record in the nonfinal office action dated 15May2025 are withdrawn. In particular:
RE ¶¶ 6-8: The objections are withdrawn in view of the amendments to the claims;
RE ¶ 10: The Indefiniteness rejection is withdrawn in view of the amendments to the claim;
RE ¶ 12: The Improper Markush rejection is withdrawn in view of the amendments to the claim; and
RE ¶ 13: The Subject Matter Eligibility rejection is withdrawn in view of the amendments to the claim.
Status of the Claims
The amendments and arguments filed 17November2025 are acknowledged and have been fully considered. Claims 4, 8-20, 23-25, 28-52 were previously canceled. Claims 54-56 are new. Claims 1-3, 5-7, 21-22, 26-27, and 53-56 are pending and examined on the merits herein. Claims 1, 5, 7, 26, 27, 53 are currently amended; claims 3, 6, 21, 22 were previously presented; claim 2 is original.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) [US provisional 63225758 filed 27July2021] is acknowledged. Claims 1-3, 5-7, 21-22, 26-27, and 53-56 have or maintain an effective filing date of 27July2021.
Claim Objections
Claim 1 REMAINS objected to because of the following informality (the first formality was addressed by the claim amendments filed 17November2025, this second one was not addressed):
Please also re-introduce the percent sign “%” within the recitation of “…are at least 85 complementary to”.
Appropriate correction is required.
Claim 53 REMAINS objected to because of the following informalities: for consistency with claim 1 and clarity (please note that the recitation of “at least 200 contiguous nucleotides” conflicts with the recitation of “a segment of SEQ ID NO: 47” which reads on any 2+ nucleotides found within SEQ ID NO: 47) please amend “identity with a segment of SEQ ID NO: 47” to “identity to the sequence SEQ ID NO: 47”. Appropriate correction is required.
Response to Applicant’s Remarks:
Applicant traverses this objection and argues that (page 5 of the Remarks):
PNG
media_image1.png
78
526
media_image1.png
Greyscale
While Applicant’s interpretation of this claim language is acknowledged, it does not remedy the fact that “segment” may reasonably mean any 2+ nucleotides found within the sequence SEQ ID NO: 47. For that reason, the Office maintains that the use of “segment” in claim 53 is an informality that should be remedied. Please amend the claim as suggested by the Office to remove the problematic informality and make the language of claim 53 consistent with claim 1 as well as claims 5 and 6.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6 and 53 REMAIN rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 recites “… a nucleotide sequence of at least about 85% sequence identity to SEQ ID NO: 47” and claim 53 recites “…nucleotides with at least about 85% sequence identity with a segment of SEQ ID NO: 47”. While the recitation of “about” does not necessarily make a claim indefinite (MPEP § 2173.05(b)), in the context within which “about” is being used here (percent identity between sequences) and because the specification does not provide a limiting definition of how to interpret “about” in this context; the phrase “at least about” in claims 6 and 53 renders the claims indefinite. To explain by example, the Office cannot find a limiting definition of “about” in the specification and that term does not have a well-recognized meaning in the art (at least not in the context of sequence identity). So, one is left to wonder whether “about” in this context means a .5% or less variation to account for rounding to a whole number (e.g., where “at least 85% sequence identity” to SEQ ID NO: 47 would capture sequences with 84.5-84.9% or 85.1-85.4% identity to SEQ ID NO: 47) or whether “about” in this context captures broader variations (2% change? 5% change? 10% change? 20% change?). Without clarity from Applicant as to what “about” means in this context, the scope of the claims is unclear.
Response to Applicant’s Remarks:
Applicant asserts that ¶69 on page 37 of the specification provides a limiting definition of “about” in the context of sequence identity.
This is not persuasive at least because the cited paragraph does not provide a limiting definition (“variance of up to 1-3 percent” is not limiting):
PNG
media_image2.png
154
730
media_image2.png
Greyscale
If Applicant want to recite a particular percent identity range, please just recite the corresponding integer(s) in the claims. For example, if Applicant wants “at least about 98% sequence identity” at claim 6 to be interpreted to mean “at least 95% sequence identity”; then just say so in the claims (i.e., just recite “at least 95% sequence identity” in the claims). The recitation of “about” in these claims remains indefinite.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 5-7, 21-22, 26-27, 53 REMAIN rejected and claims 54-56 are rejected under 35 U.S.C. 103 as being unpatentable over ISLAM & SHERIF (“RNAi-Based Biofungicides as a Promising Next-Generation Strategy for Controlling Devastating Gray Mold Diseases” 18March2020 Int’l. J. Mol. Sci. 21(2072):10 total pages (doi:10.3390/ijms21062072) and XIONG et al. (“Host-induced gene silencing of BcTOR in Botrytis cinerea enhances plant resistance to grey mould” 2019 Mol. Plant Path. 20(12):1722-1739) and WANG et al. (“Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection” 2016 Nat. Plants 2(16151): doi.10.1038/nplants.2016.151) and UniProt ID A0A384JLS4_BOTFB ((Accession No. A0A384JLS4) Version 12 dated 07April2021 (2 total pages); available at https://www.uniprot.org/uniprotkb/A0A384JLS4/entry) and NCBI Reference Sequence XM_024693733.1 (Version 1 dated 17April2018 (2 total pages); available at https://www.ncbi.nlm.nih.gov/nuccore/XM_024693733.1) and DEVAUX et al. (“Diversification of Function by Different Isoforms of Conventionally Shared RNA Polymerase Subunits” 2007 Mol. Biol. Cell 18:1293-1301) and BOUKHAROV et al. (US 2007/0271630 of Appl. No. 11360355 on 22November2007) and LIU et al. (“Conserved Fungal Genes as Potential Targets for Broad-Spectrum Antifungal Drug Discovery” 2006 Euk. Cell. 5(4):638-649).
With respect to this rejection, the only material change in the claims filed 17November2025 is at claims 26 and 54-56 (the claims now break up the plant types previously recited in claim 26): claim 26 now recites a fruit bearing plant, new claim 54 now recites a vegetable, new claim 55 now recites an “ornamental plant”, and new claim 56 now recites the specific plant types which were previously recited at claim 26 (i.e., “strawberry, grape, tomato, or bean”). None of “fruit bearing plant”, “vegetable”, or “ornamental plant” have a limiting definition within the specification or an art-recognized meaning. Therefore, they are interpreted broadly and understood to encompass tomato plants.
↓
PNG
media_image3.png
49
535
media_image3.png
Greyscale
↓
These claims (as elected) are generally directed toward fungicidal compositions for, and methods of their use in, suppressing the Botrytis cinerea1 “RPB5” gene2 via double-stranded RNA (“dsRNA”) and, thereby, controlling B. cinerea infection of a plant (e.g., via inducing B. cinerea growth suppression, decreased pathogenicity, and/or mortality/death).
ISLAM & SHERIF teach fungicidal compositions which function via dsRNA and their use for controlling B. cinerea infection of, for example, tomato plants. [relevant to claims 1, 2-3, 21, 22, 26, 27, 54-56] Of the several reasons given by ISLAM & SHERIF for recommending a dsRNA approach are (1) a dsRNA approach would alleviate incidence and concern over fungicide-resistant-B. cinerea strains (noting that some B. cinerea strains are now resistant to certain chemical fungicides) as well as off-target impacts such as to the environment3 and (2) fungicides utilizing dsRNA have already been effective against B. cinerea: ISLAM & SHERIF cite XIONG et al. as evidence that a host-transcribed dsRNA (e.g., tomato host4 [relevant to claim 26]) can effectively suppress critical B. cinerea gene targets (in XIONG et al., TOR) and cause B. cinerea growth suppression, decreased pathogenicity, and/or mortality/death [relevant to claim 27]. ISLAM & SHERIF also cite WANG et al. as evidence that topical application of dsRNAs (there, targeting DCL1 and DCL2 genes5 in a composition comprising water as a carrier agent6 [relevant to claims 2-3]) to, for example, tomato [relevant to claims 26, 54-56] causes decreased B. cinerea pathogenicity7 [relevant to claim 27]. For completeness, WANG et al. also teach tomato-host-expression of RNAs targeting B. cinerea DCL1 and DCL2 to control B. cinerea infection.8
None of ISLAM & SHERIF, XIONG et al., and WANG et al. teach or suggest targeting the B. cinerea RPB5 gene for suppression nor, it follows, that the B. cinerea gene (or RNA molecules suppressing it) comprises the specific sequences recited in these claims (i.e., suppresses SEQ ID NO: 11 and/or comprises the sequence SEQ ID NO: 47).
As an initial matter, the polynucleotide sequences SEQ ID NOs: 11 and 47 both encode the B. cinerea RPB5 amino acid sequence published as UniProt ID A0A384JLS4_BOTFB (Accession No. A0A384JLS4) which is the sequence encoded by the Open Reading Frame (locus) named “BCIN_06g07270” (please note that “BCIN_06g07270” is referenced within the attached copy of the amino acid sequence published as UniProt ID A0A384JLS4_BOTFB, the attached copy of the polynucleotide sequence published as NCBI Reference Sequence XM_024693733.1 (Version 1 dated 17April2018), and the alignments of SEQ ID NOs: 11 and 47 to the amino acid sequence UniProt ID A0A384JLS4_BOTFB herein below). For clarity of the record, UniProt ID A0A384JLS4_BOTFB and NCBI Reference Sequence XM_024693733.1 were both known to the prior art at B. cinerea RPB5 sequences (see the descriptions within those attachments labeling each as “RPB5” sequences).
Before this application was filed, it was already shown that dsRNA-induced suppression of a pathogen’s RPB5 gene causes “rapid growth arrest and cell death” (DEVAUX et al., there the pathogen being the protozoan parasite Trypanosoma brucei9). Targeting a pathogen’s RPB5 gene had also been suggested in other pathogen::host contexts such as to control soybean cyst nematode infection of soybean plants (BOUKHAROV et al.10, with dsRNA-suppression being specifically suggested11) and to control Saccharomyces cerevisiae (i.e. fungal) infection of humans (LIU et al.12).
In view of the cited references, it is the Office position that a person with ordinary skill in the art at the time this application was filed (a “POSA”) would have found it obvious to utilize dsRNA suppression of B. cinerea RPB5 as a fungicide because it would have been no more than the “simple substitution of one known element (dsRNA-suppression of T. brucei RPB5 per DEVAUX et al.) for another (B. cinerea RPB5) to obtain predictable results (pathogen grown cessation or reduced pathogenicity per DEVAUX et al.) ” (MPEP § 2143(I)(B)) and/or the “use of [a] known technique (dsRNA-suppression of pathogen’s RPB5 per DEVAUX et al.) to improve similar methods/products (here, the pathogen being B. cinerea) in the same way” (MPEP § 2143(I)(C)) and/or “applying a known technique (dsRNA-suppression of a pathogen’s RPB5 gene per DEVAUX et al., BOUKHAROV et al., and LIU et al.) to a known product (B. cinerea RPB5 gene per UniProt ID A0A384JLS4_BOTFB and NCBI Reference Sequence XM_024693733.1) ready for improvement to yield predictable results (i.e., pathogen growth cessation, decreased pathogenicity, and/or mortality/death)” (MPEP § 2143(I)(D)) and/or (at the very least) “obvious to try”, especially in view of the successful results reported by DEVAUX et al. and the suggestion to use dsRNA suppression to control B. cinerea per ISLAM & SHERIF including the benefits discussed by ISLAM & SHERIF to use, in particular, a dsRNA-suppression approach for B. cinerea control (MPEP § 2143(I)(E)).
To be clear regarding the sequence particulars recited in claims 1, 5-7, 21, and 53; there is nothing of record to suggest that the structures/sequences therein would have been nonobvious to a POSA. This is the Office’s position in view of the sequence identity of sequences SEQ ID NOs: 11 and 47 to known sequences (100% identity to UniProt ID A0A384JLS4_BOTFB and NCBI Reference Sequence XM_024693733.1), since the dsRNA molecules utilized by Applicant were generated using the sequence published as NCBI Reference Sequence XM_024693733.1 (Table 1A of the specification at ¶229 on page 124), since there is nothing of record to suggest that these claims are directed toward products or methods utilizing a unique dsRNA construction/protocol, and in view of the breadth of these claims (claims 1 merely requires one strand of the dsRNA molecule have at least 200 contiguous nucleotides and be at least 85% complementary to an RNA transcribed from a target gene comprising SEQ ID NO: 11, claim 53 merely requires an RNA molecule of at least 200 consecutive nucleotides with at least 85% identity to a segment of SEQ ID NO: 47, claim 21 merely requires that the “at least 200 contiguous nucleotides” be at least 400 contiguous nucleotides, claim 5 merely requires a first strand with at least 85% sequence identity to SEQ ID NO: 47, claim 6 merely requires a first strand nucleotide sequence “of at least about” 98% identity to SEQ ID NO: 47, and claim 7 merely requires a second strand complementary to the first). Applicant is reminded that even if claimed sequences are not (explicitly) taught by the prior art, they may be obvious. As an example, the Board recently explained (in the context of new marker sequences) that when sequences are obtained using known materials and conventional technology, such sequences may be obvious even if they are new.13 Applicant is welcomed to show, with supporting evidence, how the sequence particulars of claims 1, 5-7, 21, and 53 would not have been obvious to a POSA (in the context of the POSA using molecules for dsRNA-suppression of B. cinerea RPB5).
Alignment of SEQ ID NO: 11 to the amino acid sequence published as UniProt ID A0A384JLS4_BOTFB
(see Result 1 of the 01May2025 sequence search file “us-17-815-196-11.rup”)
RESULT 1
A0A384JLS4_BOTFB
(NOTE: this sequence has 1 duplicate in the database searched)
ID A0A384JLS4_BOTFB Unreviewed; 241 AA.
AC A0A384JLS4;
DT 07-NOV-2018, integrated into UniProtKB/TrEMBL.
DT 07-NOV-2018, sequence version 1.
DT 27-NOV-2024, entry version 22.
DE RecName: Full=DNA-directed RNA polymerases I, II, and III subunit RPABC1 {ECO:0000256|ARBA:ARBA00020809};
GN Name=Bcrpb5 {ECO:0000313|EMBL:ATZ51314.1};
GN ORFNames=BCIN_06g07270 {ECO:0000313|EMBL:ATZ51314.1};
OS Botryotinia fuckeliana (strain B05.10) (Noble rot fungus) (Botrytis
OS cinerea).
OC Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes;
OC Helotiales; Sclerotiniaceae; Botrytis.
OX NCBI_TaxID=332648 {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798};
RN [1] {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=B05.10 {ECO:0000313|EMBL:ATZ51314.1,
RC ECO:0000313|Proteomes:UP000001798};
RX PubMed=21876677; DOI=.1371/journal.pgen.1002230;
RA Amselem J., …;
RT "Genomic analysis of the necrotrophic fungal pathogens Sclerotinia
RT sclerotiorum and Botrytis cinerea.";
RL PLoS Genet. 7:E1002230-E1002230(2011).
RN [2] {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=B05.10 {ECO:0000313|EMBL:ATZ51314.1,
RC ECO:0000313|Proteomes:UP000001798};
RX PubMed=23104368; DOI=.1128/EC.00164-12;
RA Staats M., van Kan J.A.;
RT "Genome update of Botrytis cinerea strains B05.10 and T4.";
RL Eukaryot. Cell 11:1413-1414(2012).
RN [3] {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=B05.10 {ECO:0000313|EMBL:ATZ51314.1,
RC ECO:0000313|Proteomes:UP000001798};
RX PubMed=26913498; DOI=.1111/mpp.12384;
RA Van Kan J.A…;
RT "A gapless genome sequence of the fungus Botrytis cinerea.";
RL Mol. Plant Pathol. 18:75-89(2017).
CC -!- SUBCELLULAR LOCATION: Nucleus {ECO:0000256|ARBA:ARBA00004123}.
CC -!- SIMILARITY: Belongs to the archaeal Rpo5/eukaryotic RPB5 RNA polymerase
CC subunit family. {ECO:0000256|ARBA:ARBA00025765}.
CC ---------------------------------------------------------------------------
CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms
CC Distributed under the Creative Commons Attribution (CC BY 4.0) License
CC ---------------------------------------------------------------------------
DR EMBL; CP009810; ATZ51314.1; -; Genomic_DNA.
DR AlphaFoldDB; A0A384JLS4; -.
DR EnsemblFungi; Bcin06g07270.1; Bcin06p07270.1; Bcin06g07270.
DR VEuPathDB; FungiDB:Bcin06g07270; -.
DR OrthoDB; 101801at2759; -.
DR Proteomes; UP000001798; Chromosome bcin06.
DR GO; GO:0005736; C:RNA polymerase I complex; IEA:EnsemblFungi.
DR GO; GO:0005665; C:RNA polymerase II, core complex; IEA:EnsemblFungi.
DR GO; GO:0005666; C:RNA polymerase III complex; IEA:EnsemblFungi.
DR GO; GO:0003677; F:DNA binding; IEA:InterPro.
DR GO; GO:0001054; F:RNA polymerase I activity; IEA:EnsemblFungi.
DR GO; GO:0001055; F:RNA polymerase II activity; IEA:EnsemblFungi.
DR GO; GO:0001056; F:RNA polymerase III activity; IEA:EnsemblFungi.
DR GO; GO:0003968; F:RNA-dependent RNA polymerase activity; IEA:EnsemblFungi.
DR GO; GO:0006363; P:termination of RNA polymerase I transcription; IEA:EnsemblFungi.
DR GO; GO:0006386; P:termination of RNA polymerase III transcription; IEA:EnsemblFungi.
DR GO; GO:0006362; P:transcription elongation by RNA polymerase I; IEA:EnsemblFungi.
DR GO; GO:0006368; P:transcription elongation by RNA polymerase II; IEA:EnsemblFungi.
DR GO; GO:0006361; P:transcription initiation at RNA polymerase I promoter; IEA:EnsemblFungi.
DR GO; GO:0006367; P:transcription initiation at RNA polymerase II promoter; IEA:EnsemblFungi.
DR GO; GO:0006384; P:transcription initiation at RNA polymerase III promoter; IEA:EnsemblFungi.
DR GO; GO:0042797; P:tRNA transcription by RNA polymerase III; IEA:EnsemblFungi.
DR FunFam; 3.40.1340.10:FF:000002; DNA-directed RNA polymerases I, II, and III subunit RPABC1; 1.
DR FunFam; 3.90.940.20:FF:000001; DNA-directed RNA polymerases I, II, and III subunit RPABC1; 1.
DR Gene3D; 3.40.1340.10; RNA polymerase, Rpb5, N-terminal domain; 1.
DR Gene3D; 3.90.940.20; RPB5-like RNA polymerase subunit; 1.
DR HAMAP; MF_00025; RNApol_Rpo5_RPB5; 1.
DR InterPro; IPR014381; Arch_Rpo5/euc_Rpb5.
DR InterPro; IPR005571; RNA_pol_Rpb5_N.
DR InterPro; IPR036710; RNA_pol_Rpb5_N_sf.
DR InterPro; IPR000783; RNA_pol_subH/Rpb5_C.
DR InterPro; IPR020608; RNA_pol_subH/Rpb5_CS.
DR InterPro; IPR035913; RPB5-like_sf.
DR PANTHER; PTHR10535; DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC1; 1.
DR PANTHER; PTHR10535:SF0; DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC1; 1.
DR Pfam; PF01191; RNA_pol_Rpb5_C; 1.
DR Pfam; PF03871; RNA_pol_Rpb5_N; 1.
DR PIRSF; PIRSF000747; RPB5; 1.
DR SUPFAM; SSF53036; Eukaryotic RPB5 N-terminal domain; 1.
DR SUPFAM; SSF55287; RPB5-like RNA polymerase subunit; 1.
DR PROSITE; PS01110; RNA_POL_H_23KD; 1.
PE 3: Inferred from homology;
KW Nucleus {ECO:0000256|ARBA:ARBA00023242};
KW Reference proteome {ECO:0000313|Proteomes:UP000001798};
KW Transcription {ECO:0000256|ARBA:ARBA00023163}.
FT DOMAIN 16..124
FT /note="RNA polymerase Rpb5 N-terminal"
FT /evidence="ECO:0000259|Pfam:PF03871"
FT DOMAIN 168..240
FT /note="RNA polymerase subunit H/Rpb5 C-terminal"
FT /evidence="ECO:0000259|Pfam:PF01191"
SQ SEQUENCE 241 AA; 27290 MW; D0C7ADDDEA92FAB1 CRC64;
Length: 241
Score: 1226.00 Matches: 241
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 39.1% Indels: 0
Gaps: 0
US-17-815-196-11 (1-1820) x A0A384JLS4_BOTFB (1-241)
Qy 184 ATGGCTGATGATGAGGATCGCGCGCAAAAGCAACGGGACGGAATTGATAGAGAGGCCGCA 243
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 MetAlaAspAspGluAspArgAlaGlnLysGlnArgAspGlyIleAspArgGluAlaAla 20
Qy 244 AAGCTTTGGAGATGTTATCGAACCGTACACGAGATGGTCCAGGATCGGGGTTACCTTCTC 303
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 21 LysLeuTrpArgCysTyrArgThrValHisGluMetValGlnAspArgGlyTyrLeuLeu 40
Qy 304 GCTGAAGAAGAAGTCAACATGAGCTTTGATACATTCAAGAGCAAGTTCACCAGTAATGAT 363
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 41 AlaGluGluGluValAsnMetSerPheAspThrPheLysSerLysPheThrSerAsnAsp 60
Qy 364 GGAAGTGTTGATCGTCGCCAAATGAACTTCTCCGCAACTCCAAGTGAAGCTATGATTGCC 423
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GlySerValAspArgArgGlnMetAsnPheSerAlaThrProSerGluAlaMetIleAla 80
Qy 424 AGATACGCAGTTGCGCCCACAGCGGAGAACCCAAACCCCACTACCTCAGAAATCGGTACT 483
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 81 ArgTyrAlaValAlaProThrAlaGluAsnProAsnProThrThrSerGluIleGlyThr 100
Qy 484 ATCTGGATTGAGTTTCTCATGGTCACTGATGTTTCTATTGGAATCAAACAAATGCGAACG 543
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 101 IleTrpIleGluPheLeuMetValThrAspValSerIleGlyIleLysGlnMetArgThr 120
Qy 544 TTCGCCCAGCATCTTTCTCAACATAACTTCTCGGCCGGAATCCTCATCGCACCTGTTGCA 603
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 PheAlaGlnHisLeuSerGlnHisAsnPheSerAlaGlyIleLeuIleAlaProValAla 140
Qy 604 CCATCAGGTCCCGCTCAAAAGATTATTCCCGCTGTCGCATCCGAGACAAGAATCGAGACC 663
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 141 ProSerGlyProAlaGlnLysIleIleProAlaValAlaSerGluThrArgIleGluThr 160
Qy 664 TTCGTCGAGCAAGATTTACTTGTCAATATTACACATCATGAATTGGTTCCCAAGCATGTT 723
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 161 PheValGluGlnAspLeuLeuValAsnIleThrHisHisGluLeuValProLysHisVal 180
Qy 724 TTGTTAAGTAGAGAAGAGAGGGCCAAGTTGTTGTCAAGATATAGATTGAAGGATACTCAA 783
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 LeuLeuSerArgGluGluArgAlaLysLeuLeuSerArgTyrArgLeuLysAspThrGln 200
Qy 784 CTCCCACGTATTCAGGCTGCGGATCCAGTTGCAAAATATTTGGGATTGAGAAGAGGGCAG 843
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 201 LeuProArgIleGlnAlaAlaAspProValAlaLysTyrLeuGlyLeuArgArgGlyGln 220
Qy 844 GTCGTTAAGATTATCAGAAAGTCGGAAACTGCTGGTCGTTATGCCAGTTACAGATTGTGC 903
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 221 ValValLysIleIleArgLysSerGluThrAlaGlyArgTyrAlaSerTyrArgLeuCys 240
Qy 904 GTA 906
|||
Db 241 Val 241
Alignment of SEQ ID NO: 47 to the amino acid sequence published as UniProt ID A0A384JLS4_BOTFB
(see Result 3 of the 01May2025 sequence search file “us-17-815-196-47.rup”)
RESULT 3
A0A384JLS4_BOTFB
(NOTE: this sequence has 1 duplicate in the database searched)
ID A0A384JLS4_BOTFB Unreviewed; 241 AA.
AC A0A384JLS4;
DT 07-NOV-2018, integrated into UniProtKB/TrEMBL.
DT 07-NOV-2018, sequence version 1.
DT 27-NOV-2024, entry version 22.
DE RecName: Full=DNA-directed RNA polymerases I, II, and III subunit RPABC1 {ECO:0000256|ARBA:ARBA00020809};
GN Name=Bcrpb5 {ECO:0000313|EMBL:ATZ51314.1};
GN ORFNames=BCIN_06g07270 {ECO:0000313|EMBL:ATZ51314.1};
OS Botryotinia fuckeliana (strain B05.10) (Noble rot fungus) (Botrytis
OS cinerea).
OC Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes;
OC Helotiales; Sclerotiniaceae; Botrytis.
OX NCBI_TaxID=332648 {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798};
RN [1] {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=B05.10 {ECO:0000313|EMBL:ATZ51314.1,
RC ECO:0000313|Proteomes:UP000001798};
RX PubMed=21876677; DOI=.1371/journal.pgen.1002230;
RA Amselem J…;
RT "Genomic analysis of the necrotrophic fungal pathogens Sclerotinia
RT sclerotiorum and Botrytis cinerea.";
RL PLoS Genet. 7:E1002230-E1002230(2011).
RN [2] {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=B05.10 {ECO:0000313|EMBL:ATZ51314.1,
RC ECO:0000313|Proteomes:UP000001798};
RX PubMed=23104368; DOI=.1128/EC.00164-12;
RA Staats M., van Kan J.A.;
RT "Genome update of Botrytis cinerea strains B05.10 and T4.";
RL Eukaryot. Cell 11:1413-1414(2012).
RN [3] {ECO:0000313|EMBL:ATZ51314.1, ECO:0000313|Proteomes:UP000001798}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=B05.10 {ECO:0000313|EMBL:ATZ51314.1,
RC ECO:0000313|Proteomes:UP000001798};
RX PubMed=26913498; DOI=.1111/mpp.12384;
RA Van Kan J.A… ;
RT "A gapless genome sequence of the fungus Botrytis cinerea.";
RL Mol. Plant Pathol. 18:75-89(2017).
CC -!- SUBCELLULAR LOCATION: Nucleus {ECO:0000256|ARBA:ARBA00004123}.
CC -!- SIMILARITY: Belongs to the archaeal Rpo5/eukaryotic RPB5 RNA polymerase
CC subunit family. {ECO:0000256|ARBA:ARBA00025765}.
CC ---------------------------------------------------------------------------
CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms
CC Distributed under the Creative Commons Attribution (CC BY 4.0) License
CC ---------------------------------------------------------------------------
DR EMBL; CP009810; ATZ51314.1; -; Genomic_DNA.
DR AlphaFoldDB; A0A384JLS4; -.
DR EnsemblFungi; Bcin06g07270.1; Bcin06p07270.1; Bcin06g07270.
DR VEuPathDB; FungiDB:Bcin06g07270; -.
DR OrthoDB; 101801at2759; -.
DR Proteomes; UP000001798; Chromosome bcin06.
DR GO; GO:0005736; C:RNA polymerase I complex; IEA:EnsemblFungi.
DR GO; GO:0005665; C:RNA polymerase II, core complex; IEA:EnsemblFungi.
DR GO; GO:0005666; C:RNA polymerase III complex; IEA:EnsemblFungi.
DR GO; GO:0003677; F:DNA binding; IEA:InterPro.
DR GO; GO:0001054; F:RNA polymerase I activity; IEA:EnsemblFungi.
DR GO; GO:0001055; F:RNA polymerase II activity; IEA:EnsemblFungi.
DR GO; GO:0001056; F:RNA polymerase III activity; IEA:EnsemblFungi.
DR GO; GO:0003968; F:RNA-dependent RNA polymerase activity; IEA:EnsemblFungi.
DR GO; GO:0006363; P:termination of RNA polymerase I transcription; IEA:EnsemblFungi.
DR GO; GO:0006386; P:termination of RNA polymerase III transcription; IEA:EnsemblFungi.
DR GO; GO:0006362; P:transcription elongation by RNA polymerase I; IEA:EnsemblFungi.
DR GO; GO:0006368; P:transcription elongation by RNA polymerase II; IEA:EnsemblFungi.
DR GO; GO:0006361; P:transcription initiation at RNA polymerase I promoter; IEA:EnsemblFungi.
DR GO; GO:0006367; P:transcription initiation at RNA polymerase II promoter; IEA:EnsemblFungi.
DR GO; GO:0006384; P:transcription initiation at RNA polymerase III promoter; IEA:EnsemblFungi.
DR GO; GO:0042797; P:tRNA transcription by RNA polymerase III; IEA:EnsemblFungi.
DR FunFam; 3.40.1340.10:FF:000002; DNA-directed RNA polymerases I, II, and III subunit RPABC1; 1.
DR FunFam; 3.90.940.20:FF:000001; DNA-directed RNA polymerases I, II, and III subunit RPABC1; 1.
DR Gene3D; 3.40.1340.10; RNA polymerase, Rpb5, N-terminal domain; 1.
DR Gene3D; 3.90.940.20; RPB5-like RNA polymerase subunit; 1.
DR HAMAP; MF_00025; RNApol_Rpo5_RPB5; 1.
DR InterPro; IPR014381; Arch_Rpo5/euc_Rpb5.
DR InterPro; IPR005571; RNA_pol_Rpb5_N.
DR InterPro; IPR036710; RNA_pol_Rpb5_N_sf.
DR InterPro; IPR000783; RNA_pol_subH/Rpb5_C.
DR InterPro; IPR020608; RNA_pol_subH/Rpb5_CS.
DR InterPro; IPR035913; RPB5-like_sf.
DR PANTHER; PTHR10535; DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC1; 1.
DR PANTHER; PTHR10535:SF0; DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC1; 1.
DR Pfam; PF01191; RNA_pol_Rpb5_C; 1.
DR Pfam; PF03871; RNA_pol_Rpb5_N; 1.
DR PIRSF; PIRSF000747; RPB5; 1.
DR SUPFAM; SSF53036; Eukaryotic RPB5 N-terminal domain; 1.
DR SUPFAM; SSF55287; RPB5-like RNA polymerase subunit; 1.
DR PROSITE; PS01110; RNA_POL_H_23KD; 1.
PE 3: Inferred from homology;
KW Nucleus {ECO:0000256|ARBA:ARBA00023242};
KW Reference proteome {ECO:0000313|Proteomes:UP000001798};
KW Transcription {ECO:0000256|ARBA:ARBA00023163}.
FT DOMAIN 16..124
FT /note="RNA polymerase Rpb5 N-terminal"
FT /evidence="ECO:0000259|Pfam:PF03871"
FT DOMAIN 168..240
FT /note="RNA polymerase subunit H/Rpb5 C-terminal"
FT /evidence="ECO:0000259|Pfam:PF01191"
SQ SEQUENCE 241 AA; 27290 MW; D0C7ADDDEA92FAB1 CRC64;
Length: 241
Score: 508.00 Matches: 102
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 50.3% Indels: 0
Gaps: 0
US-17-815-196-47 (1-586) x A0A384JLS4_BOTFB (1-241)
Qy 585 GCACCATCAGGTCCCGCTCAAAAGATTATTCCCGCTGTCGCATCCGAGACAAGAATCGAG 526
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 140 AlaProSerGlyProAlaGlnLysIleIleProAlaValAlaSerGluThrArgIleGlu 159
Qy 525 ACCTTCGTCGAGCAAGATTTACTTGTCAATATTACACATCATGAATTGGTTCCCAAGCAT 466
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 160 ThrPheValGluGlnAspLeuLeuValAsnIleThrHisHisGluLeuValProLysHis 179
Qy 465 GTTTTGTTAAGTAGAGAAGAGAGGGCCAAGTTGTTGTCAAGATATAGATTGAAGGATACT 406
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 180 ValLeuLeuSerArgGluGluArgAlaLysLeuLeuSerArgTyrArgLeuLysAspThr 199
Qy 405 CAACTCCCACGTATTCAGGCTGCGGATCCAGTTGCAAAATATTTGGGATTGAGAAGAGGG 346
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 200 GlnLeuProArgIleGlnAlaAlaAspProValAlaLysTyrLeuGlyLeuArgArgGly 219
Qy 345 CAGGTCGTTAAGATTATCAGAAAGTCGGAAACTGCTGGTCGTTATGCCAGTTACAGATTG 286
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 220 GlnValValLysIleIleArgLysSerGluThrAlaGlyArgTyrAlaSerTyrArgLeu 239
Qy 285 TGCGTA 280
||||||
Db 240 CysVal 241
Response to Applicant’s Remarks 17November2025:
(1) Applicant traverses this rejection by arguing that the cited references which discuss RPB5 do so with relation to (supposedly) very different organisms (unicellular yeast, a protozoan, or nematode) than the fungus of these claims (Botrytis cinerea). According to Applicant, because the prior art discussed RPB5 in the context of (supposedly) very different organisms, a POSA would not have had a reasonable expectation of successfully suppressing Botrytis cinerea RPB5 and would not have had a reasonable expectation that such suppression may be used to control (prevent) Botrytis cinerea infection or disease therefrom. (Remarks at pages 6-7)
This is not persuasive because Applicant is overlooking what RPB5 is: RPB5 is an RNA polymerase subunit present within all eukaryotes (there is no known eukaryote which does not comprise RPB5) (see the Abstract of DEVAUX et al.). A POSA would understand that RPB5 is ubiquitous across eukaryotes and, therefore, would not be deterred from applying the results in unicellular yeast, a protozoan, or nematode to a fungus such as Botrytis cinerea.
(2) Applicant also asserts that the use of RNAi “for control of plant pests or pathogens” was unpredictable and, therefore, a POSA would not have had the requisite reasonable expectation of success. (Remarks at page 7)
This is not persuasive in view of the cited references (showing successful use of dsRNA-induced suppression of a pathogen’s RPB5 gene and the continued suggestion by at least ISLAM & SHERIF to use a dsRNA approach).
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Rebecca STEPHENS whose telephone number is (571)272-0070. The examiner can normally be reached Monday through Friday 8:30-4:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad ABRAHAM can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/REBECCA STEPHENS/Examiner, Art Unit 1663
/MATTHEW R KEOGH/Primary Examiner, Art Unit 1663
1 Also known as Botryotinia fuckeliana. See UniProt ID A0A384JLS4_BOTFB.
2 “RPB5” is also known as the “RPABC1” subunit within RNA polymerases I, II, and III. See UniProt ID A0A384JLS4_BOTFB.
3 ISLAM & SHERIF at the bridge of pages 5-6.
4 XIONG et al. at Abstract, page 1730, and Fig. 9 on page 1733.
5 WANG et al. at Abstract.
6 WANG et al. at page 10.
7 WANG et al. at the bridge of pages 2-3.
8 See WANG et al. at the bridge of pages 3-4.
9 DEVAUX et al. at the Abstract and the left column of page 1298.
10 BOUKHAROV et al. at Table 1 on page 50.
11 See BOUKHAROV et al. at ¶113 on page 17.
12 LIU et al. at Table 2 at page 641.
13 Ex parte CHAKY et al. (PTAB, Appeal 2015-001609 for Appl. No. 13339548, 25November2016, 14 total pages).