Prosecution Insights
Last updated: April 19, 2026
Application No. 17/815,711

GENOME ENGINEERING THE HUMAN IMMUNOGLOBULIN LOCUS TO EXPRESS RECOMBINANT BINDING DOMAIN MOLECULES

Non-Final OA §102§103§112
Filed
Jul 28, 2022
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF SOUTHERN CALIFORNIA
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
3y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allow Rate
104 granted / 177 resolved
-1.2% vs TC avg
Strong +63% interview lift
Without
With
+62.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
56 currently pending
Career history
233
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
14.3%
-25.7% vs TC avg
§112
29.4%
-10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 177 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status and Election Claims 1-56 are pending Applicant’s election without traverse of Group 1, directed to methods of producing antibody fragments or non-immunoglobulin binding domains from an immunoglobulin locus in B cells and methods of treating a disease with the antibody fragments, in the Reply filed December 22, 2025 is acknowledged. Claims 19-22 and 35-56 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected groups, there being no allowable generic or linking claim. Applicant’s election of the species (A) HIV, (B) CRISPR/Cas9 genome editing system and (C) an antibody fragment as the binding domain is also acknowledged. Claims 9-10 and 27-34 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected species, there being no allowable generic or linking claim. Claims 1-8, 11-18 and 23-26 are under examination along with the species recited above. Drawings The drawings are objected to because the lines, shadings, numbers and letters of FIGs 4, 6, 8, 11, 12, 13, 20 and 22 are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, the text in FIGs above is light grey or otherwise not sufficiently dense and dark to permit satisfactory reproduction characteristics; the letters over shading especially in FIGs 4, 6, and 20 are not sufficiently dark for reproduction; and the text in many of the FIGs above is very small and of poor resolution. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the term TALEN®, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claims 3-4 are objected to because of the following informalities: Claims 3-4 recite “wherein the immunoglobulin locus is selection from the IGHG1…”. The “the” before the list of IGH loci is not required and grammatically incorrect. It is suggested to delete “the” before the list of IGH loci in each of claims 3 and 4. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 6, 8 and 11 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 6 contains the trademark/trade name TALEN®. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a protein fusion between a transcription activator-like effector domain and a FokI nuclease domain and, accordingly, the identification/description is indefinite. Although TALEN is an acronym used in the art to refer to transcription activator-like effector domains fused to nuclease domains, the term is still a trademark nonetheless. To remedy the indefiniteness, it is suggested that “(TALEN)” be removed from the claim. If Applicant desires to include a shorthand name, “TALE nuclease” is suggested. Claim 8 recites “The method of claim 7, wherein the spCas9 guide RNAs target a polynucleotide having the sequence of sg01… sg17 presented in Table 2.” Claim 8 is indefinite for three reasons. First, “the spCas9 guide RNAs” lack clear antecedent basis”. Although claim 7 recites a CRISPR/Cas9 system and guide RNAs are an inherent component of CRISPR/Cas9 systems, claim 8 recites “the spCas9 guide RNA”. SpCas9 refers to the Cas9 originating from S. pyogenes that requires a specific handle sequence in the guide RNA and recognizes target DNA with specific PAM sequence. There are other CRISPR/Cas9 system, such as the system from S. aureus which requires a different PAM sequence, and therefore would require different targeting sequences on the guide RNA. Thus, an “spCas9 guide RNA” is not an inherent component of the more generic CRISPR/Cas9 system, and accordingly “the spCas9 guide RNAs” lacks clear antecedent basis. Second, it is not clear how many guide RNAs are required. Claims 1 and 7 recite “a/the genome editing system” which is interpreted as requiring as few as a single Cas9/gRNA system species. Each CRISPR/Cas9 system species needs a single guide RNA species since Cas9 binds to guide RNAs in a 1:1 ratio. Using the plural “guide RNAs” makes claim 8 confusing because it is not clear if only 1 guide RNA from the group is required or at least two guide RNAs from the group. Third, claim 8 also recites “having the sequence of sg01, sg02… or sg17 presented in Table 2”. Reference to tables in claims renders the claim indefinite when there is a practical way to define the invention in words. See MPEP 2173.05(s). Here, the tables contain exclusively text and the guide RNAs are also represented by SEQ ID NOs. The appropriate text could simply be imported into the claim or, preferably, the targeted sequences could be referenced using SEQ ID NOs. For instance, “wherein one or more Cas9 gRNAs targets a polynucleotide having one of SEQ ID NOs 15-23”. Claim 11 recites “a guide RNA (gRNA) that targets a sequence as set forth in Table 2, 3, 4 or 6.” Reference to tables in claims renders the claim indefinite when there is a practical way to define the invention in words. See MPEP 2173.05(s). Here, the tables contain exclusively text and the guide RNA targeted sequences are also represented by SEQ ID NOs. The appropriate text could simply be imported into the claim or, preferably, the guide RNA spacer sequence could he referenced using SEQ ID NOs. For instance, “wherein the genome editing system comprises a guide RNA (gRNA) that targets one of SEQ ID NOs 15-41”. Claim Rejections - 35 USC § 102 - Hartweger The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-2, 6-7, 13-14, 16-18, 23 and 25-26 are rejected under 35 U.S.C. 102(a)(1) as being by anticipated by Hartweger (Hartweger et al., Journal of Experimental Medicine (2019), 216: 1301-1310; cited in IDS filed 1/26/2024). Regarding claims 1-2, Hartweger teaches editing B cells to express mature broadly neutralizing antibodies to the HIV-1 virus (Abstract). Hartweger teaches introducing a targeted double strand break in the human IgH locus (i.e., a human immunoglobulin locus) (Fig 3A, scissors). Hartweger teaches inserting a ssDNA HDRT into the cleaved DNA site (Fig 3A). Hartweger teaches the ssDNA HDRT construct comprises the human IgHV1-69 promoter driving the expression of a VJCK construct a VDJ H domain (Fig 3A). The Specification defines “antibody fragment” as “at least one portion of an antibody that retains the ability to specifically inter with an epitope of an antigen. Hartweger’s VJCK construct and VDJ H domains are interpreted as “as antigen-binding domain and “an antibody fragment” since a B cells that expresses them can recognize the targeted antigen (Fig 3C). Because Hartweger teaches the B cells produce the antigen-binding domains encoded by the ssDNA HDRT (Fig 3C-D), the promoter driven expression construct must inherently produce an mRNA encoding the variable light chain and heavy chain antibody fragments. Regarding claims 6-7, Hartweger teaches using CRISPR/Cas9 – guide RNA systems for creating the double strand break in the IgH locus (Abstract; page 1307, ¶5). Regarding claim 13, Hartweger teaches the HDRT donor had homology arms (Fig 3A) and was integrated via homology-directed repair (page 1302, ¶4). Regarding claim 14, Hartweger teaches expression of the VJCK and VDJ H antibody fragments is driven by the IgHV1-69 promoter (i.e., a B-cell specific promoter) (Fig3A). Regarding claim 16, the Specification indicates that M1 and M2 exons have the coding sequence for the transmembrane domain, and that inclusion of the M1/M2 exons results in a transmembrane BRC, while exclusion results in a secreted antibody ([0037]). Hartweger teaches that the gene integration design allows for expression of membrane forms of the antibody (page 1303, ¶1), indicating that the mRNA further comprised M1 and M2 exons of the IgH locus. Regarding claim 17, the teachings of Hartweger are recited above as for claim 1. Hartweger teaches after integration of the antibody expression construct, the resulting engineered B cells express the antibody fragments (Fig 3C-D). Regarding claim 18, Hartweger teaches the B cells were isolated from healthy human individuals and transfected with Cas9/gRNA complexes (i.e., the B cells were treated ex vivo) (page 1307, ¶9 through page 1308, ¶2). Regarding claims 23 and 26, Hartweger also teaches editing mouse primary B cells (i.e., obtaining isolated B cells), by integrating a construct comprising a promoter that drives expression of bnAb VJ-C and a bnAb VDJ (i.e., antibody fragments comprising an antigen-binding domain) (Fig 2A). Hartweger teaches the engineered mouse B cells produce the antibody fragments (Fig 2C-D). Hartweger teaches the antibodies were reactive to HIV-1 antigens (i.e., a viral pathogen that can cause an infection) (Abstract). Hartweger teaches administering the edited B cells to mice and then immunizing the mice with the HIV-1 antigens (page 1305, ¶4-5). Hartweger teaches the edited cells can be used to produce sufficient antibodies to confer protective levels of humoral immunity (i.e., used in a method of treating a subject with the viral infection) (page 1305, ¶5). Regarding claim 25, Hartweger teaches the engineered B cells were originally isolated from C57BL6/J mice and administered to B6.Igha mice (i.e., the isolated B cells were allogenic to the subject) (Fig 4A). Claim Rejections - 35 USC § 102 - Voss Claims 1-2, 6-7, 13-14, 16-18, 23-24 and 26 are rejected under 35 U.S.C. 102(a)(2) as being by anticipated by Voss (US 20230060376 A1, effectively filed as least as early as August 3, 2018). Regarding claims 1-2, Voss teaches engineering B cells by modifying immunoglobulin genes (Abstract). Voss teaches modifying the Ig HC VDJ locus in Ramos cells (i.e., a human immunoglobulin locus in human B cells) (Fig 3B). Voss teaches introducing a targeted DNA break in the HC VDJ locus using Cas9/gRNA (i.e., a genome editing system) (FIGs 1 and 3, [0030]-[0031]). Voss teaches inserting a construct comprising a V434 promoter driving expression of the PG9 VDJ coding sequence (i.e., an antibody fragment comprising an antigen binding domain) (Fig 3A-B). Voss’s VDJ construct is interpreted as “as antigen-binding domain and “an antibody fragment” since a B cells that expresses them can recognize the targeted antigen (Fig 3B). Voss teaches the B cells produce mRNA encoding the PG9(VDJ) antibody fragment (Fig 3E). Regarding claims 6-7, Voss teaches using CRISPR/Cas9/guide RNA systems for creating the double strand break in the IgH locus ([0030]). Regarding claim 13, Voss teaches the V434p-PG9(VDJ) donor was integrated via homology directed repair ([0007], [0030]; Fig 3A). Regarding claim 14, Voss teaches expression of the PG9(VDJ) antibody fragment is driven by a V434 promoter (i.e., a B-cell specific promoter) (Fig3A). Regarding claim 16, the Specification indicates that M1 and M2 exons have the coding sequence for the transmembrane domain, and that inclusion of the M1/M2 exons results in a transmembrane BRC, while exclusion results in a secreted antibody ([0037]). Voss teaches that the modified IgH locus expresses the PG9 HC and results in cell surface expression of the HIV specific B cell receptors ([0032]), indicating that the mRNA further comprised M1 and M2 exons of the IgH locus. Regarding claim 17, the teachings of Voss are recited above as for claim 1. Voss teaches that after integration of the antibody expression construct, the resulting engineered B cells express the antibody fragments (Fig 3B). Regarding claim 18, Voss teaches the Ramos cells are a Bukitt’s lymphoma cell line (i.e., the B cells is engineered in vitro) ([0176]) Regarding claims 23 and 26, Voss also teaches editing primary human B cells (i.e., obtaining isolated B cells), by integrating a construct comprising a promoter driving expression of V374 promoter-driven the PG9 VDJ antibody fragment ([0212], FIGs 3A, 10). Voss teaches the engineered human B cells produce the antibody fragments ([0214]). Voss teaches the PG9 antibodies are specific to HIV-1 antigens (i.e., a viral pathogen that can cause an infection) ([0031]). Voss teaches the engineered B cells can be administered to a subject for treatment of a viral infection ([0109]). Regarding claim 24, Voss teaches the B cells that have undergone universal genome editing to replace the VDJ region with the PG9 HIV-1-specific VDJ region can undergo maturation followed by autologous engraftment (i.e., the isolated precursor B cells are autologous to the subject ([0198]). Claim Rejections - 35 USC § 103 – Voss in view of MacDonald and Hartweger The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 3-5 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Voss (US 20230060376 A1, effectively filed as least as early as August 3, 2018) in view of MacDonald (US 20110145937, published June 16, 2011) and Hartweger (Hartweger et al., Journal of Experimental Medicine (2019), 216: 1301-1310; cited in IDS filed 1/26/2024). The teachings of Voss are recited above in paragraphs 34-42 and incorporated here. Voss also teaches the region of replacement in the IgH locus can be as small as 450 nucleotides in length ([0052]). Voss teaches other regions can be selected for homologous recombination or to identify other recognition sites for guide Cas9 guide RNAs ([0053]). Voss teaches that Cas9 can be recruited to multiple regions in the IgH locus by programming the guide RNA spacer sequence ([0079]). Voss does not teach integration of the VDJ antibody fragment in the IGHG1 gene in relation to a CH1, Hinge, CH2 or CH3 exons. Regarding claims 3-5 and 12, MacDonald teaches that camels produce antibodies that are devoid of light chains ([0003]). MacDonald teaches there is a need in the art to make non-camelid VHH domains (i.e., heavy chain only antibodies) ([0004]). MacDonald teaches methods of making VH antibodies in vitro requires fusing coding sequence from the variable heavy region with coding sequence from the constant region without the CH1 domain ([0143]-[0143]). MacDonald also teaches methods for producing heavy chain antibodies by deletion of a CH1 domain in the IgHG gene (Abstract). MacDonald teaches integrating a selectable marker by homology directed repair into the IgG1 gene (i.e., an IGHG1 locus) such that the CH1 domain exon is removed (Figs 2-3). MacDonald teaches removal of the CH1 region links the VH domain directly with the CH2-CH3 domains to produce heavy chain antibodies (Fig 8, 10). The teachings or Hartweger are recited above in paragraphs 24-32 and incorporated here. Briefly, Hartweger teaches editing B cells to express mature broadly neutralizing antibodies to the HIV-1 virus by inserting a ssDNA HDRT comprising a promoter driving expression of a VDJ H domain into the IgH locus (Fig 3A). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have modified Voss’s method by integrating the PG9 VDJ heavy chain variable region and an exogenous promoter sequence as taught Hartweger directly upstream of the IGHG1 Hinge or CH2 region (i.e., downstream of the CH1 region). It would have amounted to integrating a known antibody fragment in a IgH locus region known to be amendable to homology directed repair by known means to yield predictable results. Methods for producing VHH antibodies by deleting other otherwise unlinking the variable heavy chain exons from the CH1 exon in the constant regions were known in the art, as evidenced by MacDonald. The skilled artisan would have a reasonable expectation of success of integrating the exogenous promoter driven VDJ variable domain at the IGHG1 locus downstream of the CH1 gene because 1) MacDonald teaches the region is amenable to homology directed repair, and 2) Voss and Hartweger teach that Cas9 can be engineered to cut any sequence of the IgH locus by virtue of programming the guide RNA sequence. The skilled artisan would have been motivated to integrate the PG9 VHL downstream of the CH1 exon in the IgHG1 locus to produce single chain antibody versions of broadly-neutralizing HIV-1 antibodies. Claim Rejections - 35 USC § 103 – Voss in view of MacDonald, Hartweger and Genbank Claims 8 and 11 are rejected under 35 U.S.C. 103 as being unpatentable over Voss (US 20230060376 A1, effectively filed as least as early as August 3, 2018), MacDonald (US 20110145937, published June 16, 2011) and Hartweger (Hartweger et al., Journal of Experimental Medicine (2019), 216: 1301-1310; cited in IDS filed 1/26/2024) as applied to claims 1-7, 12-14, 16-18 and 23-26 above, and further in view of Genbank (NC_000014.9, Homo sapiens chromosome 14, GRCh38.p12 Primary Assembly, version release March 26, 2018, https://www.ncbi.nlm.nih.gov/nuccore/NC_000014.9 [retrieved January 15, 2026], showing region of IGHG1 gene). The teachings of Voss, MacDonald and Hartweger are recited above and applied as for claims 1-7, 12-14, 16-18 and 23-26. Voss also teaches S. pyogenes Cas9 (SpCas9) was used create the double strand break in the IgH locus ([0030], [0127]). Voss teaches the PAM sequence for SpCas9 is “NGG” ([0080]-[0081]). Voss also teaches guide RNAs should be designed such that the targeting sequence is in proper orientation of the appropriate PAM sequence ([0082]), which for SpCas9 is 20 bases in the 5’ direction of the PAM sequence ([0081]). Voss teaches the guide RNAs used in the working examples were designed using a publicly available CRISPR design web server ([0127]). Hartweger also teaches the targeting sequence of the guide RNAs were designed using publicly available guide design tools (page 1307, ¶5). Voss, MacDonald and Hartweger do not teaches the guide RNAs of SEQ ID NOs 15-23, which are the targeting sequences of the recited guide RNAs in Table 2. Regarding claims 8 and 11, Genbank teaches the sequence of the IGHG1 locus (page 3). Genbank teaches the exon coordinates for the IGHG1 locus (page 3, “CDS join”). Genbank teaches the intron between the CH1 exon and the hinge exon is from coordinates 295-685. Genbank teaches there is an “AGG” (i.e., an SpCas9 PAM sequence) at positions 516-518 (page 3). Genbank teaches the 20 bases upstream of the AGG sequence is aagctaggtgcccctaaccc, which is 100% identical to the sequence of sg01 as defined in Table 2 of the specification (i.e., SEQ ID NO 15) (page 3, underlined). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically targeted SEQ ID NO 15 for integrating the PG9 VDJ sequence downstream of the CH1 exon in the method rendered obvious for claims 3-5 and 12 above. It would have amounted to designing SpCas9 guide RNA targeting sequences using known parameters by known means to yield predictable results. The skilled artisan would have been motivated to have chosen SEQ ID NO 15 to target for cleavage to facilitate donor DNA insertion since it has the known SpCas9 PAM sequence just 3’ of the last nucleotide, which Voss teaches is the required targeted sequence-PAM relationship for SpCas9. The skilled artisan would have predicted that a SpCas9 guide RNA with a targeting sequence of SEQ ID NO 15 could be produced and used to engineer the IGHG1 locus because Voss and Hartweger teach that SpCas9 can be used to target virtually any sequence for genome engineering as long as it has the appropriate 3’ PAM sequence. Claim Rejections - 35 USC § 103 – Hartweger in view of Scholz Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Hartweger (Hartweger et al., Journal of Experimental Medicine (2019), 216: 1301-1310; cited in IDS filed 1/26/2024) in view of Scholz (US 20130143267 A1, published June 6, 2013). The teachings of Hartweger are recite above in paragraphs 24-32 and incorporated here. Hartweger does not teach the promoter used to drive the antibody fragment expression is the EEK promoter. Scholz teaches transfecting B cells with a vector encoding the HIV-1 neutralizing antibody, b12 ([0126]). Scholz teaches the b12 antibody expression was under the control of the EEK promoter ([0126]). Scholz teaches the transduced B cells produced the b12 antibody ([0128]). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the IgHV1-69 promoter in Hartweger’s donor vector for the EEK promoter taught in Scholz. It would have merely amounted to a simple substitution of one known B-cell specific promoter for another to yield predictable results. Each of the IgHV1-69 and EEK promoters represent two functionally equivalent promoters recognized by the prior art to provide antibody expression in B cells. Accordingly, one of ordinary skill in the art could have made this substitution and it would have been entirely predictable that the EEK promoter would have been useful for regulating the expression of HIV-1 specific antibodies in the method of Hartweger. Because the prior art recognizes the equivalence of IgHV1-69 and EEK for the purpose of expressing antibody and antibody fragments in B cells, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. MPEP 2144.06.II. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jul 28, 2022
Application Filed
Feb 20, 2025
Response after Non-Final Action
Jan 15, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454686
In Vitro Cleavage of DNA Using Argonaute
2y 5m to grant Granted Oct 28, 2025
Patent 12448630
CRISPR-CAS SYSTEMS AND USES THEREOF
2y 5m to grant Granted Oct 21, 2025
Patent 12442052
ANALYSIS OF POLYNUCLEOTIDES
2y 5m to grant Granted Oct 14, 2025
Patent 12435321
CRISPR/CAS12J ENZYME AND SYSTEM
2y 5m to grant Granted Oct 07, 2025
Patent 12416011
BIOCONTAINMENT/BIOCONTROL SYSTEM AND METHODS
2y 5m to grant Granted Sep 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+62.6%)
3y 10m
Median Time to Grant
Low
PTA Risk
Based on 177 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month