DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Supplemental Correspondence to October 2, 2025 Interview Summary
As described in the interview summary mailed October 2, 2025, Applicant indicated that they would draft further amendments to the claims for Examiner’s consideration. Applicant provided the proposed amendments on November 4, 2025, a copy of which is included in Appendix I. Examiner indicated that Applicant’s proposed amendments would not place the claims in condition for allowance. No agreement was reached.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on November 14, 2025 has been entered.
Application Status
Applicant’s remarks and amendments to the claims filed November 14, 2025 are acknowledged. Claims 1, 4, 6-7, and 10-12 were amended, claims 8-9, 13, 16-17, and 19-25 were cancelled, and claims 26-36 were introduced. Claims 1-2, 4, 6-7, 10-12, and 26-36 are pending and under examination.
Priority
Applicant’s priority claims to provisional Application No. 63/226,210 are acknowledged. Claims 1-2, 4, 6-7, 10-12, and 26-36 find support therein, and the effective filing date of all claims under examination is July 28, 2021.
Withdrawn Rejections
Applicant’s amendments to the claims are sufficient to overcome the § 112(b) rejections and the § 112(a) Written Description rejections raised in the prior action. The aforementioned rejections are withdrawn, accordingly.
Applicant’s remarks and amendments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Claim Objections
Claim 33 is objected to because of the following informalities:
Claim 33 recites “the SEVs,” which should be amended to recite “the sEVs” so that the terminology is consistent throughout the claims.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 2, 4, 6-7, 10-12, 26-30, and 32-36 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
Claims 1 and 26 recite a “HER2-positive breast cell.” The specification states that ““HER2-positive” or “HER2+” refers to a breast cancer tumor or breast cancer cell that has higher than normal HER2 levels” (pg. 14, lines 18-19). The specification also describes means to characterize breast cancers as HER2-positive, e.g., on the basis of intensity and homogeneity of HER2 membrane staining in the tumor tissue (“a HER2-positive IHC score of 3+ is assigned when circumferential membrane staining is complete, intense, and present in >10% of tumor cells,” pg. 14, lines 19-30). The specification’s guidance relates to breast cancers, whereas the instant claim recites a “breast cell.” The specification does not appear to provide a metric to ascertain the meaning of “HER2-positive” or “HER2+” when a breast cell is non-cancerous, and therefore, it is not clear whether the phrase “HER2-positive breast cell” encompasses any breast cell which expresses HER2, any breast cell with a certain level of HER2 expression, or only breast cancer cells derived from HER2-positive tumors. Because the scope of “HER2-positive breast cell[s]” encompassed by the claim is unclear, the claim is indefinite.
Claims 2, 4, 6-7, 10-12, 26-30, and 32-36 are rejected for depending from claims 1 and 26 and failing to remedy the indefiniteness. Claim 31 is not included in this rejection because the claim is limited to a “HER2-positive breast cancer cell.” Based on the specification, the skilled artisan could reasonably ascertain the scope of breast cancer cells which would be considered “HER2-positive” (i.e., those which have higher than normal levels of HER2 expression based on the art, e.g., as determined by the metrics described on pg. 14, lines 18-31).
In the interest of compact prosecution, the claims will be interpreted as encompassing HER2-positive breast cancer cells as described above hereinafter, as this is believed to be Applicant’s preferred embodiment based on the specification.
Claim 36 recites “the CRISPR-Cas system,” but no such CRISPR-Cas system is previously recited in the claim, or in claim 26 from which it depends. Claim 26 recites a “gene editing agent targeting a nucleic acid encoding FIP200,” which encompasses a CRISPR-Cas system based on the specification (pg. 15, lines 17-20). However, this phrase does not require a CRISPR-Cas system because it also encompasses other gene editing agents, e.g., TALENs, ZFNs, recombinases, etc., and therefore, does not provide sufficient antecedent basis for the term “the CRISPR-Cas system” in claim 36.
The claim will be interpreted as depending from claim 29 hereinafter, which provides sufficient antecedent basis for the aforementioned limitation.
Claim Rejections - 35 USC § 102 – Guan
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 4, 7, 10, 26-27, 29, 31-33, and 36 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
Regarding claims 1, 26, and 31-32, Guan teaches administering an effective amount of an agent that inhibits a nucleic acid encoding FIP200 to a HER2-positive breast cancer cell, wherein the agent is an siRNA targeting a nucleic acid encoding FIP200 (“we examined several HER2+ breast cancer cell lines and found that depleting FIP200 by siRNA reduced HER2 levels in HCC202 cells (Figure S3H),” pg. 347, left col.; Fig. S3H).
Guan demonstrates that administering an agent that inhibits a nucleic acid encoding FIP200
stimulates the release of small extracellular vesicles comprising HER2 from HER2-positive breast cells (“Autophagy inhibition altered intracellular trafficking of HER2 to the ILVs and release through sEVs,” pg. 343; left col.; “We determined that blocking autophagy could lead to HER2 loss through exocytosis after FIP200 deletion… (Figures 4B and 4C)… HER2 was subsequently released from these cells in sEVs,” pg. 347-349; “We observed an increased amount of HER2 in sEV lysates from Fip200-/- tumor cells… (Figure 6C)… FIP200 and ATG13 KO also increased HER2 release from cells through sEVs… (Figure 6D),” pg. 349, left col.);
and reduces HER2 expression on the plasma membrane of HER2-positive breast cells (“Our studies demonstrate a mechanism of autophagy regulation mediated by sEVs, to reduce the plasma membrane expression of HER2,” pg. 343, left col.; “We then analyzed HER2 distribution in established mammary tumor cells and HeLa cells… both Fip200-/- tumor cells showed reduced HER2 on the cell surface… (Figure 3G)… HeLa cells with FIP200 or ATG13 KO showed reduced HER2 on the plasma membrane (Figures 3H and S3C),” pg. 347, left col.; Fig. 3G, 3H, S3C).
Accordingly, the aforementioned results recited in claims 1, 26, and 32 are interpreted as inherent, natural results of the administering step taught by Guan.
Regarding claims 4, 29, and 36, Guan teaches a CRISPR-Cas system which targets a nucleic acid encoding FIP200 (“CRISPR/Cas9-Mediated Knockout of FIP200… in HeLA and MCF-7 Cells…,” “sgFIP200,” pg. e4). Guan teaches that administering the CRISPR-Cas system to cells “block[s] autophagy and reduce[s] HER2 levels (pg. 345, right col.).
Regarding claim 7, Guan demonstrates that administering an agent that inhibits a nucleic acid encoding FIP200 inhibits FIP200-mediated autophagy (“We used genetic approaches to delete the essential autophagy gene Fip200,” pg. 343, left col.; “disruption of autophagy by CRISPR-Cas9-mediated knockout of FIP200 or another essential autophagy gene ATG13 also blocked autophagy and reduced HER2 levels in HeLa cells (Figures 2I and 2J)… “support that decreased HER2 levels upon FIP200 deletion was due to autophagy blockade,” pg. 345, right col.; Fig. 2I-J). The limitations of claim 7 are also interpreted as an inherent, natural result of the administering step taught by Guan.
Regarding claims 10 and 33, as stated above, Guan demonstrates that administering an agent that inhibits a nucleic acid encoding FIP200 stimulates release of small extracellular vesicles comprising HER2 from HER2-positive breast cells. HER2 is a membrane-localized protein based on Guan (“cell surface levels of receptor tyrosine kinases including HER2,”). Guan also teaches that HER2 co-localizes with transmembrane proteins of ILVs (i.e., CD63 and CD81) from which sEVs form (pg. 349, left col.). Thus, although Guan is silent as to whether a “vesicular membrane of the sEVs comprise HER2,” this is interpreted as an inherent, natural result of the administering step based on Guan’s teachings regarding the membrane localization of HER2. See MPEP 2112.02.
Regarding claim 27, Guan teaches isolating sEVs from HER2-positive breast cancer cells (“culture supernatants from… Fip200-/- tumor cells were subjected to serial differential ultra-centrifugation to collect sEVs,” pg. 349, left col.; “SEV Isolation and Characterization,” pg. e5).
Claim Rejections - 35 USC § 102 – Hao as evidenced by Guan
Claims 1, 4, 7, 10, 26, 29, 31-33, and 36 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hao (Hao and Guan, 2018, Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4386; of record) as evidenced by Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
Regarding claims 1, 26, and 31-32, Hao teaches administering an effective amount of an agent that inhibits a nucleic acid encoding FIP200 to a HER2-positive breast cancer cell, wherein the agent is gene editing agent targeting a nucleic acid encoding FIP200 (“To uncover the role of FIP200 and autophagy in Her2+ BCa, we studied Fip200 in MMTV-Neu mouse tumor cells that model Her2+ BCa. We found that inhibiting autophagy by deletion of Fip200 or Atg13 using Crispr-Cas9…”).
Hao is silent as to the results recited in the claims. However, Guan demonstrates that administering an agent that inhibits a nucleic acid encoding FIP200
stimulates the release of small extracellular vesicles (sEVs) comprising HER2 from HER2-positive breast cells (“Autophagy inhibition altered intracellular trafficking of HER2 to the ILVs and release through sEVs,” pg. 343; left col.; “We determined that blocking autophagy could lead to HER2 loss through exocytosis after FIP200 deletion… (Figures 4B and 4C)… HER2 was subsequently released from these cells in sEVs,” pg. 347-349; “We observed an increased amount of HER2 in sEV lysates from Fip200-/- tumor cells… (Figure 6C)… FIP200 and ATG13 KO also increased HER2 elase from cells through sEVs… (Figure 6D),” pg. 349, left col.);
and reduces HER2 expression on the plasma membrane of HER2-positive breast cells (“Our studies demonstrate a mechanism of autophagy regulation mediated by sEVs, to reduce the plasma membrane expression of HER2,” pg. 343, left col.; “We then analyzed HER2 distribution in established mammary tumor cells and HeLa cells… both Fip200-/- tumor cells showed reduced HER2 on the cell surface… (Figure 3G)… HeLa cells with FIP200 or ATG13 KO showed reduced HER2 on the plasma membrane (Figures 3H and S3C),” pg. 347, left col.; Fig. 3G, 3H, S3C).
Accordingly, the aforementioned results recited in claims 1, 26, and 32 are interpreted as inherent, natural results of the administering step taught by Hao.
Regarding claims 4, 29, and 36, Hao teaches the gene editing agent targeting a nucleic acid encoding FIP200 is a CRISPR-Cas system (“We found that inhibiting autophagy be deletion of Fip200 or Atg13 using Crispr-Cas9…”).
Regarding claim 7, Hao teaches that administering the agent inhibits FIP200-mediated autophagy (“We found that inhibiting autophagy by deletion of Fip200 or Atg13 using Crispr-Cas9…”).
Regarding claims 10 and 33, as stated above, Guan demonstrates that administering an agent that inhibits a nucleic acid encoding FIP200 stimulates release of small extracellular vesicles comprising HER2 from HER2-positive breast cells. HER2 is a membrane-localized protein based on Guan (“cell surface levels of receptor tyrosine kinases including HER2,”). Guan also teaches that HER2 co-localizes with transmembrane proteins of ILVs (i.e., CD63 and CD81) from which sEVs form (pg. 349, left col.). Thus, although Hao and Guan are silent as to whether a “vesicular membrane of the sEVs comprise HER2,” this is interpreted as an inherent, natural result of the administering step based on Guan’s teachings regarding the membrane localization of HER2. See MPEP 2112.02.
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections - 35 USC § 103 – Guan in view of Huynh
Claims 2 and 28 are rejected under 35 U.S.C. 103 as being unpatentable over Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information) as applied to claims 1, 4, 7, 10, 26-27, 29, 31-33, and 36, in further view of Huynh (Huynh et al., 2018, Oncomedicine, 2018;3L 74-81). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Guan are described in paragraphs 12-17 above and applied as to claims 1, 4, 7, 10, 26-27, 29, 31-33, and 36 therein. Guan suggests that their findings may have therapeutic relevance (pg. 343, left col.; Discussion, pg. 349-353). Guan also states that “[f]uture studies will be necessary to… guide potential therapy through autophagy modulation” given the limitations of their in vivo mouse model (“we cannot exclude the possibility that either autophagy blockade (i.e., by FIP200 cKO and cKI)… could compromise tumorigenesis in MMTV-Neu mice,” pg. 353, left col.). Guan teaches the in vivo mouse model of HER2-positive breast cancer, i.e., MMTV-Neu (“We used genetic approaches to delete the essential autophagy gene Fip200… in the MMTV-Neu mouse model to investigate autophagy in HER2-driven breast cancer,” pg. 343, left col.).
However, Guan does not describe administering the FIP200-targeting siRNA in paragraph 13 above to a subject, i.e., a mammal (specification, pg. 11, lines 30-31).
Huynh teaches that siRNAs can be delivered to cells in vivo (“Approaches to siRNA Delivery,” pg. 76-77). Huynh teaches that siRNAs are a “promising tool for application in breast cancer therapy” (pg. 74, right col.).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have administered the FIP200-targeting siRNA to the MMTV-Neu mouse model of Guan. It would have amounted to administering a known agent targeting FIP200 to a known mouse model of HER2-positive breast cancer, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success of administering the agent to the mouse model because Guan demonstrates that the siRNA is effective for reducing FIP200 expression, and means to deliver siRNAs to mice were known as evidenced by Huynh. The skilled artisan would have recognized that administering a FIP200-targeting siRNA to HER2-positive breast cancer cells in the MMTV-Neu mouse model would help resolve whether the results obtained from FIP200 knockout were due to “compromise[d] tumorigenesis,” or potentially therapeutic effects. The skilled artisan would have been motivated to further investigate this possibility because Guan specifically suggests that this line of investigation will “guide potential therapy through autophagy modulation.”
Claim Rejections - 35 USC § 103 – Guan in view of Huynh and GPP
Claims 6 and 30 are rejected under 35 U.S.C. 103 as being unpatentable over Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information) as applied to claims 1, 4, 7, 10, 26-27, 29, 31-33, and 36 in further view of Huynh (Huynh et al., 2018, Oncomedicine, 2018;3L 74-81) and GPP (GPP Web Portal, “LEGACY_shRNA_inventory_20110405_PUBLIC.txt.gz,” https://portals.broadinstitute.org/gpp/public/dir?dirpath=shrna_annot/legacy, available 13 December 2013). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Guan are described in paragraphs 12-17 above and applied as to claims 1, 4, 7, 10, 26-27, 29,31-33, and 36 therein. As stated therein, Guan’s agent is an siRNA targeting a nucleic acid encoding FIP200 (“we examined several HER2+ breast cancer cell lines and found that depleting FIP200 by siRNA reduced HER2 levels in HCC202 cells (Figure S3H),” pg. 347, left col.; Fig. S3H).
Guan does not teach administering an shRNA targeting a nucleic acid encoding FIP200, wherein the shRNA consists of the nucleotide sequence of SEQ ID NO: 15, or comprises the nucleotide sequence of SEQ ID NO: 16 or 17.
Huynh teaches that siRNAs may “result in… short-lived silencing of a gene,”” (pg. 75, right col.). Huynh teaches that shRNA can be used to introduce siRNA into cells, e.g., through the use of shRNA expression plasmids (pg. 75-77). GPP Web Portal (hereinafter, “GPP”) teaches expression plasmids (“pLKO.1”) encoding shRNAs targeting a nucleic acid encoding FIP200 (“RB1CC1”). GPP teaches shRNAs consisting of the nucleotide sequence of SEQ ID NO: 15 (“TRCN0000013525”), and comprising the nucleotide sequence of SEQ ID NO: 16 (“TRCN0000084986”) or 17 (“TRCN0000084987”). See Fig. A below.
FIGURE A
CCGGCCAAGGATTATTCGACCATTTCTCGAGAAATGGTCGAATAATCCTTGGTTTTT SEQ ID NO: 15
CCGGCCAAGGATTATTCGACCATTTCTCGAGAAATGGTCGAATAATCCTTGGTTTTT TRCN0000013525
GCTGAATTTCAGTGCTTAGAA SEQ ID NO: 16
CCGGGCTGAATTTCAGTGCTTAGAACTCGAGTTCTAAGCACTGAAATTCAGCTTTTTG TRCN0000084986
CCAACTTTAACACAGTCTTAA SEQ ID NO: 17
CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG TRCN0000084987
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the siRNA of Guan, for an expression plasmid encoding an shRNA taught by GPP. It would have amounted to substituting two known RNAi-based agents targeting a nucleic acid encoding FIP200, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success that the substitution could be made, because the agent of Guan and the agents of GPP are designed to target FIP200 with RNAi machinery, for the purposes of reducing FIP200 expression. The skilled artisan would have been motivated to substitute the RNAi-based agents because Huynh teaches that siRNAs may “result in… short-lived silencing of a gene,” and the skilled artisan would recognize that the expression plasmids of GPP may overcome this “short-lived silencing” and allow further investigation of the relationship between FIP200-mediated autophagy and HER2-positive breast cancer.
Claim Rejections - 35 USC § 103 – Guan and Huynh in further view of Garrett
Claims 11-12 and 34-35 are rejected under 35 U.S.C. 103 as being unpatentable over Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information) and Huynh (Huynh et al., 2018, Oncomedicine, 2018;3L 74-81) as applied to claims 1-2, 4, 7, 10, 26-29, 31-33, and 36 in further view of Garrett (Garrett and Arteaga, 2011, Cancer Biology & Therapy, 11:9, 793-800). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
Regarding claims 12 and 35, the term “therapeutic” is interpreted hereinafter as an intended use for the second agent which does not, by itself, further limit the structure of the second agent, because the structures of the second agents which are “therapeutic agents” are explicitly defined by the claims.
The teachings of Guan and Huynh are described in paragraphs 12-17 above, and 24-28 above and applied as to claims 1-2, 4, 7, 10, 26-29, 31-33, and 36 therein. Guan, citing Garrett and Arteaga (hereinafter, “Garrett”), also teaches that “resistance to [] targeted therapies in some patients… remain a significant challenge for effective treatment” (pg. 341, left col.). Guan states that “previous in vitro studies suggest that autophagy can facilitate the development of resistance to breast cancer cells to anti-HER2 antibody” (pg. 341, right col.). Guan also notes that sEVs, which Guan teaches are released following administration of the agent inhibiting FIP200, “have a widespread influence on… drug resistance” (pg. 343, left col.).
Guan does not teach administering an effective amount of a second agent to the subject, wherein the second agent is trastuzumab.
However, Garrett, referenced by Guan, teaches that a “large proportion of patients” with HER2-positive tumors are resistant to the anti-HER2 antibody, trastuzumab, (“The antibody trastuzumab… These anti-HER2 drugs are changing the natural history of HER2-overexpressing breast cancer. However, therapeutic resistance… typically occurs within months of starting therapy,” Abstract; “a large proportion of patients with HER2+ tumors either does not respond to trastuzumab or develops acquired tolerance to the antibody, suggesting both de novo and acquired mechanisms of drug resistance,” pg. 794, left col.). Garrett teaches that “HER2-overexpressing tumor cells that bypass trastuzumab action continue to depend on the HER2 oncogene” (pg. 794, left col.). Garrett teaches that “single-agent trastuzumab… [is] not adequate to inhibit the HER2 signaling network completely,” and suggests consideration of “combinations of HER2-targeted agents” in HER2-positive breast cancer.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have administered a second agent to the subject, wherein the second agent is trastuzumab. It would have amounted to administering a known agent relevant to HER2-positive breast cancer to a subject rendered obvious above, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in administering the second agent to the subject because as evidenced by Guan and Garrett, trastuzumab was a known agent relevant to both HER2-positive breast cancer and FIP200-mediated autophagy, which could be administered to cells in vivo. The skilled artisan would have recognized that the method of Guan, which modulates autophagy and promotes release of sEVs comprising HER2, was relevant to trastuzumab resistance based on the teachings described above. The skilled artisan would have been motivated to administer trastuzumab to the subject in an effort to investigate the relationship between anti-HER2 antibody therapy, and modulation of FIP200-mediated autophagy.
Claim Rejections - 35 USC § 103 – Hao in view of Swiatnicki
Claims 2, 11-12, 28, and 34-35 are rejected under 35 U.S.C. 103 as being unpatentable over Hao (Hao and Guan, 2018, Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4386; of record) as evidenced by Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information) as applied to claims 1, 4, 7, 10, 26, 29, 31-33, and 36, in further view of Swiatnicki (Swiatnicki and Andrecheck, 2019, Journal of Mammary Gland Biology and Neoplasia, (2019) 24:231-243). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Hao as evidenced by Guan are described in paragraphs 18-22 above and applied as to claims 1, 4, 7, 10, 26, 29, 31-33, and 36 therein.
Regarding claims 2 and 28, Hao does not describe that the HER2-positive breast cancer cell is in a subject, i.e., a mammal (specification, pg. 11, lines 30-31). However, Hao teaches that their “results raise[] the interesting possibility that Her2 may promote tumor development and/or progression at least in part by reducing FIP200 expression to inhibit autophagy, which might play a tumor suppressive role in Her2-driven BCa.” Hao teaches the HER2-positive breast cancer cells are derived from MMTV-Neu mice, and model HER2-positive breast cancer (“MMTV-Neu mouse tumor cells that model Her2+ BCa”).
Swiatnicki teaches that CRISPR-Cas systems have been used to investigate the role of a numerous genes in breast cancer (“Studies utilizing the power of TALEN and CRISPR systems have investigated numerous genes important to breast cancer, including BRCA1 and CDH1,” pg. 233, right col.). Swiatnicki teaches that CRISPR-Cas systems can be employed through “direct injection” into mice (“These systems can be employed through manipulation of mouse embryonic cells, or through direct injection of the system components into wildtype mice, and mice containing the cas9 protein under control of the cre-lox system,” pg. 233, right col.).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have administered the gene editing agent to a MMTV-Neu mouse model based on Hao. It would have amounted to administering a known gene editing agent targeting FIP200 to a known mouse model comprising the HER2-positive breast cancer cells taught by Hao, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success of administering the gene editing agent targeting FIP200 to the mouse model because using CRISPR-Cas systems to investigate the function of genes in breast cancer, and means to deliver CRISPR-Cas systems to mice, were known in the art as evidenced by Hao and Swiatnicki. In an effort to investigate the “interesting possibility” proposed by Hao that FIP200-mediated autophagy “might play a tumor suppressive role” in HER2-positive breast cancer, the skilled artisan would have been motivated to administer the gene editing agent to the MMTV-Neu mouse model of Hao which models HER2-positive breast cancer.
Regarding claims 11-12, and 34-35, Hao does not teach administering a second agent, wherein the second agent is one recited in claims 12 or 35. However, Hao does state that “Her2 knockdown or lapatinib treatment of MMTV-Neu cells increased Fip200 expression and autophagy.”
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have administered a second agent to the subject, wherein the second agent is lapatinib. It would have amounted to administering a known agent relevant to HER2-positive breast cancer to a subject rendered obvious above, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in administering the second agent to the subject because lapatinib was a known agent relevant to both HER2-positive breast cancer and FIP200-mediated autophagy, which could be administered to cells as evidenced by Hao. The skilled artisan would have been motivated to administer lapatinib to the subject in an effort to further investigate the relationship between FIP200-mediated autophagy and HER2, in HER2-positive breast cancer.
Claim Rejections - 35 USC § 103 – Hao in view of Guan
Claim 27 is rejected under 35 U.S.C. 103 as being unpatentable over Hao (Hao and Guan, 2018, Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4386; of record) as evidenced by Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information) as applied to claims 1, 4, 7, 10, 26, 29, 31-33, and 36, and in further view of Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Hao as evidenced by Guan are described in paragraphs 18-22 above and applied as to claims 1, 4, 7, 10, 26, 29, 31-33, and 36 therein. Hao teaches that their results “raise[] the interesting possibility that Her2 may promote tumor development and/or progression at least in part by reducing FIP200 expression to inhibit autophagy, which might play a tumor suppressive role in Her2-driven BCa.”
Hao does not teach a step of isolating one or more sEVs released from the HER2-positive breast cell.
As described in paragraphs 12-17 above, Guan teaches a substantially identical method to Hao, wherein administering an agent which inhibits a nucleic acid encoding FIP00 to a HER-positive breast cancer cell results in the release of sEVs comprising HER2, and a reduction in HER2 on the plasma membrane of the breast cancer cell. Guan also describes steps to isolate HER2-comprising sEVs (“SEV Isolation and Characterization,” pg. e5).
Importantly, in contrast to Hao, which teaches that FIP200-mediated autophagy may have a tumor suppressive role in HER2-positive breast cancer, Guan suggests that FIP200-mediated autophagy may have a tumor promoting role (“These results reveal a regulatory mechanism of autophagy in cancer cells by controlling HER2 directly, supporting autophagy inhibition as a distinct treatment strategy that may synergize with current anti-HER2 agents,” pg. 349, right col.; “Our results here demonstrate a tumor-promoting function for autophagy in HER2-positive breast cancer model,” pg. 351, right col.). Guan raises a number of future directions for their work, including, “determin[ing] whether the increased sEV secretion would have adverse pro-metastatic effects” (pg. 351, right col.).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have isolated sEVs from the HER2-positive breast cancer cells of Hao in view of Guan. It would have amounted to combining a step from a substantially identical method, with a known method, by known means to yield predictable results. Guan teaches that administering an agent which inhibits a nucleic acid encoding FIP00 promotes release of sEVs, and therefore, the skilled artisan would have had a reasonable expectation that sEVs could be isolated from the HER2-positive breast cancer cells of Hao, which are administered the agent in paragraph 19 above. The skilled artisan could have performed the additional step because Guan teaches means to isolate sEVs from HER2-positive breast cancer cells. The skilled artisan would have expected the combination to yield a functional method in which the step of Hao (i.e., administering the agent), and step of Guan (i.e., isolating the sEVs) would have performed their respective functions. The skilled artisan would have been motivated to isolate sEVs from the HER2-positive breast cancer cells of Hao in an effort to further investigate the relationship between FIP200-mediated autophagy and HER2-positive breast cancer, and specifically, to understand whether secretion of HER2-comprising sEVs has pro-metastatic effects as suggested by Guan.
Claim Rejections - 35 USC § 103 – Hao in view of Huynh and GPP
Claims 6 and 30 are rejected under 35 U.S.C. 103 as being unpatentable over Hao (Hao and Guan, 2018, Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4386; of record) as evidenced by Guan (Hao et al., 8 February 2021, Developmental Cell, 56, pg. 341-355, and Supplemental Information) as applied to claims 1, 4, 7, 10, 26, 29, 31-33, and 36, and in further view of (Huynh et al., 2018, Oncomedicine, 2018;3L 74-81) and GPP (GPP Web Portal, “LEGACY_shRNA_inventory_20110405_PUBLIC.txt.gz,” https://portals.broadinstitute.org/gpp/public/dir?dirpath=shrna_annot/legacy, available 13 December 2013). The rejections that follow are new and necessitated by Applicant’s amendments to the claims.
The teachings of Hao as evidenced by Guan are described in paragraphs 18-22 above and applied as to claims 1, 4, 7, 10, 26, 29, 31-33, and 36 therein. Hao teaches that their results “raise[] the interesting possibility that Her2 may promote tumor development and/or progression at least in part by reducing FIP200 expression to inhibit autophagy, which might play a tumor suppressive role in Her2-driven BCa.”
The agent used by Hao results in deletion of FIP200 (“deletion of FIP200… using Crispr-Cas9). Hao does not teach administering an shRNA targeting a nucleic acid encoding FIP200, wherein the shRNA consists of the nucleotide sequence of SEQ ID NO: 15, or comprises the nucleotide sequence of SEQ ID NO: 16 or 17. It is noted that FIP200 is also known as RB1CC1 in the art (“Fip200… also called RB1CC1,” specification, pg. 2, lines 21-22).
Huynh teaches that shRNA can be used to introduce siRNA into cells, e.g., through the use of shRNA expression plasmids (pg. 75-77). Huynh teaches that siRNAs are a “promising tool for application in breast cancer therapy” (pg. 74, right col.). GPP teaches expression plasmids (“pLKO.1”) encoding shRNAs targeting a nucleic acid encoding FIP200 (“RB1CC1”). GPP teaches shRNAs consisting of the nucleotide sequence of SEQ ID NO: 15 (“TRCN0000013525”), and comprising the nucleotide sequence of SEQ ID NO: 16 (“TRCN0000084986”) or 17 (“TRCN0000084987”). See Fig. A above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the agent of Hao, for an shRNA taught by GPP. It would have amounted to substituting two known agents targeting a nucleic acid encoding FIP200, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success that the substitution could be made because both the agent of Hao and the agents of GPP are designed to target FIP200 for the purposes of reducing FIP200 expression, and delivering shRNAs to cells was known as evidenced by Huynh. The skilled artisan would have been motivated to investigate the “interesting possibility that Her2 may promote tumor development and/or progression at least in part by reducing FIP200 expression” based on Hao, and would have recognized that the shRNAs of GPP, which would be predicted to reduce FIP200 expression, would be a complementary approach to Hao’s use of an agent which results in the deletion of FIP200.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600