Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of Application/Amendment/Claims
Applicant's response filed 11/19/2025 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 05/20/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
With entry of the amendment filed on 11/19/2025, claims 45-47, 49 and 51-55 are pending in the application.
New Claim Rejections – necessitated by claim amendments
Claim Objections
Claim 47 is objected to because of the following informalities: The claim is drawn to a third guide nucleic acid and has the limitation “wherein the guide nucleic acids comprises SEQ ID No. 13”. The claim would be clearer if rephrased to “wherein the guide nucleic acid comprises SEQ ID No. 13” wherein changing the word “acids” to its singular form would reflect the claim only reciting a single guide nucleic acid. Appropriate correction is required
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 49 and 51 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 49 recites comprising wherein the target nucleic sequences comprise nucleic acid sequences encoding C-C chemokine receptors, Activated leukocytes cell adhesion molecule (ALCAM/CD166), Junctional adhesion molecule A (F 11R/JAMA), ALCAMICD 166 receptors, FI 1R/JAMA receptors or combinations thereof, wherein the guide nucleic acids comprise SEQ ID NOs: 1-13. This limitation is indefinite because it is unclear what guide nucleic acids target which target nucleic sequence and because the specification, in Table 1, describes SEQ ID Nos. 1-7 as targeting ALCAM, SEQ ID Nos. 8/12 target JAMA and SEQ ID No. 13 targeted CCR2/5. The sequences are not described as targeted any C-C chemokine or ALCAM/CD166 receptors or different JAMA sequences.
Claim 51 is indefinite because the amended claim recites the guide nucleic acids comprise SEQ ID Nos. 1-13 however the claim does not recite which sequence targets which target gene. The claimed two or more target nucleic acids are recited in the alternative as i-iv and therefore it is not clear if alternative i is selected, which recites the ALCAM gene, what sequences of SEQ IDs 1-13 would the target guide nucleic acid sequences. As recited, each alternative can have any of SEQ ID Nos. 1-13.
Claim 52 depends from claim 51 and is also indefinite because it is unclear which SEQ ID Nos. correspond to which target nucleic acid sequence.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 52 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 52 fails to further limit claim 51 because it recites more target nucleic acid sequences than in claim 51 which broadens the claim. For example, claim 51 is dawn to CCR2 and CCR5 however claim 52 is drawn to encoding any C-C chemokine receptors. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 45-47, 49 and 51-55 is/are rejected under 35 U.S.C. 103 as being unpatentable over Minkenberg et al. ("CRISPR/Cas9-enabled multiplex genome editing and its application." Progress in molecular biology and translational science 149 (2017): 111-132 of record cited on 892 mailed 05/20/2025), Dabrowski et al. (CRISPR-Cas9 mediated disruption of ALCAM gene inhibits adhesion and trans-endothelial migration of myeloid cell J. Neurovirol. (2019) 25 (Suppl 1) of record cited on 892 mailed 05/20/2025), Kang, HyunJun, et al. "CCR5 disruption in induced pluripotent stem cells using CRISPR/Cas9 provides selective resistance of immune cells to CCR5-tropic HIV-1 virus." Molecular therapy Nucleic acids 4 (2015 of record cited on 892 mailed 05/20/2025), Park, Ryan J., et al. "A genome-wide CRISPR screen identifies a restricted set of HIV host dependency factors." Nature genetics 49.2 (2017): 193-203 of record cited on 892 mailed 05/20/2025), Covino et al. ("The CCL2/CCR2 axis in the pathogenesis of HIV-1 infection: a new cellular target for therapy?." Current drug targets 17.1 (2016): 76-110 of record cited on 892 mailed 05/20/2025), Cui et al. ("Review of CRISPR/Cas9 sgRNA design tools." Interdisciplinary Sciences: Computational Life Sciences 10.2 (2018): 455-465) and Maeder et al. (US 20170007679).
Regarding claim 45, Minkenberg et al. teach a CRISPR Cas9 system with multiple gRNAs targeted to different DNA sites and teach this is one of the CRISPR Cas9 systems best advantages and makes this the most efficient tool for multiplexing compared to other known genome editing systems (see pages 112-113). Minkenberg et al. teach diverse strategies for multiplex gRNA expression (see Fig. 1) and teach results of efficient expression of up to 5 different gRNAs using adenovirus vectors (see page 114 last para). Minkenberg et al. do not teach targeting an ALCAM gene or a CCR2 or CCR5 gene.
Regarding claims 45, 46, 49, 52-55, Dabrowski et al. teach CRISPR Cas9 mediated gene disruption of ALCAM/CD166 inhibits migration of HIV-1 infected monocytes and teach the gRNAs were designed to target exon 1 of the gene spanning the target codon and signal peptide region. Dabrowski et al. teach HIV-1 infected monocyte migration is responsible for a viral reservoir in the brain which leads to neuroinflammation, neuronal damage and central nervous system dysfunction (see abstract). With respect to claim 54, Dabrowski et al. teach delivery using a lentiviral vector that was capable of expression in the cell.
Regarding claims, 51, Kang et al. teach individuals lacking (the chemokine receptor 5) CCR5 are protected from HIV infection and demonstrated disruption of CCR5 using CRISPR Cas 9 system with a single or dual gRNAs (see introduction and page 2).
Park et al. identified a set of five host proteins that are essential for HIV entry and replication and found CCR5 and ALCAM being part of the five host proteins (see abstract). Park et al. suggest that while combination of antiretroviral therapy for HIV has saved lives, it has failed to prevent the emergence and spread of drug resistant strains and anti-HIV therapies that target host genes required by HIV offer new treatment methods (see page 201 second col).
Covina et al. teach modulation of CCL2/CCR2 expression in HIV effects viral replication (see page 80 col. 1) and suggest CCR2 as a promising novel approach to treatment of disease (see page 96 second par col. 1 and conclusion).
It would have therefore been obvious to use the multiplexing CRISPR Cas9 system taught by Minkenberg et al. to make a composition multiple gRNA targeted to ALCAM/CD166 gene and CCR5 which are identified as essential host proteins essential for HIV entry. It would have further been obvious to target CCR2 given it was emerging and a new target for treatment of HIV. One would have been capable of making such a multiplex system with the advantages of targeting different DNA as clearly taught by the prior art.
Regarding the limitations of SEQ ID Nos. 1-13, the specification, in Table 1, describes SEQ ID Nos. 1-7 as targeting ALCAM, SEQ ID Nos. 8-12 target JAMA and SEQ ID No. 13 targeted CCR2/5. The specification describes targeting exon 1 of the ALCAM gene (see Fig. 1, 2a-e and Fig, 8).
Cui et al. ("Review of CRISPR/Cas9 sgRNA design tools." Interdisciplinary Sciences: Computational Life Sciences 10.2 (2018): 455-465) teach gRNA design tools that efficiently design gRNA to a known target with high efficiency and specificity (see page 456 and Table 1). The gene ALCAM/CD166 is known as NC_000003.12. It would have been obvious for one of skill in the art to design the claimed sequences SEQ ID Nos. 1-7 targeted to the exon 1 region of ALCAM given the gene sequence was known, the exon region 1 was known and Dabrowski et al. teach CRISPR Cas9 mediated gene disruption of ALCAM/CD166 inhibits migration of HIV-1 infected monocytes using gRNAs were designed to target exon 1 of the gene spanning the target codon and signal peptide region. One of skill in the art would have been capable of using the claimed sequences in the multiplexing CRISPR Cas9 system targeted to ALCAM/CD166 gene.
Maeder et al. (US 20170007679) teach, in Table 2B, exemplary gRNA targeting domains for knocking out the CCR5 gene selected according to the second tier parameters. The targeting domains bind within the first 500 bp of the coding sequence (e.g., within 500 bp downstream from the start codon). Any of the targeting domains in the table can be used with a S. pyogenes Cas9 molecule that generates a double stranded break (Cas9 nuclease) or a single-stranded break (Cas9 nickase) and teach SEQ ID No. 4635 that is identical to claim 13 (see alignment below). It would have been obvious to use the known gRNA to target a CCR2/5 gene in designing a CRISPR system as above against HIV.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Publication No. US20170007679A1
GENERAL INFORMATION
APPLICANT MAEDER
SEQ ID NO 4635
LENGTH: 21
Query Match 100.0%; Score 21; Length 21;
Best Local Similarity 95.2%;
Matches 20; Conservative 1; Mismatches 0; Indels 0; Gaps 0;
SEQ 13 1 CAAAACCAAAGATGAACACCA 21
SEQ 4635 1 CAAAACCAAAGAUGAACACCA 21
Response to Applicant’s Argument
Applicant’s arguments are drawn to the previous 103 not teaching the specifically claimed SEQ ID Nos. The new 103 rejection, necessitated by claim amendments, make it obvious to use the now claimed SEQ ID Nos.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a).
706.07(a) Final Rejection, When Proper on Second Action [R-07.2015]
PNG
media_image1.png
18
19
media_image1.png
Greyscale
Second or any subsequent actions on the merits shall be final, except where the examiner introduces a new ground of rejection that is neither necessitated by applicant’s amendment of the claims, nor based on information submitted in an information disclosure statement filed during the period set forth in 37 CFR 1.97(c) with the fee set forth in 37 CFR 1.17(p). Where information is submitted in an information disclosure statement during the period set forth in 37 CFR 1.97(c) with a fee, the examiner may use the information submitted, e.g., a printed publication or evidence of public use, and make the next Office action final whether or not the claims have been amended, provided that no other new ground of rejection which was not necessitated by amendment to the claims is introduced by the examiner. See MPEP § 609.04(b).
Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KIMBERLY CHONG at 571-272-3111. The examiner can normally be reached Monday thru Friday 9-5 pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/Primary Examiner, Art Unit 1636