DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
The amended claims filed 12/17/2025 are acknowledged and entered.
Claims 1, 4, 8, 11, 14, 18, 21, 24, 28, 36, 37, 43 and 47 have been amended
Claims 1, 4, 8, 11, 14, 18, 21, 24, 28, 36, 37, 39, 40, 43, and 45-51 are pending and examined on their merits.
Response to Amendment
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office Action.
Objections
Specification - Withdrawn
The disclosure was objected to because of the following informalities:
a) Requirements for patent applications containing nucleotide and/or amino acid sequence disclosures. Applicant has provided the incorporation-by-reference of the material and the objection is withdrawn.
Claim Rejections - 35 USC § 112 - Withdrawn
1. The rejections for claims 22 and 47 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as ), second paragraph, as being indefinite is withdrawn in view of claim 22 being cancelled and claim 47 amendment.
2. The rejections for claims 43 and 45-49 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends is withdrawn in view of claim 43, 45-49 amendments.
Claim Rejections - 35 USC § 112(a) - Maintained
3. Claims 1, 8, 11, 14, 18, 21, 24, 28, 36, 37, 39, 40, 43, and 45-51 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus. See, e.g., Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010); University of California v. Eli Lilly & Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997) at 1406; Juno Therapeutics, Inc. v. Kite Pharma, Inc., 10 F.4th 1330, 1337, 2021 USPQ2d 893 (Fed. Cir. 2021) ("[T]he written description must lead a person of ordinary skill in the art to understand that the inventor possessed the entire scope of the claimed invention. Ariad, 598 F.3d at 1353–54 ('[T]he purpose of the written description requirement is to ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor's contribution to the field of art as described in the patent specification.' (internal quotation marks omitted).").
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014). The issue is whether the skilled artisan would understand inventor to have invented, and been in possession of, the invention as claimed.
The Federal Circuit has clarified the application of the written description requirement to inventions in the field of biotechnology. See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568,43 USPQ2d l398, 1406 (Fed. Cir. 1997). The Court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures. A definition by function does not suffice to define the genus because it is only an indication of what the genus does, rather than what it is. Further, the Court held that to adequately describe a claimed genus, an applicant must describe a representative number of species of the claimed genus, and that one of skill in the art should be able to “visualize or recognize the identity of the members of the genus.”
Claims 1, 8, 11, 14, 18, 21, 24, 28, 43, 45-49 are drawn to a composition comprising nucleic acid probes or primers for the detection of SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid, comprising SEQ ID NOs 1-13 or a nucleic acid sequence having at least 95% sequence identity to any of the SEQ ID NOs 1-13.
Claims 1, 8, 11, 14, 18, 21, 24, 28, 37, 43, 45-49 reads on a massive genus of compositions comprising sequences with no clear limits. The transitional term “comprising”, which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements, unrecited sequences or method steps. See, e.g., > Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004) (“like the term comprising,’ the terms containing’ and mixture’ are open-ended.”).< Invitrogen Corp. v. Biocrest Mfg., L.P., 327 F.3d 1364, 1368, 66 USPQ2d 1631, 1634 (Fed. Cir. 2003). MPEP 2111.02.
There is a lack of guidance/support in the claims and/or specification as to what features of the claimed composition must be present to detect SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid. The composition comprises SEQ ID NOs 1-13 range from 18 to 30 nucleotides or more in length and no clear limitations are provided for the length of the sequences or a range for sequence identity (95% to 100%). The specification has failed to sufficiently describe the structural features that must be retained by members of the claimed genus as to establish a structure-function relationship. That is, what changes can be made to the compositions comprising the claimed sequences and still have the intended function of detecting SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid..
However, while claims 1, 8, 11, 14, 18, 21, 24, 28, 37, 43, 45-49 are drawn to a genus that comprises innumerable sequences, the specification has only adequately described and successfully reduced to practice a handful of sequences (SEQ ID NOs 1-3, 5-7 and 9-11 as provided in Table 1); and as shown in exemplary assays discussed in the specification (page 22). This is not representative of the very large genus of sequences claimed, since there is a high degree of uncertainty as to whether the claimed genus can retain the functional properties of detecting SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid.
At best, the specification contemplates the use of BLAST to predict the probes to specifically amplify SARS-CoV-2 and had no homologies with human, other human- pathogenic coronaviruses or microbial genes on BLAST analysis that would potentially produce false-positive test results. However, this is not sufficient to describe members of the claimed genus because such methods access online databases that are continually being updated as sequencing technology improves. As a result, they are not a static source of information. Thus, one of skill in the art would readily appreciate that relying on a non-patent source that is continuously subject to change as a means to identify members of the claimed genus does not sufficiently meet the written description requirement.
In the absence of a representative number of examples, the specification must at least describe the structural features that are required for the claimed function, in this case detecting SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid. However, as discussed above, the specification fails to describe any substantive structural limitations as to establish a structure-function relationship with respect to SARS-CoV-2 detection.
Accordingly, claims 1, 8, 11, 14, 18, 21, 24, 28, 37, 43, 45-49 as currently written are not adequately described and one of skill in the art would readily appreciate that applicant was not in possession of the claimed genus at the time of filing.
Claim 37 is drawn to the method, wherein SARS-CoV-2 has a genome comprising the sequence according to GenBank accession no. MN975262, or a variant thereof comprising at least 95% sequence identity thereto. The transitional term “comprising”, which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements, unrecited sequences or method steps. See above.
Claims 37 reads on a massive genus of SARS-CoV-2 sequences with no clear limits. There is a lack of guidance/support in the claims and/or specification as to what features of the claimed genus sequences must be present for the genus to be identified as SARS-CoV-2 genome and no clear limitations are provided for the type of variants of MN975262, or the type or number of modifications or location of modifications in the sequence, or the length of the sequences for the large range of sequence identity (95% to 100%). All these factors may potentially end up identifying different species of Coronaviruses, even if those species are not currently known, and not just SARS-CoV-2. The specification has failed to sufficiently describe the structural features that must be retained by members of the claimed genus as to establish a structure-identity relationship, that is, what changes can be made and still be classified as SARS-CoV-2.
However, while claims 37 is drawn to a genus that comprises innumerable sequences, the specification has only adequately described a handful (6) of partial sequences, two of them are human SARS-CoV-2, two of them are human SARS-CoV-1 and two are Bat SARS-like coronaviruses (page 5; Brief Description of Drawings: Figures 1A-1D- partial alignments of the oligonucleotide regions of SARS- CoV-2 (2019-nCoV HKU-SZ-002a2020, GenBank accession no. MN938384; and 2019- nCoV HKU-SZ-005b2020, GenBank accession no. MN975262), human SARS-CoV (SARS-CoV HKU-39849, GenBank accession no. AY278491; and SARS-CoV GZ50, GenBank accession no. AY304495), and bat SARS-like coronaviruses (Bat-SL-CoVZC45, GenBank accession no. MG772933; and Bat-SL-CoVZXC21, GenBank accession no. MG772934) predicted to bind with the new (1A) Covid-19-RdRp/Hel, (1B) Covid-19-S, (1C) Covid-19-N, and the published (1D) RdRp-P2 real-time RT-PCR assays.) but has not defined what is the percentage of identity, or the nucleotide/structure differences between these genomes. This is not representative of the extremely large genus of sequences claimed, since there is a high degree of uncertainty as to whether the claimed genus can solely be identified as SARS-CoV-2 sequences.
In the absence of a representative number of examples, the specification must at least describe the structural features that are required for a genome to be classified as SARS-CoV-2. However, as discussed above, the specification fails to describe any substantive structural limitations as to establish a structure-identity relationship with respect to SARS-CoV-2 classification.
Accordingly, claim 37 as currently written is not adequately described and one of skill in the art would readily appreciate that applicant was not in possession of the claimed genus at the time of filing.
Claim Rejections - 35 USC § 103 - Maintained
Claims 1, 4, 11, 14, 21, and 24 are rejected under 35 U.S.C. 103 as being unpatentable over MN908947.1 (GenBank MN908947 Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome. VRL 12-Jan-2020 https://www.ncbi.nlm.nih.gov/nuccore/MN908947.1) in view of Ye (BMC Bioinformatics 2012, 13:134).
Claims 1, 11 and 21 are drawn to a composition comprising nucleic acid probes or primers for the detection of SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid, comprising SEQ ID NOs 1-3, 5-7 and 9-11 or a nucleic acid sequence having at least 95% sequence identity to any of the SEQ ID NOs 1-3, 5-7 and 9-11
Claims 4, 14 and 24 are drawn to a series of primers pairs (forward and reverse primers) consisting of SEQ ID NOs 1-3, 13 (claim 4) and 5-6 (claim 14) and comprising of SEQ ID NO: 7 (claim 14), 9-11 (claim 24).
Claim 37 is drawn to the method, wherein SARS-CoV-2 has a genome comprising the sequence according to GenBank accession no. MN975262, or a variant thereof comprising at least 95% sequence identity thereto.
GenBank: MN908947.1 accession number teaches the complete SARS-CoV-2 genomic nucleic acid sequence, which is 100% identical to GenBank accession no. MN975262 (claim 37). GenBank database also includes tools such as Run Blast (find regions of similarity between this sequence and other sequences using BLAST) and Pick Primers (design and test primers for this sequence using Primer-BLAST).
Examples of the claimed sequences found. These sequences correspond to the primer pairs listed in claims 1, 4, 11, 14, 21, and 24 (also listed in claims 8, 18 and 28) and therefore, these primers sequences are not novel.
CLAIMS 1, 4 AND 8 - PAIR SEQ ID NO 1 (FORWARD) AND SEQ ID NO 2 (REVERSE)
SEQ ID NO 1 CGCATACAGTCTTRCAGGCT
PNG
media_image1.png
151
910
media_image1.png
Greyscale
SEQ ID NO:2 GTGTGATGTTGAWATGACATGGTC
Reverse complementary: GACCATGTCATWTCAACATCACAC (= SEQ ID NO 4)
W = A or T (specification, page 12, line 11
If W = A GACCATGTCATATCAACATCACAC and last C deleted
PNG
media_image2.png
110
874
media_image2.png
Greyscale
CLAIMS 11, 14 AND 18 - PAIR SEQ ID NO 5 (FORWARD) AND SEQ ID NO 6 (REVERSE)
SEQ ID NO:5 CCTACTAAATTAAATGATCTCTGCTTTACT
PNG
media_image3.png
130
893
media_image3.png
Greyscale
SEQ ID NO 6 CAAGCTATAACGCAGCCTGTA
Reverse complementary: TACAGGCTGCGTTATAGCTTG (=SEQ ID NO 8)
PNG
media_image4.png
103
884
media_image4.png
Greyscale
CLAIMS 21, 24 AND 28 - PAIR SEQ ID NO 9 (FORWARD) AND SEQ ID NO 10 (REVERSE)
SEQ ID NO:9 GCGTTCTTCGGAATGTCG
PNG
media_image5.png
138
891
media_image5.png
Greyscale
SEQ ID NO:10 TTGGATCTTTGTCATCCAATTTG
Reverse and complementary CAAATTGGATGACAAAGATCCAA (=SEQ ID NO 12)
PNG
media_image6.png
133
876
media_image6.png
Greyscale
Additionally, the nucleic acid probes (SEQ ID NOs: 3, 7 and 11 of claims 4, 11 and 18, and 21 and 24) are also found in GenBank: MN908947.1 as shown below
SEQ ID NO: 3: TTAAGATGTG GTGCTTGCAT ACGTAGAC
PNG
media_image7.png
110
884
media_image7.png
Greyscale
SEQ ID NO: 7: CGCTCCAGGG CAAACTGGAA AG
PNG
media_image8.png
106
886
media_image8.png
Greyscale
SEQ ID NO: 11: AACGTGGTTG ACCTACACAGST
S= C or G, If C then
PNG
media_image9.png
111
890
media_image9.png
Greyscale
Ye teaches what Primer-BLAST is, its capabilities and how to use it: Primer blast is a tool to design target-specific primers for polymerase chain reaction (title). It is a software tool called to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers (entire article).
One of ordinary skill in the art would have been motivated to combine the teachings of GenBank: MN908947.1 with Ye to find nucleic acid probes or primers for the specific detection of SARS-CoV-2 RNA dependent RNA polymerase/Helicase; Spike and Nucleocapsid because tools like Run Blast, Pick Primers and Primer BLAST have been specifically developed for the purpose of primer optimization and are known to make the process of designing highly specific primers very simple and effective (claims 1,11 and 21) It would further be obvious to select primer pairs (forward and reverse primers) using these tools as claimed in claims 11, 14 and 18.
It would further be obvious with that primer or probe optimization in a composition is clearly a result effective parameter that a person of ordinary skill in the art would routinely optimize. Optimization of parameters is a routine practice that would be obvious for a person of ordinary skill in the art to employ. It would have been customary for an artisan of ordinary skill to determine the optimal amount of each ingredient needed to achieve the desired results. The principle of law states from MPEP 2144.05: "The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages." (Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382); Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 2.
From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. PCR technology and designing PCR primers has been successfully utilized in the labs all over the world since the 1990s and currently there are many tools to facilitate the development of many types of PCR tests. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary.
Claims 1, 8, 11, 18, 21 and 28 are rejected under 35 U.S.C. 103 as being unpatentable over MN908947.1 (GenBank MN908947 Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome. VRL 12-Jan-2020 https://www.ncbi.nlm.nih.gov/nuccore/MN908947.1) in view of Ye (BMC Bioinformatics 2012, 13:134) and VanGuilder (BioTechniques 44:619-626 (25th Anniversary Issue, April 2008).
Claims 1, 11 and 21 have been discussed above
Claims 8, 18 and 28 are drawn to the probes further comprising one or more fluorescent reporters, one or more quenchers, or a combination thereof, optionally, wherein the one or more fluorescent reporters is a 5' fluorescent reporter and the one or more quenchers is a 3' quencher.
GenBank: MN908947.1 teachings and examples have been discussed above.
Ye teachings have been discussed above.
GenBank: MN908947.1 and Ye do not teach the use of fluorescent reporter or quenchers added to the probes.
VanGuilder teaches the current state of qPCR for gene expression analysis and how the method has reached a mature stage of development and implementation, specifically, the different fluorescent reporter technologies of real-time qPCR (abstract, entire article). Real-time PCR is carried out in a thermocycler that permits measurement of a fluorescent detector molecule, which decreases post-processing steps and minimizes experimental error (page 621, second paragraph). Sequence-specific TaqMan probes are labeled with both a fluorescent reporter (5’ end) and a quencher (3’ end), which are maintained in close proximity until hybridization to the target occurs (page 621 third paragraph) (claims 8, 18 and 28).
One of ordinary skill in the art would have been motivated to combine the teachings of GenBank: MN908947.1 and Ye to identify suitable highly specific nucleic acid probes or primers for the detection of SARS-CoV-2 with VanGuilder and incorporate fluorescent reporter technology to those nucleic acid probes/primers because fluorescent probes and quenchers allows for rapid and easy confirmation of results in a large number of samples.
From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary.
Claims 36, 37, 39-40, 43 and 45-51, are rejected under 35 U.S.C. 103 as being unpatentable over MN908947.1 in view of Ye and Corman (Euro Surveill. 2020;25(3): pages 1-8. published on Jan 23, 2020).
GenBank: MN908947.1 teachings and examples have been discussed above.
Ye teachings have been discussed above.
GenBank: MN908947.1 and Ye do not teach either the origin of the sample or the specifics of the detection method.
Corman teaches the detection of SARS-CoV-2 by real time RT-PCR (entire article) as claimed in claims 39-40 and 43. Clinical samples were obtained for assay evaluation. Biological samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium. Faecal samples were also analyzed. (page 2, Methods: Clinical samples and coronavirus cell culture supernatants for initial assay evaluation section) (claims 36, 46 and 47). Corman uses a variety of biological samples but was not able to obtained viral isolates or patient specimens. Design and validation were nevertheless enabled by the close genetic relatedness to the 2003 SARS-CoV, and aided by the use of synthetic nucleic acid technology (page 2, second paragraph) and was able to design specific probes to detect only SARS-CoV-2 RNA and not SARS-CoV RNA (page 4, 3 paragraph). Corman tested samples containing a broad range of respiratory agents reflecting the general spectrum of virus concentrations encountered in diagnostic laboratories (table 2). In total, this testing yielded no false positive outcomes (page 4, Exclusivity of 2019 novel coronavirus based on clinical samples pre-tested positive for other respiratory viruses section) (claim 50). The RNA was extracted from these clinical samples (page 2, Methods: RNA extraction section) (claim 36) and analyzed using one step real-time RT PCR (page 2, Methods: Real-time reverse-transcription PCR section) as claimed in claims 39 and 40. The primers and probes used are shown in table 1 (page 2) (claim 43) and the relative positions of several amplicon targets are shown in figure 1 (page 3) (claim 45). Cross-reactivity with other corona viruses was analyzed too (page 6, first column second paragraph). Cell culture supernatants containing all endemic human coronaviruses (HCoV)229E, NL63, OC43 and HKU1 as well as MERS-CoV were tested in duplicate in all three assays (Table 2) None of the tested viruses or virus preparations showed reactivity with any assay (page 6, second column, first paragraph).
One of ordinary skill in the art would have been motivated to combine the teachings of GenBank: MN908947.1 and Ye to identify suitable highly specific nucleic acid probes or primers for the detection of SARS-CoV-2 with Corman because the workflow taught by Corman describes how to design and validate detection assays such as real time RT PCR. It would have been obvious for one of ordinary skill in the art to use a thoroughly validated (with the use of 2003 SARS-CoV, and synthetic nucleic acid technology) and highly specific assay to test samples from a patient suspected of being infected with SARS-CoV-2 (claims 49 and 51) with a reasonable expectation of success.
From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary.
Double Patenting - Maintained
The rejections for claims 4, 8, 11, 14, 18, 21, 24, 28, 36-37, 39-40, 43, 45-51 on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4-5, 8-9, 13-14, 18 and 22-27 of application 17/545,818 (copending application) is maintained.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Applicant has requested that this provisional double patenting rejection to be held in abeyance until the claims are otherwise allowable.
Relevant arguments that apply to new claims
Applicant’s arguments are as follow:
- (a) Rejection under 35 USC § 112(a). Applicant argues that the amendments to the claims satisfy the written description requirement because claims 1, 11, and 21 require that the nucleic acid sequences of the primer pairs and corresponding probes share at least 95% sequence identity with the recited sequences. A 95% sequence identity corresponds to about one nucleotide difference within the RdRp/Helicase primer or probe sequences of SEQ ID NOs:1-3, and about one to two nucleotide differences (~1.5 bases) within the N gene primer or probe sequences of SEQ ID NOs:9-11. At least 95% sequence identity ensures that the primers and probes maintain the nucleotide positions essential for the selective recognition of SARS-CoV-2, while allowing limited variation that does not introduce cross-reactivity with SARS-CoV-1, and related coronaviruses.
- (b) Rejection of claims 1, 4, 11, 14, 21, 24 and 37 under 35 USC § 103. The claimed compositions and methods are based on Applicant's development of assays containing primers and probes that include specific nucleotide differences within the RdRp/Helicase, Spike, and Nucleocapsid gene regions of SARS-CoV-2, which facilitate highly specific and sensitive detection of the SARs-CoV-2 virus. Applicant selected primer and probe sequences having specific nucleotide variations, particularly at positions distinguishing SARS-CoV-2 from SARS-CoV-1 (the closest related coronavirus genome). Cross-reactivity between SARS-CoV-2 and SARS-CoV-1, as well as other coronaviruses (such as MERS-CoV) or other respiratory viruses was effectively eliminated and solved the problem of detection assays producing false positives or failing to distinguish SARS-CoV-2 from related coronaviruses, thereby, providing a solution that is highly specific and sensitive for detecting SARS-CoV-2. The claims as amended are not obvious over GenBank Accession No. MN908947.1 and Ye, because the Examiner's reasoning relies on impermissible hindsight reconstruction of Applicants' findings. Neither reference provides any teaching or guidance for selecting primers or probes containing nucleotide differences sufficient to distinguish SARS-CoV-2 from SARS-CoV-1 or to eliminate cross-reactivity with related coronavirus. Thus, the claimed sequences could not have been obtained through routine application of known techniques. Ye does not disclose any actual primer or probe sequences, nor does it provide any instruction, parameters, or criteria relevant to designing diagnostic primers for a newly emerging pathogen such as SARS-CoV-2. The publication is limited to describing the functionality of the software and does not demonstrate or suggest the identification of primers having the specificity and sensitivity of the claimed invention.
When the first genomic sequence of the Wuhan-Hu-1 isolate (GenBank Accession No. MN908947.1) was released, little was known about the virus's biology, mutation patterns, or genomic diversity across early isolates. In this context, there was no clear guidance or consensus regarding which genomic regions could reliably distinguish SARS-CoV-2 from other coronaviruses, particularly SARS- CoV-1, the most closely related known species. The earliest diagnostic efforts relied on in silico analysis of the newly released genome and borrowed heavily from prior SARS-CoV assays. As subsequently reported e.g., by Corman (also cited by the Examiner), these early assays frequently produced false positives or non-specific amplification, underscoring that the process of identifying SARS-CoV-2-specific primer and probe sets was far from routine. In reality, the art at the time was highly unpredictable: sequence differences at the highlighted positions between SARS-CoV-1 and SARS-CoV-2 in were not known, and their impact on hybridization, amplification efficiency, and diagnostic specificity were unknown.
- (c) The primer and probe sequences required by the claims as amended have superior and unexpected properties that could not have been predicted from the cited art. Applicant's specific primer and probe sequences achieved unexpected specificity (~100%) while maintaining high detection sensitivity, results that could not have been predicted from the prior art. Specifically, Applicant's data demonstrate unexpected specificity compared to existing SARS-CoV-derived assays. The assays developed by Applicants did not cross-react with SARS-CoV-1 or any other related coronaviruses (Application as filed, Table 4, cols. 2-3). This outcome was unexpected because, at the time the Application was filed, the high genomic similarity between SARS-CoV-1 and SARS-CoV-2, exceeding 80% across key conserved regions, made it unpredictable that any primer and probe set could fully eliminate cross-reactivity. Early diagnostic efforts, e.g., the existing RdRp SARS assay, failed for precisely this reason: absence of the nucleotide differences in the primer and probe sequences caused false-positive amplification or reduced assay specificity. Applicant's selection of primer and probe sequences having specific nucleotide differences simultaneously improved specificity while preserving sensitivity of the claimed primers and probes for detection of SARS-CoV-2, represents a non-obvious and superior advance over the prior art.
- (d) Rejection of claims 1, 8, 11, 18, 21, and 28 under 35 USC § 103. VanGuilder does not cure the deficiencies of MN908947.1 and Ye, as described above.
- (e) Rejection of claims 36-38, 40, 43, and 41-51 under 35 USC § 103. Corman does not cure the deficiencies of MN908947.1 and Ye, as described above. Corman merely discloses a general RT- PCR method using SARS-CoV-2 primers that were shown to cross-react with SARS-CoV-1 (see Application as filed, Table 3), and therefore provides no teaching or suggestion of Applicant's specific primer and probe sets or the improved performance achieved by the claimed detection methods.
Applicant’s arguments have been considered but are not persuasive. In response to Applicant’s arguments:
Specific and sensitive detection of SARS-CoV-2 with the instant primers is not surprising since, as Applicant notes, they sit in regions with differences from other viruses and PCR based methods are quite sensitive owed to amplification. Thus, these features are predictable and not surprising. Furthermore, specific detection is not required by the claims and so Applicant’s arguments are not commensurate in scope with the claims. The same argument is made for lack of cross-reactivity. Primers based on sequences that differ from other viruses would tend to lack cross-reactivity.
With respect to Applicant’s results, any claim that fails to limit the primers to only those made and tested by Applicant are commensurate in scope with any argument of unexpected results. However, not all claims are drawn only to primers made and tested and so this argument is not persuasive for this reason also.
It is standard practice in this art to make specific primers. The fact that Applicant did it is therefore not surprising and certainly not a new concept to diagnostics. Since all primers are identifiable from the published sequence discussed, those of the instant claims would clearly be arrived at with no more than routine experimentation.
If Applicant meant to make a long-felt need argument with their “solving problem” comments, they did not make a persuasive one as they identified clearly the pandemic was not long before the filing of instant claims and so the need could not have been long-felt.
Specific teaching or suggestion are not the only rationales for obviousness. Furthermore, such teaching or suggestion need not be expressed in a reference. There is no requirement that an “express, written motivation to combine must appear in prior art references before a finding of obviousness.” See Ruiz v. A.B. Chance Co., 357 F.3d 1270, 1276, 69 USPQ2d 1686, 1690 (Fed. Cir. 2004).
It is not surprising either than a SARS-CoV-1 assay is not specific for SARS-CoV-2. Thus, no surprising results have been shown.
- Regarding item (a), claims 1, 11 and 21 are drawn to a composition comprising: a nucleic acid primer pair comprising a SEQ ID NO: X. The claim language clearly utilizes the term “comprising of” for the sequences of the nucleic acid primer pairs. The transitional term “comprising”, which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or sequences, or method steps. See, e.g., > Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004) (“like the term comprising,’ the terms containing’ and mixture’ are open-ended.”).< Invitrogen Corp. v. Biocrest Mfg., L.P., 327 F.3d 1364, 1368, 66 USPQ2d 1631, 1634 (Fed. Cir. 2003). MPEP 2111.02. In other words, the sequences can be longer than the listed SEQ ID NOs. Therefore, there is no such requirement in the claims that would limit any open ended sequences (as per the use of the term comprising) that would include a SEQ ID NO listed in the claims to have only one or two nucleotide differences at 95% identity in the total sequence. Accordingly, "at least 95%" sequence identity of an open ended sequence does not ensure that the primers and probes, as claimed in the instant application, maintain the nucleotide positions essential for the selective recognition of SARS-CoV-2, while allowing limited variation that does not introduce cross-reactivity with SARS-CoV-1, and related coronaviruses, or even does not ensure specific binding to the target.
Variance residing in the claim does not restrict the scope sufficiently to what Applicant made and tested. Rather it allows more than this in scope. Finding non-modifiable positions in a sequence is an enablement argument but this rejection is based on description and the two are severable. The claims are drawn to more than the sequences of any and all figures and so Applicant’s arguments are not commensurate in scope with the claims.
Consequently, the rejection under 35 USC § 112(a) is maintained, see above.
- Regarding item (b), Applicant arguments that the prior art references would not have been sufficient to accomplish the goal of specificity and the elimination of crossreactivity to related viruses to just detect the SARS- Cov-2 virus are not found persuasive.
In response to Appellants’ argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). As discussed below, there is ample motivation to combine the references independent of the inherent feature.
GenBank Accession No. MN908947.1 discloses the complete nucleotide sequence of the Wuhan-Hu-1 isolate of SARS-CoV-2 and it is the starting point for any primer design, but it is the combination of GenBank Accession No. MN908947.1 and Ye that the artisan would use to identify these primers in SARS-CoV-2, in addition to further optimization of the sequences found in order to meet the desire outcome. The claimed PCR primers are 100% identical to the SARS-CoV-2 sequence as taught by GenBank Accession No. MN908947.1. Ye teaches Primer blast is a tool to design target-specific primers for polymerase chain reaction (title). It is a software tool called to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers (in the instant application there are not even mismatches with the SARS-CoV-2 sequence). Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Additional programs are Run Blast and Pick Primers. In addition, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Moreover, PCR technology has been around since 1990s and since then, different variations of the technology have been developed and its use has been expanded outside the field of diagnostics, including areas like identifying genetic diseases (even caused by single mutations), paternity cases, and criminal forensics because of its exquisite detection sensitivity, which is exactly the purpose of PCR technology. Nowadays, PCR is hardly considered a breakthrough technology (see VanGuilder teachings discussed above and the teachings of the entire article). As a reminder, the instant claims comprises several SEQ ID NOs and there is no warranty that the comprised open-ended sequences will retain the same specificity and crossreactivity results as sequences consisting of the SEQ ID NOs, which are the ones tested (see item (a) above). Applicant's unsubstantiated opinion that the art at the time of the pandemic was highly unpredictable is contradictory to the art's teachings and so not persuasive. The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997). The fact that any invention was developed during a health or other type of crisis, such a pandemic caused by an emerging pathogen, is not relevant to the patentability analysis of any invention. Related viruses such as SARS-CoV or MERS-CoV were already known and sequenced. SARS-CoV-2 was sequenced too and the detailed specific biology of SARS-CoV-2 is not needed to develop a PCR assay as demonstrated by Corman.
Corman’s teachings are discussed in length above but basically discloses the detection of SARS-CoV-2 by real time RT-PCR (and not in silico analysis). Corman was able to design specific probes to detect only SARS-CoV-2 RNA and not SARS-CoV RNA. Corman tested samples containing a broad range of respiratory agents reflecting the general spectrum of virus concentrations encountered in diagnostic laboratories (table 2). In total, this testing yielded no false positive outcomes. In addition, Figure 2 depicts Partial alignments of oligonucleotide binding regions, SARS-related coronaviruses (n = 9) showing that these types of partial alignments were known in the art and thus it would be obvious for an artisan to compare the sequences of related viruses.
Applicant has not sufficiently described why there is no prima facie case for obviousness. See discussion above for more details regarding the teachings of, GenBank Accession No. MN908947.1, Ye and Corman relevant to the rejection under 35 U.S.C. 103 and the motivation to combine these references.
- Regarding item (c), Applicant's arguments that the data demonstrate unexpected specificity compared to existing SARS-CoV-derived assays because the claimed assays did not cross-react with SARS-CoV-1 or any other related coronaviruses is in direct contradiction with the teachings of Corman (assay yielded no false positive outcomes, specific probes to detect only SARS-CoV-2 RNA and not SARS-CoV RNA, or a broad range of respiratory agents), regardless of the % of homology of key conserved regions between viruses. Applicant also discloses in the specification that Corman’s RdRp assays had been implemented in >30 laboratories in Europe (page 3, line 20-21), therefore it was a successful assay. Evidence of unexpected properties may be in the form of a direct or indirect comparison of the claimed invention with the closest prior art which is commensurate in scope with the claims. See In re Boesch, 617 F.2d 272, 205 USPQ 215 (CCPA 1980) and MPEP § 716.02(d) - § 716.02(e). An affidavit or declaration under 37 CFR 1.132 must compare the claimed subject matter with the closest prior art to be effective to rebut a prima facie case of obviousness. In re Merchant, 575 F.2d 865, 868, 197 USPQ 785, 787 (CCPA 1978) (emphasis in original). Where the comparison is not identical with the reference disclosure, deviations therefrom should be explained, In re Finley, 174 F.2d 130, 81 USPQ 383 (CCPA 1949), and if not explained should be noted and evaluated, and if significant, explanation should be required. In re Armstrong, 280 F.2d 132, 126 USPQ 281 (CCPA 1960) (deviations from example were inconsequential). See also MPEP 716.02e. Furthermore, a showing of unexpected results (better sensitivity must be based on evidence, not argument or speculation. In re Mayne, 104 F.3d 1339, 1343-44, 41 USPQ2d 1451, 1455-56 (Fed. Cir. 1997) (conclusory statements that claimed compound possesses unusually low immune response or unexpected biological activity that is unsupported by comparative data held insufficient to overcome prima facie case of obviousness). MPEP § 2145. A greater than expected result is an evidentiary factor pertinent to the legal conclusion of obviousness ... of the claims at issue.” In re Corkill, 711 F.2d 1496, 226 USPQ 1005 (Fed. Cir. 1985). MPEP 716.02 (a). The evidence relied * > upon < should establish “that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance.” Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992). MPEP 716.02 (b). Applicant must further show that the results were greater than those which would have been expected from the prior art to an unobvious extent, and that the results are of a significant, practical advantage. Ex parte The NutraSweet Co., 19 USPQ2d 1586 (Bd. Pat. App. & Inter. 1991). MPEP 716.02 (b). Applicant has failed to provide evidence of unexpected results when prior art assays have also shown specificity, no false positive data, and no cross-reaction with related viruses and have been successfully implemented in multiple countries. An improvement to prior art assays is merely the "predictable use of prior art elements," and therefore the improved assay is obvious.
- Regarding item (d), Applicant's arguments regarding the deficiencies of MN908947.1 and Ye have not been found persuasive as discussed above. In addition, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
- Regarding item (e), Applicant's arguments regarding the deficiencies of MN908947.1 and Ye have not been found persuasive as discussed above. In addition, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Table 3 in the specification shows the limits of detection of Covid-19 real-time RT-PCR assays with in vitro RNA transcripts for SARS-CoV-2 and it is unclear how the table relates to Corman’s data. Corman’s teachings have been discussed in detail above and in rejection under 35 U.S.C. 103.
Applicant argues as set forth above. Thus, for all the reasons set forth above and the reasons of record, the rejection is maintained.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to IMMA BARRERA whose telephone number is (571) 272-0674. The examiner can normally be reached Monday - Friday 9 to 5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, Applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached on (571) 270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/IMMA BARRERA/
Examiner, Art Unit 1671
/Michael Allen/Supervisory Patent Examiner, Art Unit 1671