Prosecution Insights
Last updated: April 19, 2026
Application No. 17/821,831

RESISTANCE GENE TO RHIZOMANIA

Non-Final OA §101§102§112
Filed
Aug 24, 2022
Examiner
RADOSAVLJEVIC, ALEKSANDAR
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Kws Saat SE & Co. Kgaa
OA Round
1 (Non-Final)
82%
Grant Probability
Favorable
1-2
OA Rounds
2y 11m
To Grant
89%
With Interview

Examiner Intelligence

Grants 82% — above average
82%
Career Allow Rate
87 granted / 106 resolved
+22.1% vs TC avg
Moderate +7% lift
Without
With
+7.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
25 currently pending
Career history
131
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
20.6%
-19.4% vs TC avg
§102
15.3%
-24.7% vs TC avg
§112
42.4%
+2.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 106 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group II in the reply filed on 23 June 2025 is acknowledged. Claims 16-17 and 22 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Newly added claims 25-27 read on the elected invention of Group II. Claims 16-27 are pending. Claims 16-17 and 22 are withdrawn. Claims 18-21 and 23-27 are examined herein. Claim Interpretation For the purpose of examination, the term “endogenous” is interpreted to encompass any non-transgenic genomic component, for example natively occurring genes and loci or those introduced through introgression, based on the context of the specification. Applicant’s specification discloses that BNYVV resistant Beta vulgaris plants comprising the claimed nucleotides and polypeptides were discovered in a population of sugar beets wherein said resistance was conferred by a gene or genome segment introgressed from Beta vulgaris subsp. maritima (which is known in the art as a wild relative of cultivated Beta vulgaris plants) (instant specification, page 28, Example 1, first paragraph). For the purpose of examination, “mutation” is interpreted to mean any difference in any nucleotide or amino acid residue relative to the susceptible allele sequences (i.e. instant SEQ ID NO: 1 or 2), including those that result from natural processes. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 18, 20, 23, and 25-27 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature without significantly more. The claims are broadly drawn to a beet necrotic yellow vein virus (BNYVV) resistant plant of the genus Beta comprising an endogenous nucleic acid molecule having a nucleic acid selected from, among others, a sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2, in which at least one amino acid residue substitution is present as a result of one or more mutations in the nucleic acid sequence (claim 18); wherein the one or more mutations is heterozygous or homozygous (claim 20); a population of plants comprising a plant of claim 18 (claim 23); the plant of claim 18 wherein the polypeptide further comprises an amino acid residue at position 566 that differs from arginine, a residue at position 731 that differs from glutamine, and/or a residue that differs at position 831 that differs from proline, all relative to SEQ ID NO: 2 (claim 25); the plant of claim 18 wherein the polypeptide comprises at least one of five amino residue substitutions relative to SEQ ID NO: 2 (K307Q, Q437R, R556H, Q731K, and/or P831S; claim 26); and the plant of claim 18 wherein the nucleic acid sequence comprises at least one of five nucleotide substitutions (A919C, A1310G, G1697A, C2191A, and/or C2491T; claim 27). Thus, the claimed genus of plants encompasses any BNYVV resistant plant of the genus Beta, including Beta vulgaris subsp. maritima, which comprises the nucleic acids and mutations described above. Beta vulgaris subsp. maritima, also known as sea beet, is a naturally occurring wild plant (see Panella et al, 2007, Euphytica 154: 383-400; page 384, first paragraph under “Introduction”; see Pavli et al, 2010, Field Crops Research 122: 165-172; page 169, column two, first paragraph under “Trends and future prospects”) Applicant discloses the discovery of a population of sugar beet plants comprising an introgression from Beta vulgaris subsp. maritima, wherein the introgression comprises a gene or genome segment that imparts resistance to rhizomania (instant specification, Example 1, page 28, first paragraph). Applicant further discloses that the resistance gene is an NBS-LRR gene comprising the sequence of instant SEQ ID NO: 3 (resistant genotype; SEQ ID NO: 3 encodes the polypeptide of SEQ ID NO: 4; instant specification, Example 1, page 28-29, bridging paragraph; Figure 1 and Description of Figures). Applicant further discloses the presence of five diagnostic amino acid substitutions and their corresponding nucleotide substitutions in the resistant genotype as recited by instant claims 25-27 (i.e. SEQ ID NO: 3 relative to SEQ ID NO: 1, the susceptible genotype; SEQ ID NO: 4 relative to SEQ ID NO: 2, the amino acid encoded by SEQ ID NO: 1; ; instant specification, Example 1, page 29, second paragraph). Therefore, because the source of introgressed SEQ ID NO: 3 was Beta vulgaris subsp. maritima, Applicant has indirectly disclosed the existence of a Beta vulgaris subsp. maritima plant (which is a naturally occurring wild plant species), that comprises a rhizomania resistance conferring nucleic acid which comprises the claimed polynucleotide substitutions (i.e. SEQ ID NO: 3) and encodes a polypeptide comprising the claimed amino acid substitutions (i.e. SEQ ID NO: 4). Regarding the limitations of claim 20, all alleles are inherently either heterozygous or homozygous in a genome. Regarding the limitations of claim 23, wild plants inherently exist as populations. Thus, the plants and populations of instant claims 18, 20, 23, and 25-27 read on a product of nature. This judicial exception is not integrated into a practical application and does not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims read entirely on a wild species of plant, Beta vulgaris subsp. maritima, or a population thereof. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 18-21 and 23-27 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in this rejection as they all depend directly or indirectly from independent claim 18. Claim 18 is indefinite in its recitation of an endogenous nucleic acid having “(a) a nucleotide sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2 or, or a polypeptide having an amino acid sequence that is at least 95% identical to SEQ ID NO: 2, in which at least one amino acid residue substitution is present as a result of one or more mutations in the nucleic acid sequence; (b) a nucleotide sequence that comprises the sequence of SEQ ID NO: 1, in which at least one nucleotide substitution is present as a result of one or more mutations ,which leads to an amino acid substitution”. It is not clear how a polypeptide having the sequence of SEQ ID NO: 2 (i.e. having 100% identity to SEQ ID NO: 2) or a nucleotide sequence comprising SEQ ID NO: 1 (i.e. having 100% identity to SEQ ID NO: 1) can also comprise at least one substitution. It is further not clear what sequence these substitutions are to be compared to in order to ascertain that they are substitutions. One could interpret this to mean that SEQ ID NOs: 1 and 2 comprise these substitutions inherently, and the substitutions are relative to some other reference sequence. One could also interpret this to mean that the claims require the sequences of SEQ ID NOs: 1 or 2, and further require a substitution in the nucleic acid outside of these sequence regions. Thus, the metes and bounds of the claims are unclear. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 18-21 and 23-27 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are broadly drawn to a beet necrotic yellow vein virus (BNYVV) resistant plant of the genus Beta comprising an endogenous nucleic acid molecule having a nucleic acid sequence selected from: (a) sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2 or, or a polypeptide having an amino acid sequence that is at least 95% identical to SEQ ID NO: 2, in which at least one amino acid residue substitution is present as a result of one or more mutations in the nucleic acid sequence; (b) a nucleotide sequence that comprises the sequence of SEQ ID NO: 1, in which at least one nucleotide substitution is present as a result of one or more mutations ,which leads to an amino acid substitution; (c) a nucleotide sequence that encodes a polypeptide which, by substitution, deletion and/or addition from one or more amino acids of the amino acid sequence encoded by the nucleotide sequence according to (a) or (b), is derived from a polypeptide encoded by the nucleotide sequence according to (a) or (b); or (d) a nucleotide sequence that encodes at least one leucine-rich domain (LRR) corresponding to (i) the amino acid positions 558 to 594 of SEQ ID NO: 4, or the amino acid positions 542 to 594 of SEQ ID NO: 4, (ii) the amino acid positions 604 to 634 of SEQ ID NO: 4, or the amino acid positions 582 to 634 of SEQ ID NO: 4, (iii) the amino acid positions 760 to 790 of SEQ ID NO: 4 or (iv) the amino acid positions 838 to 869 of SEQ ID NO: 4, and/or at least one AAA ATPase domain corresponding to (I) the amino acid positions 177 to 289 of SEQ ID NO: 4 or (II) the amino acid positions 156 to 263 of SEQ ID NO: 4. The claims are further drawn to said plants wherein the polypeptide further comprises an amino acid residue at position 566 that differs from arginine, a residue at position 731 that differs from glutamine, and/or a residue that differs at position 831 that differs from proline, all relative to SEQ ID NO: 2; the plant of claim 18 wherein the polypeptide comprises at least one of five amino residue substitutions relative to SEQ ID NO: 2 (K307Q, Q437R, R556H, Q731K, and/or P831S); and the plant of claim 18 wherein the nucleic acid sequence comprises at least one of five nucleotide substitutions (A919C, A1310G, G1697A, C2191A, and/or C2491T). Thus BNYVV-resistant plants of claim 18 read on any plants of the genus Beta comprising a polynucleotide or a polypeptide with any number of substitutions relative to the 2784 nucleotide long SEQ ID NO: 1 or any number of substitutions relative to the 927 amino acid long SEQ ID NO: 2, or approximately 800-900 substitutions relative to the 927 amino acid long SEQ ID NO: 4 but requiring the presence of at least an LRR or AAA ATPase domain. This is an exceedingly vast genus of claimed plants as the number of encompassed polynucleotides and polypeptides exceeds 1 x 101000. Examiner notes that while claims 25-27 recite limitations drawn to a small number of defined substitutions, the claim language does not limit the sequences to only these substitutions, but rather merely requires their presence. Thus, the plants would encompass, for example, Beta plants comprising at least one of the defined substitutions in addition to substitutions at every other position. In contrast to this vast genus, Applicant has described only a single representative species. Applicant describes sugar beet plants comprising an introgression from Beta vulgaris subsp. maritima, wherein the introgression comprises a gene or genome segment that imparts resistance to rhizomania (instant specification, Example 1, page 28, first paragraph). Applicant further discloses that the resistance gene is an NBS-LRR gene comprising the sequence of instant SEQ ID NO: 3 (resistant genotype; SEQ ID NO: 3 encodes the polypeptide of SEQ ID NO: 4; instant specification, Example 1, page 28-29, bridging paragraph; Figure 1 and Description of Figures). Applicant further discloses the presence of five diagnostic amino acid substitutions and their corresponding nucleotide substitutions in the resistant genotype relative to the susceptible genotype (i.e. SEQ ID NO: 3 relative to SEQ ID NO: 1, the susceptible genotype; SEQ ID NO: 4 relative to SEQ ID NO: 2, the amino acid encoded by SEQ ID NO: 1; instant specification, Example 1, page 29, second paragraph). Of these substitutions (amino acid substitutions K307Q, Q437R, R556H, Q731K, and P831S; and corresponding nucleotide substitutions A919C, A1310G, G1697A, C2191A, and C2491T) applicant discloses that only two are considered to be causative mutations (amino acid substitutions K307Q and Q437R and corresponding nucleotide substitutions A919C and A1310G; instant specification, Example 1, page 29, second paragraph, Figure 1 and Brief Description of the Figures, page 12). Thus, applicant has described a single species of the claimed genus: a BNYVV-resistant sugar beet plant (Beta vulgaris subsp. vulgaris) comprising in its genome an introgressed nucleotide sequence comprising SEQ ID NO: 3 (which encodes SEQ ID NO: 4), wherein said nucleotide comprises two causative SNPs (A919C and A1310G) that result in two amino acid residue substitutions (K307Q and Q437R). Applicant describes SEQ ID NO: 1 as the genomic sequence of the rhizomania sensitive allele and SEQ ID NO:2 as the polypeptide encoded by said rhizomania sensitive allele. The sensitive allele and the polypeptide it encodes both share over 98% sequence identity to their rhizomania resistant counterparts. Applicant does not describe any other BNYVV resistant plants. Applicant does not describe any other exogenous sequences (introgressed or natively occurring) which confer BNYVV resistance to plants of the genus Beta and have any number of substitutions relative to SEQ ID NO: 1 or 2, or that comprise one of the LRR or AAA ATPase domains recited in claim 18 but otherwise comprise any number of mutations relative to SEQ ID NO: 4. Examiner notes that regarding the limitations in claim 18 drawn to the domains of SEQ ID NO: 4, none of the domains encompass one of the disclosed causative SNPs. Applicant does not describe any other exogenous sequences (introgressed or natively occurring) which confer BNYVV resistance to plants of the genus Beta and have any number of substitutions relative to SEQ ID NO: 1 or 2, or that comprise one of the LRR or AAA ATPase domains recited in claim 18 but otherwise comprise any number of mutations relative to SEQ ID NO: 4, wherein said sequences also comprise at least one of the amino acid substitutions K307Q, Q437R, R556H, Q731K, and P831S or at least one of the corresponding nucleotide substitutions A919C, A1310G, G1697A, C2191A, and C2491T. The specification teaches that SEQ ID NOs 1 and 3 are disease resistance genes of the NBS-LRR type, which are characterized by possession of an LRR and NB-ARC domain (instant specification, page 14, paragraphs 1-2). Martin et al (2003, Annual Review Plant Biology 54: 23-61) as cited in the instant specification, discloses that it is known in the art that LRR and NB-ARC domains (a part of the NBS region), while associated with disease resistant proteins, are also common to proteins with diverse functions (page 30, paragraph 1; page 30-31, bridging paragraph). Further, the specification teaches that not only is there diversity in this function of these structures, but also that the structural-functional relationship is unpredictable and, in part owing to the repetitive nature of the nucleic acid sequence, it is not possible to identify BNYVV-resistance conferring nucleic acids based on the possession known structural motifs (page 14, paragraph 2). Moreover, as NBS-LRR proteins that do have the function of disease resistance are diverse, the specification does not teach any other structures, motifs or amino acid resides that are necessary to confer BNYVV resistance specifically (beyond the two disclosed causative SNPs and amino acid substitutions) and such structures, motifs or amino acid resides do not appear to be known in the art (Martin et al 2003, page 24, last paragraph; Table 1). Post-filing art has indicated there are over 231 NB-ARC domain containing proteins within sugar beet, and each one may correspond to a single avirulence gene (gene-for-gene hypothesis; Funk et al, 2018, The Plant Journal 95: 659-671; specifically, Summary and Introduction, but also throughout text). Thus, the structures which are both necessary and sufficient to distinguish a polynucleotide or polypeptide with any number of substitutions relative to the 2784 nucleotide long SEQ ID NO: 1 or any number of substitutions relative to the 927 amino acid long SEQ ID NO: 2, or approximately 800-900 substitutions relative to the 927 amino acid long SEQ ID NO: 4, which when said polypeptide or polynucleotide further comprises the causative SNPs and amino acid residue described in the application, confers rhizomania resistance to plants of the genus Beta from those that do no confer said resistance, are not described and are not known in the prior art. One of skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species. Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is highly diverse, the single disclosed plant is insufficient to describe the claimed genus. Hence, Applicant has not, in fact, described BNYVV resistant Beta plants over the full scope of the claims and the specification fails to provide adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Enablement Claims 18-21 and 23-27 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for BNYVV Beta vulgaris subsp. vulgaris plants comprising the polynucleotide of SEQ ID NO: 3 or a polynucleotide encoding the polypeptide of SEQ ID NO: 4, does not reasonably provide enablement across the full scope of the claims (as detailed below) The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims. The claims are broadly drawn to a beet necrotic yellow vein virus (BNYVV) resistant plant of the genus Beta comprising an endogenous nucleic acid molecule having a nucleic acid sequence selected from: (a) sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2 or, or a polypeptide having an amino acid sequence that is at least 95% identical to SEQ ID NO: 2, in which at least one amino acid residue substitution is present as a result of one or more mutations in the nucleic acid sequence; (b) a nucleotide sequence that comprises the sequence of SEQ ID NO: 1, in which at least one nucleotide substitution is present as a result of one or more mutations ,which leads to an amino acid substitution; (c) a nucleotide sequence that encodes a polypeptide which, by substitution, deletion and/or addition from one or more amino acids of the amino acid sequence encoded by the nucleotide sequence according to (a) or (b), is derived from a polypeptide encoded by the nucleotide sequence according to (a) or (b); or (d) a nucleotide sequence that encodes at least one leucine-rich domain (LRR) corresponding to (i) the amino acid positions 558 to 594 of SEQ ID NO: 4, or the amino acid positions 542 to 594 of SEQ ID NO: 4, (ii) the amino acid positions 604 to 634 of SEQ ID NO: 4, or the amino acid positions 582 to 634 of SEQ ID NO: 4, (iii) the amino acid positions 760 to 790 of SEQ ID NO: 4 or (iv) the amino acid positions 838 to 869 of SEQ ID NO: 4, and/or at least one AAA ATPase domain corresponding to (I) the amino acid positions 177 to 289 of SEQ ID NO: 4 or (II) the amino acid positions 156 to 263 of SEQ ID NO: 4. The claims are further drawn to said plants wherein the polypeptide further comprises an amino acid residue at position 566 that differs from arginine, a residue at position 731 that differs from glutamine, and/or a residue that differs at position 831 that differs from proline, all relative to SEQ ID NO: 2; the plant of claim 18 wherein the polypeptide comprises at least one of five amino residue substitutions relative to SEQ ID NO: 2 (K307Q, Q437R, R556H, Q731K, and/or P831S); and the plant of claim 18 wherein the nucleic acid sequence comprises at least one of five nucleotide substitutions (A919C, A1310G, G1697A, C2191A, and/or C2491T). Thus BNYVV-resistant plants of claim 18 read on any plants of the genus Beta comprising a polynucleotide or a polypeptide with any number of substitutions relative to the 2784 nucleotide long SEQ ID NO: 1 or any number of substitutions relative to the 927 amino acid long SEQ ID NO: 2, or approximately 800-900 substitutions relative to the 927 amino acid long SEQ ID NO: 4 but requiring the presence of at least an LRR or AAA ATPase domain. This is an exceedingly vast genus of claimed plants as the number of encompassed polynucleotides and polypeptides exceeds 1 x 101000. Applicant teaches sugar beet plants comprising an introgression from Beta vulgaris subsp. maritima, wherein the introgression comprises a gene or genome segment that imparts resistance to rhizomania (instant specification, Example 1, page 28, first paragraph). Applicant further teaches that the resistance gene is an NBS-LRR gene comprising the sequence of instant SEQ ID NO: 3 (resistant genotype; SEQ ID NO: 3 encodes the polypeptide of SEQ ID NO: 4; instant specification, Example 1, page 28-29, bridging paragraph; Figure 1 and Description of Figures). Applicant further teaches the presence of five diagnostic amino acid substitutions and their corresponding nucleotide substitutions in the resistant genotype relative to the susceptible genotype (i.e. SEQ ID NO: 3 relative to SEQ ID NO: 1, the susceptible genotype; SEQ ID NO: 4 relative to SEQ ID NO: 2, the amino acid encoded by SEQ ID NO: 1; instant specification, Example 1, page 29, second paragraph). Of these substitutions (amino acid substitutions K307Q, Q437R, R556H, Q731K, and P831S; and corresponding nucleotide substitutions A919C, A1310G, G1697A, C2191A, and C2491T) applicant teaches that only two are considered to be causative mutations (amino acid substitutions K307Q and Q437R and corresponding nucleotide substitutions A919C and A1310G; instant specification, Example 1, page 29, second paragraph, Figure 1 and Brief Description of the Figures, page 12). Thus, applicant has taught a single species of the claimed genus: a BNYVV-resistant sugar beet plant (Beta vulgaris subsp. vulgaris) comprising in its genome an introgressed nucleotide sequence comprising SEQ ID NO: 3 (which encodes SEQ ID NO: 4), wherein said nucleotide comprises two causative SNPs (A919C and A1310G) that result in two amino acid residue substitutions (K307Q and Q437R). Applicant teaches SEQ ID NO: 1 as the genomic sequence of the rhizomania sensitive allele and SEQ ID NO:2 as the polypeptide encoded by said rhizomania sensitive allele. The sensitive allele and the polypeptide it encodes both share over 98% sequence identity to their rhizomania resistant counterparts. Applicant does not teach any other BNYVV resistant plants. Applicant does not teach any other exogenous sequences (introgressed or natively occurring) which confer BNYVV resistance to plants of the genus Beta and have any number of substitutions relative to SEQ ID NO: 1 or 2, or that comprise one of the LRR or AAA ATPase domains recited in claim 18 but otherwise comprise any number of mutations relative to SEQ ID NO: 4. Examiner notes that regarding the limitations in claim 18 drawn to the domains of SEQ ID NO: 4, none of the domains encompass one of the disclosed causative SNPs. Applicant does not teach any other exogenous sequences (introgressed or natively occurring) which confer BNYVV resistance to plants of the genus Beta and have any number of substitutions relative to SEQ ID NO: 1 or 2, or that comprise one of the LRR or AAA ATPase domains recited in claim 18 but otherwise comprise any number of mutations relative to SEQ ID NO: 4, wherein said sequences also comprise at least one of the amino acid substitutions K307Q, Q437R, R556H, Q731K, and P831S or at least one of the corresponding nucleotide substitutions A919C, A1310G, G1697A, C2191A, and C2491T. The specification fails to provide guidance for how to make a BNYVV resistant plant of genus Beta comprising a polynucleotide or a polypeptide with any number of substitutions relative to the 2784 nucleotide long SEQ ID NO: 1 or any number of substitutions relative to the 927 amino acid long SEQ ID NO: 2, or approximately 800-900 substitutions relative to the 927 amino acid long SEQ ID NO: 4 but requiring the presence of at least an LRR or AAA ATPase domain. The instant specification fails to provide guidance for which nucleotides of SEQ ID NO: 1 can be altered and to which other nucleotides, and which nucleotides must not be changed to maintain the rhizomania resistance activity of the encoded polypeptide when it further comprises the causative SNPs A919C and A1310G. The specification also fails to provide guidance for which nucleotides can be deleted and which regions of the polynucleotide can tolerate insertions and still produce a functional protein. The instant specification fails to provide guidance for which amino acids of SEQ ID NO:2 can be altered and to which other amino acids, and which amino acids must not be changed, to maintain the rhizomania resistance activity of the polypeptide when it further comprises the amino acid residue substitutions K307Q and Q437R. The specification also fails to provide guidance for which amino acids can be deleted and which regions of the protein can tolerate insertions and still produce a functional enzyme. Applicant teaches that the nucleic acids of the instant application are disease resistance genes of the NBS-LRR type, which are characterized by possession of an LRR and NB-ARC domain (instant specification, page 14, paragraphs 1-2). However, the specification does not teach any other structures, motifs or amino acid resides that are necessary to confer rhizomania resistance specifically, as NBC-LRR type resistance proteins and the associated domains are common to a wide range of disease resistance proteins (Martin et al 2003, page 24, last paragraph; Table 1). Applicant further teaches that the gene was introgressed from Beta vulgaris subsp. maritima, but they do not provide any details regarding the source population (instant specification, Example 1, page 28, first paragraph). The specification teaches that the nucleic acids may be modified by substitution, deletion, or insertions of nucleotides or amino acids as long as the function remains unchanged (instant specification, pages 14-15). However, they do not teach which nucleotides or residues can be altered and which must remain unchanged for said function to remain unchanged. Thus, from the guidance in the specification, it would appear that one of skill in the art would need to make the claimed proteins by making random nucleotide and amino acid substitutions, which would be unpredictable. While proteins are fairly tolerant to mutations resulting in single amino acid changes, increasing the number of substitutions additively increases the probability that the protein will be inactivated (Guo et al, 2004, Proc. Natl. Acad. Sci. USA 101: 9205-9210; pg 9209, right column, paragraph 2). Given the vast number of nucleic acids encompassed by the claims, making and assaying even a representative sample to find any that confer rhizomania resistance, when also comprising the causative SNPs or amino acid residues or otherwise, would entail undue experimentation. Thus extensive teachings are required for making a polynucleotide or polypeptide with any number of substitutions relative to the 2784 nucleotide long SEQ ID NO: 1 or any number of substitutions relative to the 927 amino acid long SEQ ID NO: 2, or approximately 800-900 substitutions relative to the 927 amino acid long SEQ ID NO: 4, which when said polypeptide or polynucleotide further comprises the causative SNPs and amino acid residue described in the application, confers rhizomania resistance to plants of the genus Beta. These teachings are not provided for by specification. The specification also fails to overcome the unpredictability in the art of making a large number of amino acid substitutions in rhizomania resistance conferring polynucleotides or polypeptides and it provides no guidance on a source for such a starting material. Undue experimentation would have been required by one skilled in the art to develop BNYVV resistant plants of the genus Beta across the full scope of the claims. Given the claim breath, unpredictability in the art, undue experimentation, and lack of guidance in the specification as discussed above, the instant invention is not enabled throughout the full scope of the claims. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 18-21 and 23-24 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Lewellen 2004 (Crop Sci. 44: 357–358) as evidenced by McGrath et al 2023 (DNA Research 30: 1-14; doi.org/10.1093/dnares/dsac033) and NCBI Accession NC_079204.1 2023 (ncbi.nlm.nih.gov/nuccore/NC_079204.1; accessed 15 October 2025). Lewellen 2004 discloses a rhizomania resistant sugar beet population named C869 and a CMS counterpart C869CMS (page 357, column 2, paragraphs 1-3). McGrath et al discloses the genome of sugar beet EL10 and provides evidence that it was derived by single seed descent from C869 and thus comprises in its genome only the genetic elements present in C869 (page 2, column 2, “Section 2.1”, first paragraph). Alignment of SEQ ID NO: 1 with a genomic sequence of EL10 (NCBI Accession NCBI Accession NC_079204.1) shows that EL10, and by extension C869, comprises in its genome a nucleotide sequence that differs from instant SEQ ID NO: 1 by one or more mutations (see above under ‘Claim Interpretation” for Examiner’s interpretation of the term “mutation” in the context of this application). >Beta vulgaris subsp. vulgaris cultivar EL10 chromosome 3, EL10.2 Sequence ID: NC_079204.1 Length: 57299960 Range 1: 13767700 to 13770483 Score:4959 bits(2685), Expect:0.0, Identities:2751/2784(99%), Gaps:0/2784(0%), Strand: Plus/Plus Query 1 ATGGAAGCATTTCAGTCTGACATCGCGTTGGCTTTGCTTCAAGATTTGTTAGAAAGATTT 60 ||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||| Sbjct 13767700 ATGGAAGCATTTCAGTCAGACATCGCGTTGGCTTTGCTTCAAGATTTGCTAGAGAGATTT 13767759 Query 61 AAATCATTAGTCATTGATGAAGCAGGTCAAATAGTACAGTTTGATGCAGAGGATGAACTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13767760 AAATCATTAGTCATTGATGAAGCAGGTCAAATAGTACAGTTTGATGCAGAGGATGAACTG 13767819 Query 121 AAGAAACTGGAGAGGAAGCTATTAAAGGCCCAAGTCTTGCTTGGCAGCTTTCAGCTGACA 180 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 13767820 AAGAAACTGGAGAGGAAGCTAAAAAAGGCCCAAGTCTTGCTTGGCAGCTTTCAGCTGACA 13767879 Query 181 ACCGACAAAAATTGGCAACACTGGGTTGGTGATGTCACCAGAGTTTGCTATGATGCTGAA 240 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 13767880 ACCGACAAAAATTGGCAACACTGGATTGGTGATGTCACCAGAGTTTGCTATGATGCTGAA 13767939 Query 241 GACTTGGTTGATGATATAGTGCTTGATGCCGGCAAAACTTCATTGCTTGAGAAGATCTTG 300 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 13767940 GACTTGGTTGATGATATAGTGCTTGATGCCGGCAAAACTTCATTGTTTGAGAAGATCTTG 13767999 Query 301 TCATATTTCACAAGAGGAAGCATGGCCCGGAAGATCCAAGAGCTCCAAGATAGGTTGGAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768000 TCATATTTCACAAGAGGAAGCATGGCCCGGAAGATCCAAGAGCTCCAAGATAGGTTGGAA 13768059 Query 361 GATATAATAAGTGGATTAGACATGGTTAACAAAACAAAGCAACGAGCACAGCAATGTTAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768060 GATATAATAAGTGGATTAGACATGGTTAACAAAACAAAGCAACGAGCACAGCAATGTTAT 13768119 Query 421 TTAGGGGAGTTTGTTTATGGTAACGAACAATTACTCCTAACAGAGAAGTTATTTGGGAGG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768120 TTAGGGGAGTTTGTTTATGGTAACGAACAATTACTCCTAACAGAGAAGTTATTTGGGAGG 13768179 Query 481 GATGCAGATAAGGAGAACATTATCTCGATGTTACTGGAACAGACAATAAGCTCAGTATCT 540 |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| Sbjct 13768180 GATGCAGATAAGGAGAACATTATCACGATGTTGCTGGAACAGACAATAAGCTCAGTATCT 13768239 Query 541 ATTGTTGGCATGGACGGGCTTGGTAAAACAACACTTGCTCAGAATATGCTATATGATTCC 600 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 13768240 ATTGTTGGCATGGACGGGCTTGGTAAAACAACACTTGCTCAGAATATACTATATGATTCC 13768299 Query 601 AGAATCCAGGAGAAATTTCATCATAGAGTGTGGGTCCGTGTGTCTGCGAAGTTTGATCTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768300 AGAATCCAGGAGAAATTTCATCATAGAGTGTGGGTCCGTGTGTCTGCGAAGTTTGATCTG 13768359 Query 661 AGAAAAATCACAGACTTTATCTTACATCGCAGGCAGGAATGTGAGTACAGCTTTCTTCCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768360 AGAAAAATCACAGACTTTATCTTACATCGCAGGCAGGAATGTGAGTACAGCTTTCTTCCT 13768419 Query 721 GAGAAAATATATGGTTTGTTTCACGATCTGTATATGGGTAAAAGTATATTGATTGTGTTG 780 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768420 GAGAAAATACATGGTTTGTTTCACGATCTGTATATGGGTAAAAGTATATTGATTGTGTTG 13768479 Query 781 GATGACTTATGGGATGTGAAGTACGATGATTGGAGGTCTTTTCGCTCTTTGTTTCTGCGC 840 |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| Sbjct 13768480 GATGACTTATGGGATGTGAAGTACAATGATTGGAGCTCTTTTCGCTCTTTGTTTCTGCGC 13768539 Query 841 TCTTCTGGTTGCAAAGTTCTTCTCACCACTAGCAATCCAAATGTAACAACGGTTACAAAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768540 TCTTCTGGTTGCAAAGTTCTTCTCACCACTAGCAATCCAAATGTAACAACGGTTACAAAA 13768599 Query 901 GCTACACCGTATCATTTAAAATTGATGAAGGATGAAGATTGCCAAGCTCTAATCATGGAT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768600 GCTACACCGTATCATTTAAAATTGATGAAGGATGAAGATTGCCAAGCTCTAATCATGGAT 13768659 Query 961 AGAGTTTTCTCATCTAATAATCTATCTGAACGTCAGCTTGTAATCTTGGAGGATATTGCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768660 AGAGTTTTCTCATCTAATAATCTATCTGAACGTCAGCTTGTAATCTTGGAGGATATTGCT 13768719 Query 1021 GTAGCAGTTGCCCAAAAGTGCAAGGGCTTGCCTCTGGCAGCCAATGTTTTGGGCCTCCAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768720 GTAGCAGTTGCCCAAAAGTGCAAGGGCTTGCCTCTGGCAGCCAATGTTTTGGGCCTCCAT 13768779 Query 1081 TTATCTTCTGGGCGTAGAGATGATGAATGGATGAATTTTTTAGATAGAGACATATGCGAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768780 TTATCTTCTGGGCGTAGAGATGATGAATGGATGAATTTTTTAGATAGAGACATATGCGAG 13768839 Query 1141 TTGAGGGTATTCAAAGAAGAAATATTTCCTGCTTTTAGACTGAACAACCCTTGTTTGGCA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768840 TTGAGGGTATTCAAAGAAGAAATATTTCCTGCTTTTAGACTGAACAACCCTTGTTTGGCA 13768899 Query 1201 TCACACTTAAAGAAGTGTCTTGCTTACTGCTCATTATTTCCTCATGATTACGATTTCAAG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768900 TCACACTTAAAGAAGTGTCTTGCTTACTGCTCATTATTTCCTCATGATTACGATTTCAAG 13768959 Query 1261 AAAGAAAACTTAGTTCAGCTATGGATGTCAGAAGGtttttttCTGCCTCAAAGGATGACA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13768960 AAAGAAAACTTAGTTCAGCTATGGATGTCAGAAGGTTTTTTTCTGCCTCAAAGGATGACA 13769019 Query 1321 AGCCTAGAACAAATTGGCAGTGATTGTTTTGATGAGCTCTTGTGGAGATCTGTCTTTCAA 1380 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 13769020 AGCCTAGAACAAATTGGCAGTGATTGTTTTGATGAGCTCTTGTAGAGATCTGTCTTTCAA 13769079 Query 1381 CTTTCACATGTTGGTGATCAGGAGCTACCAACTTACAAAATGCATGAATTTATTCGCAGG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769080 CTTTCACATGTTGGTGATCAGGAGCTACCAACTTACAAAATGCATGAATTTATTCGCAGG 13769139 Query 1441 TTTGCTGAATTTGTGGCCTCAGACACATGTTTCCGGTGGGAGGAAGGTCAGAGCTCTTTC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769140 TTTGCTGAATTTGTGGCCTCAGACACATGTTTCCGGTGGGAGGAAGGTCAGAGCTCTTTC 13769199 Query 1501 TCAGTTCCTTGGTACAAAACGGCTCGTCATTTATCTTTGCTTTGTGATTGCATCAAACCA 1560 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 13769200 TCAGTTCCTTGGTACAAAACGGCTCGTCATTTATCTTTGCTTTCTGATTGCATCAAACCA 13769259 Query 1561 GCATTCCTTAAATACATTGAAAATTGTGATGGTCTGAGGACATTTCTTCTGCTAAGTGAA 1620 | |||| |||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 13769260 GAGTTCCGTAAATACATTGAAAATTGTGATGGTCTGAGGACATTTCTTCTGCTAAGTGCA 13769319 Query 1621 AAAGGAACACAAATTGGCCAGCTTCCTTATTCACTTTTCCAGAAACTAGTACGACTGCGA 1680 ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct 13769320 AAAGGAACACAAATTGGCCAGTTTCCTTATTCACTTTTCCAGAAACTAGTACGATTGCGA 13769379 Query 1681 GTTCTGGACTTGAGTCGTACTGATATTGATGAGCTCCCGGAGTCATTGGGTAGATTAAAG 1740 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769380 GTTCTAGACTTGAGTCGTACTGATATTGATGAGCTCCCGGAGTCATTGGGTAGATTAAAG 13769439 Query 1741 TATCTTCGGTATTTCGATGCATCTCAGACACATATCCTAAGGTTGCCTAAGTCAGTGACC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769440 TATCTTCGGTATTTCGATGCATCTCAGACACATATCCTAAGGTTGCCTAAGTCAGTGACC 13769499 Query 1801 AACCTTCATCAATTACAAGTACTCAGATTGAGAGAATGTTATAAACTTCTAGAGTTGCCA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769500 AACCTTCATCAATTACAAGTACTCAGATTGAGAGAATGTTATAAACTTCTAGAGTTGCCA 13769559 Query 1861 AAAAACATTAAGAACCTGACTAACCTTCTACATCTTGACGTGGACATTAAAGGATTGAGG 1920 |||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||| Sbjct 13769560 AAAAACGTTAAGAACTTGAGTAACCTTCTACATCTTGACGTGGACATTAAAGGATTGAGG 13769619 Query 1921 TGTAGGCCAGCAAGTATAGGAAGTCTAAGTTGCCTTAAAACACTTCCTTCCTTTGCTGTT 1980 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769620 TGTAGACCAGCAAGTATAGGAAGTCTAAGTTGCCTTAAAACACTTCCTTCCTTTGCTGTT 13769679 Query 1981 TGTAAGAAGGTAGGATATCGCATTGCAGAGTTGAAGAATCTGAAGAATCTATGTGGTACA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769680 TGTAAGAAGGTAGGATATCGCATTGCAGAGTTGAAGAATCTGAAGAATCTATGTGGTACA 13769739 Query 2041 ATTTGCCTTAGTAATCTTGAAAATGTTAAGGATGGGGCAGAGGCCAGGGACGCGATGATA 2100 ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| Sbjct 13769740 ATTTGCCTTAGTAATCTTGAAAACGTTAAGGATGGGGCAGAGGCCAGGGAAGCGATGATA 13769799 Query 2101 TGTGATAAGCCATATATCAAAAGGTTGGAATTAGAATGGAGCCGTTTTTCTCGAGATGGG 2160 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 13769800 TGTGATAAGCCATATATCAAAAGCTTGGAATTAGAATGGAGCCGTTTTTCTCGAGATGGG 13769859 Query 2161 TCAATAGAGATGGATGTTCTTGCTGGCCTTCAACCAGACAAAAATTTGAAAGAACTGCAA 2220 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 13769860 TCAATAGAGATGGATGTCCTTGCTGGCCTTCAACCAGACAAAAATTTGAAAGAACTGCAA 13769919 Query 2221 GTAATCAACTATGGTGGTTCGAGCTTTCCTGCTTGGCTTACAAGCCCATCTTGCATGCTT 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13769920 GTAATCAACTATGGTGGTTCGAGCTTTCCTGCTTGGCTTACAAGCCCATCTTGCATGCTT 13769979 Query 2281 GTGAGTATCTATATGCAAAATTGTCGGCAAGATGACTTTCTGCCTTCACTTGGGCAACTT 2340 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 13769980 GTGAGTATCTATATGCAAAACTGTCGGCAAGATGACTTTCTGCCTTCACTTGGGCAACTT 13770039 Query 2341 CCTTTCCTCAAGACACTTCATGTTGAAGGTATGCATAGCGTGAAGTATGTGGACTATCAT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13770040 CCTTTCCTCAAGACACTTCATGTTGAAGGTATGCATAGCGTGAAGTATGTGGACTATCAT 13770099 Query 2401 TTTTGTGGTGAAAGTACAACTGGGGCCTTTCCTTCCTTGGAATCACTGAAGATCCAGGAC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13770100 TTTTGTGGTGAAAGTACAACTGGGGCCTTTCCTTCCTTGGAATCACTGAAGATCCAGGAC 13770159 Query 2461 ATGATGTGCCTTATGAGTTGGTATCCATTACCAGACAATAGCTTGCTCCAACTCCGTGAT 2520 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 13770160 ATGATGTGCCTTATGAGTTGGTATCCATTACCAGACAATAGCTTGCTCCAGCTCCGTGAT 13770219 Query 2521 CTTACAATAGAGGATTGTCCAAGTCTCTTCTCAATGCAATCGCTAAAACATATGAGTTCA 2580 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13770220 CTTACAATTGAGGATTGTCCAAGTCTCTTCTCAATGCAATCGCTAAAACATATGAGTTCA 13770279 Query 2581 CTACAAGAACTAGTGATCAACTGTTGCCCAGGGCTGGAGACATTGCCTCAGCTACCAGGA 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13770280 CTACAAGAACTAGTGATCAACTGTTGCCCAGGGCTGGAGACATTGCCTCAGCTACCAGGA 13770339 Query 2641 TCAATTCAGTCATTGATCATTTTCGAAAGTGATATGGTGAAACAGCGGTGTCAGATTGAA 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13770340 TCAATTCAGTCATTGATCATTTTCGAAAGTGATATGGTGAAACAGCGGTGTCAGATTGAA 13770399 Query 2701 GAAGGTCCTGAATGGAACATCATAAAAACAATTCCTTATGTGGAGATTGACTACGAGAGT 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13770400 GAAGGTCCTGAATGGAACATCATAAAAACAATTCCTTATGTGGAGATTGACTACGAGAGT 13770459 Query 2761 ATGTTTCCTGGAGATTCAAGTTAG 2784 |||||||||||||||||||||||| Sbjct 13770460 ATGTTTCCTGGAGATTCAAGTTAG 13770483 Regarding the limitations in claim 19 that the mutations defined in claim 18 have been “introduced into an endogenous nucleic acid molecule having a nucleotide sequence that comprises SEQ ID NO: 1”, Examiner notes that this claim is drawn to a “product by process”. Any product claimed in a product by process that is the same as, or obvious from, a product of the prior art is unpatentable unless the manufacturing process steps would be expected to impart distinctive structural characteristics to the final product (see MPEP 2113). In the instant case, an introduced mutation would be indistinguishable from a naturally occurring mutation. Regarding the limitations of claims 20 and 21, all nucleic acids, alleles or mutations either are “homozygous or heterozygous” therefor the plant of Lewellen et al inherently meets these limitations. For the reasons set forth above, all the limitations of claims 18-21 and 23-24 are anticipated by Lewellen 2004 as evidenced by McGrath et al 2023 and NCBI Accession NC_079204.1 2023. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Shubo (Joe) Zhou can be reached at 571-272-0724. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALEKSANDAR RADOSAVLJEVIC/Examiner, Art Unit 1662 /SHUBO ZHOU/Supervisory Patent Examiner, Art Unit 1662 ATTACHMENT TO THE OFFICE ACTION Request for Information under 37 CFR § 1.105 Applicant and the assignee of this application are required under 37 CFR § 1.105 to provide the following information that the examiner has determined is reasonably necessary to the examination of this application. This request is being made for the following reasons: Applicant is claiming a BNYVV resistant plant of the genus Beta. Applicant discloses the following in the specification: the discovery of a population of sugar beet plants comprising an introgression from Beta vulgaris subsp. maritima, wherein the introgression comprises a gene or genome segment that imparts resistance to rhizomania (instant specification, Example 1, page 28, first paragraph). the resistance gene is an NBS-LRR gene comprising the sequence of instant SEQ ID NO: 3 and; five diagnostic amino acid substitutions and their corresponding nucleotide substitutions are present in the resistant genotype. Furthermore, as instant SEQ ID NO: 3 has 99% sequence identity to a polynucleotide located on chromosome three of the sugar beet EL10, it appears that the claimed plants comprise a resistance gene on chromosome 3. It appears that all currently known sources of rhizomania resistance in sugar beet originated in Beta vulgaris subsp. maritima and are located in relatively close proximity on chromosome 3, though the exact locations and the sequences are mostly unknown (see Biaggi et al, 2010, Sugar Tech 12: 238-242, page 240, Table 1; Pa
Read full office action

Prosecution Timeline

Aug 24, 2022
Application Filed
Oct 17, 2025
Non-Final Rejection — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600977
PLANTS AND METHODS FOR PRODUCING 2-PYRONE-4, 6-DICARBOXYLIC ACID (PDC)
2y 5m to grant Granted Apr 14, 2026
Patent 12599079
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010446
2y 5m to grant Granted Apr 14, 2026
Patent 12599088
SOYBEAN CULTIVAR 24180206
2y 5m to grant Granted Apr 14, 2026
Patent 12599103
Tomato Hybrid SVTM9041 and Parents Thereof
2y 5m to grant Granted Apr 14, 2026
Patent 12588681
COMPOSITIONS, KITS AND METHODS FOR WEED CONTROL
2y 5m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
82%
Grant Probability
89%
With Interview (+7.0%)
2y 11m
Median Time to Grant
Low
PTA Risk
Based on 106 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month