Prosecution Insights
Last updated: April 19, 2026
Application No. 17/836,265

Modified Guide RNAs for Gene Editing

Non-Final OA §102§103§112§DP
Filed
Jun 09, 2022
Examiner
ARIETI, RUTH SOPHIA
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Intellia Therapeutics, Inc.
OA Round
1 (Non-Final)
46%
Grant Probability
Moderate
1-2
OA Rounds
2y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
37 granted / 81 resolved
-14.3% vs TC avg
Strong +73% interview lift
Without
With
+72.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
37 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
12.3%
-27.7% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 81 resolved cases

Office Action

§102 §103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . NOTE: the examiner for this application has changed. Please address all future correspondence to Examiner Ruthie Arieti, AU1635. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-81, 86-92 are pending. Election/Restrictions Applicant’s election without traverse of: The invention of Group I, drawn to a guide RNA and The species SEQ ID NOs 281 and 1130 in the reply filed on 23 September 2025 is acknowledged. Claim 81 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 23 September 2025. SEQ ID NO 281 was searched and found to be free of the prior art of record. The other sequences recited in Claims 61-62 were searched and the following claimed SEQ ID NOs shown in the left-hand column were found to be duplicates or comprised by claimed SEQ ID NOs, as shown in this table: SEQ ID NO is or is comprised by Claim 61 SEQ ID NOs Claim 62 SEQ ID NOs Not claimed SEQ ID NOs 281 70-mer 7 407 481 681 107 181 307 391 393 507 581 591 593 707 781 791 793 795 797 909 911 913-914 921-951 962-968 970-975 81 291 293 381 491 493 607 691 693 695 697 809 811 813-814 817 818 821-851 861-868 870-875 917-918 961 5 90-mer 5 105 6 90-mer 6 106 7 90-mer 7 comprises 281 107 181 795 797 921-951 962-968 970-975 81 695 697 817 818 821-851 861-868 870-875 917-918 961 8 89-mer 8 108 82 182 9 89-mer 9 109 10 89-mer 10 110 11 88-mer 11 111 83 183 12 88-mer 12 112 84 184 696 698 796 798 90 86-mer 90 190 205 70-mer 5 405 605 105 305 505 705 206 70-mer 6 406 606 106 306 506 706 208 69-mer 8 408 608 108 308 508 708 82 182 282 382 482 582 682 782 209 69-mer 9 409 609 109 309 509 709 210 69-mer 10 410 610 110 310 510 710 211 68-mer 11 611 411 111 311 511 711 83 183 283 383 483 583 683 783 212 68-mer 12 112 412 612 312 515 712 84 184 284 292 294 384 392 394 484 492 494 584 592 594 684 692 694 696 698 784 792 794 796 798 810 812 910 912 290 66-mer 90 490 690 190 390 590 790 809 90-mer 909 911 811 813 90-mer 913 814 90-mer 914 852 90-mer 952 853 90-mer 953-954 854 855 90-mer 955-956 969 856 869 857 90-mer 957-958 858 859 90-mer 959-960 860 The sequences in the first column are either (1) identical to or (2) comprised by the sequences in the other columns (same row). The sequences in the first column have been searched and found free of the prior art of record. Since the sequences in the other columns are identical to or are longer than the sequences in the first column, they are also free of the prior art of record. Since the sequences in Claims 61 and 62 are found free of the prior art of record, the requirement for election of species as it pertains to the requirement for electing a guide RNA is withdrawn. The other species requirement is maintained. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are examined. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see ¶55). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Interpretation Claims 1, 36, 42, 48,56, 58-60, and 92 recite a modification. A modification is understood to mean a modified nt or linkage. Claim 2 recites G, C, U, and A. Those are interpreted as nucleotide bases. Claims 39, 41, and 56 recite a 3’tail. 3’tails are known in the art (e.g. a polyA tail). Therefore the term is interpreted as encompassing any nt at the 3’end that is additional to what is recited in Claim 1. Claim 42 recites the limitation "the hairpin region" in L1-2. Claim 48 recites the limitation "the hairpin region" in point (3). Claim 1 recites a broad hairpin region that comprises two hairpin regions, H1 and H2. The claims are interpreted as requiring a modification in any part of the broad hairpin region. Claim 48 recites the guide RNA comprises a protective end modification. That term is defined in the Spec. ¶52: …a "protective end modification" (such as a protective 5' end modification or protective 3' end modification) refers to a modification of one or more nucleotides within seven nucleotides of the end of an sgRNA that reduces degradation of the sgRNA, such as exonucleolytic degradation… The claim is interpreted as encompassing any modification that reduces degradation of the sgRNA under any condition. Claim Objections Claim 1 is objected to because of the following informalities: Claim 1 recites ___ being nucleotides ___, for example a lower stem region being nucleotides... The claim will be better if it recites ___ that is nucleotides ___, for example a lower stem region that is nucleotides... Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. The term “a conserved portion” in Claim 1 is a relative term which renders the claim indefinite. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. The term “a conserved portion” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. There is no standard in the art—or in the claim—for what constitutes (and doesn’t constitute) a conserved region. Conserved from what? Conserved vs. what? A person of ordinary skill understands that something is conserved only in relation to something else but no basis for comparison has been provided. The Spec. and claim(s) do not provide any standard for comparison. Claim 1 is rejected for those reasons. Claims 2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are rejected because they depend from Claim 1 and do not remedy the issues. In the interest of compact prosecution, the claim is interpreted as requiring components (i) through (vii). The specific limitation a conserved portion cannot be examined because there is no basis for comparison. The terms “a lower stem region portion” (Claims 1 and claims depending therefrom) and “an upper stem region portion” (Claims 1 and claims depending therefrom and Claims 34, 58-60) are relative terms which render the claims indefinite. The terms “a lower stem region portion” and “an upper stem region portion” are not defined by the claims, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. A person of ordinary skill would not understand what comprises “a lower stem region portion” and “an upper stem region portion” or what is lower or upper in relation to what. Similarly, Claim 1 also recites a nexus region which renders the claims indefinite because there is a question or doubt as to what are the metes and bounds of the claim. A nexus region is not a term of the art and there is no standard in the art—or in the claim—for what constitutes a nexus region. The Spec. hasn’t defined or described what is or constitutes a nexus region. A person of ordinary skill would not understand what is a nexus region or what structure(s) it comprises or excludes. The best description of a nexus region is in Fig. 1A but the figure doesn’t say what a nexus region is and what it isn’t. Therefore its metes and bounds cannot be defined/determined. Claims 1 and 58-60 are rejected for those reasons. Claims 2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are rejected because they depend from Claims 1 and/or 58-59 and do not remedy the issues. In the interest of compact prosecution, the claims are interpreted as requiring components shown in Fig. 1. Further regarding Claim 1’s recitations of “a lower stem region portion”, and regarding “a bulge region portion” and a second “bulge region portion”, the claims recite two of each these—points (i) and (v) both recite a lower stem region portion, and points (ii) and (iv) both recite a bulge region portion. Each set of these regions has the same name and is differentiated only by location and seemingly arbitrary names which are also not terms of the art (i.e., LS1 to LS6 vs LS7 to LS12 and B1 to B2 vs. B3 to B6; see below). The structures that are called by these names have no art-recognized metes and bounds and aren’t defined by the claims and it’s not clear how they relate to one another. In the interest of compact prosecution, the claims are interpreted as: (i) a first lower stem region portion … (ii) a first bulge region portion… (iv) a second bulge region portion… (v) a second lower stem region portion… The first and second portions are understood to comprise a single lower stem region or single bulge, as is shown in Fig. 21A. Claims 1-2, 34, 59, and 86-87 recite terms that are not known in the art: LS1 to LS6, B1 to B2, US1 to US12, B3 to B6, LS7 to LS12, N1 to N18 (inclusive), H1-1 to H1-12 (inclusive), and H2-1 to H2-15. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. Furthermore, these are relative terms with no basis for comparison. There is no standard in the art—or in the claim—for what constitutes LS1 to LS6, B1 to B2, US1 to US12, B3 to B6, LS7 to LS12, N1 to N18 (inclusive), H1-1 to H1-12 (inclusive), and H2-1 to H2-15, or for how they are numbered. All of those numberings are presumably inclusive but that’s not clear from the claim. A person of ordinary skill would not understand what is meant by any of those terms including because there is not stated length of the sgRNA. Furthermore, no scheme or rules for numbering the nt in those regions—and no description of how they are numbered—has been provided. Without a standard sequence or a guiding figure, the way the components are listed is arbitrary and it’s not possible to determine what’s intended or encompassed. Furthermore, Claim 1 requires that the H1 region lacks nts or that one or more of positions H1-1, H1-2, or H1-3 is deleted but how, when looking at any guideRNA, would any artisan know that anything is lacking or that those specified positions are deleted vs. a hairpin 1 region that merely comprises 4-9 nt? From the language of the claim it is not possible to say what does or doesn’t and would or wouldn’t infringe on this claim. Without any basis for comparison or numbering, the metes and bounds of the claim are indefinite. Claims 2, 34, 86-87 similarly recite that elements are lacking or deleted but provide no basis for comparison. Claims 1-2, 34, 59, and 86-87 are rejected for those reasons. Claims 2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are rejected because they depend from Claims 1-2, 34, 59, and/or 86-87 and do not remedy the issues. In the interest of compact prosecution, the claims are interpreted as requiring or lacking (as the case may be) elements of components (and numbering) shown in Fig. 1. Claims 1-2 and 87 recite various positions are deleted and/or substituted. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. There is no standard in the art—or in the claim—for what would constitute a substitution or deletion. Substituted from what to what? Deleted from what? An artisan simply could not know because there is no reference sequence for deletions and/or substitutions. For points regarding deletion, it would not be possible to determine whether a nt had been deleted, or whether the sequence simply contained a sequence lacking any of those positions. For all points reciting substitution, including points (k) through (u) in Claim 2, for any sequence, it would not be possible to determine whether a nt had been substituted, or whether the sequence simply contained a recited nt at any of those positions (e.g., a G at position H1-7 in point [k]). Claims 1-2 and 87 are rejected for those reasons. Claims 2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are rejected because they depend from Claims 1-2, and/or 87 and do not remedy the issues. In the interest of compact prosecution, the claims are interpreted as requiring or lacking (as the case may be) elements of components (and numbering) shown in Fig. 1. Since there is no reference sequence, Claim 2 cannot be examined for recitations wherein something is substituted with something else. Claim 2 recites the limitation "position n" in points (p) and (u). There is insufficient antecedent basis for this limitation in the claim because neither Claim 2 nor Claim 1 (whence Claim 2 depends) recites any position n. In the interest of compact prosecution, the claims are interpreted as requiring components and numbering shown in Fig. 1. Claim 48 recites the limitation "the modification in the hairpin region" in point (3). There is insufficient antecedent basis for this limitation in the claim because neither Claim 48 nor Claim 1 (whence Claim 48 depends) recites any modification in the hairpin region. In the interest of compact prosecution, the claims are interpreted as requiring that the hairpin region comprises at least one modified nt and/or linkage. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, and 90 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by International Publication Number WO 2018/107028, published on 14 June 2018, “WO028”, of record on IDS. WO028 is drawn to modified single and dual guide RNAs having improved in vitro and in vivo activity in gene editing methods. Regarding Claim 1: WO028 teaches Fig. 21A. Examination of that figure finds that it comprises all of the components recited in Claim 1 points (i) through (vi) and points (vii)(b)(c): PNG media_image1.png 669 1066 media_image1.png Greyscale Examination of that figure also reveals it comprises a hairpin 1 region that is H1-1 to H1-12. Regarding Claim 1 limitation (vii)(a) (i.e., wherein the hairpin 1 region lacks 6-8 nt of H1-1 to H1-12, and wherein one or more of positions H1-1, H1-2, or H1-3 is deleted), WO028 teaches (¶110-115 and ¶183) the sgRNA can comprise only H1 or H2; the hairpin regions can comprise fewer nt than what’s shown in Fig. 21A and that when it does comprise fewer nt, the modification pattern will be apparent to a skilled artisan; the hairpin regions may not be perfectly complementary; and H1 may be replaced by 1-50 nt. If H1 is replaced with 4 nt or comprises fewer nt than what’s shown in Fig. 21A, H1 would lack 6-8 nt (because H1 would either comprise fewer nt or be entirely replaced) and would have one or more of positions H1-1, H1-2, or H1-3 deleted. Therefore the sum teachings of WO028 in view of their own Fig. 21A anticipates limitations (i) through (vii) of Claim 1. Regarding the final limitation of Claim 1, namely the 5’ end or 3’ end modification, WO028 teaches (§ starting at ¶117) the sgRNA can comprise one or more modifications within the nt at the 5’ or 3’ terminus. Therefore WO028 anticipates all limitations of Claim 1. Regarding Claim 2: the preceding ¶ explained that WO028 teaches (¶110-115 and ¶183) H1 can comprise a deletion at any position. Since that § also teaches (¶114) a portion of the hairpin can comprise unpaired nt or a lack of perfect complementarity between nt, that reads on a deletion and encompasses the idea a substitution. Regarding limitation (p), WO028 teaches (¶94) the “n” between regions represents a variable number of nt. If the number between two sgRNAs varies between 3 and 2, 2 and 1, or 1 and 0, that could theoretically represent a substitution because when changing the number, the nt at position n1n2n3 would have changed. For example, reducing the number of nt between regions from three (i.e., An1Cn2Gn3) to two (i.e., Cn1Gn2) changes the nt at each position, thereby substituting C for A at position n1. Therefore WO028 anticipates limitations (a) through (j) and can be considered to anticipate the possibility of (l) through (u) of Claim 2. Note that as explained in the 112(b) rejection, limitations (k) through (u) cannot be fully examined. Regarding Claim 34, WO028 teaches (¶104-106) the upper stem region can comprise fewer nt than shown in Fig. 21A. An upper stem comprising fewer nt would in some embodiments comprise only 6 nt. Therefore WO028 anticipates Claim 34. Regarding the modifications of Claims 36, 42, 48, 58-60, and 92: WO028 teaches (¶117-150) the sgRNA can comprise one or more modifications within the lower stem region, the bulge region, the upper stem region, the nexus region, the H1 region, and the H2 region. WO028 teaches the modifications can be (¶118) 2’-OMe, 2’-F, 2’-O-MOE, and/or PS bonds. WO028 teaches (¶119) the nt in the 5’end and 3’end are modified and can be modified with 2’-OMe, 2’-F, 2’-O-MOE, and/or PS bonds. WO028 teaches the modification can be (¶145) an inverted abasic nt. WO028 teaches (¶122) each nt in the upper stem region of the sgRNA is modified with 2’-OMe. WO028 teaches (same ¶) each nt in the H1 region of the sgRNA is modified with 2’-OMe. Therefore, WO028 anticipates Claims 36, 42, 48, 58-60, and some limitations of Claim 92. Regarding Claims 39 and 41, WO028 teaches (¶116) in some embodiments, the 3’terminus region comprises 1-4 nt that are not associated with the secondary structure of the hairpin. That and Fig. 21A indicates that WO028 envisioned a 3’tail. WO028 teaches (¶116) in some embodiments, the sgRNA comprises [nt] after the hairpin region(s) [emphasis added]. That indicates that there are some embodiments wherein the sgRNA does not comprise nt after the hairpin region(s), which indicates that gRNA does not comprise a 3’tail. Therefore, WO028 anticipates Claims 39 and 41. Regarding Claim 56, WO028 teaches and shows (¶117-119, Fig. 21A) modifications in the 3’tail. Therefore WO028 anticipates Claim 56. Regarding Claim 70: WO028 teaches (¶242) LNPs may be used to deliver a nt and protein cargo and can be used to deliver the gRNA, mRNA, Cas9, and RNPs. Therefore WO028 anticipates Claim 70. Regarding Claims 71-72: WO028 teaches (¶90, ¶243) compositions comprising the gRNA and Cas9 or mRNA encoding Cas9. Therefore WO028 anticipates Claims 71-72. Regarding Claim 80, WO028 teaches (¶249) pharmaceutical formulations comprising the gRNAs and a pharmaceutically acceptable carrier. Therefore WO028 anticipates Claim 80. Regarding Claims 86-87: WO028 teaches (¶113-115) H1 can comprise fewer nt than what’s shown in Fig. 21A and the sgRNA can comprise replacement of H1 with other nt. Replacing the 12-mer H1 with a 6-mer, or entirely replacing H1, or producing an H1 that comprises fewer nt than shown in Fig. 21A would produce an H1 region lacking 6 nt of H1-1 to H1-12. W0028 teaches (¶114) the H1 region is not perfectly complementary to each other. Those teachings about an H1 with fewer nt than shown in Fig. 21A and lack of perfect complementarity encompasses H1 regions wherein any nt within H1, including H1-1, H1-12, H3, H1-10, H1-4, and/or H1-9 may be deleted. Therefore WO028 anticipates Claims 86-87. Regarding Claim 90: WO028 teaches (PDF p. 23 Table 4) an H1 region that comprises AAAAU, as shown by this modified screenshot of the table: PNG media_image2.png 52 1011 media_image2.png Greyscale Therefore WO028 anticipates Claim 90. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, and 90-92 are rejected under 35 U.S.C. 103 as being obvious over International Publication Number WO 2018/107028 (published on 14 June 2018, “WO028”, of record on IDS) as applied to Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, and 90 in the 102 rejection above and further in view of the teachings of WO028. The teachings of WO028 as applicable to Claim(s) 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, and 90 (all fully anticipated) and Claim 92 (some limitations) have been described in the 102 rejection above. WO028 teaches a gRNA comprising an sgRNA comprising all the elements in instant Claim 1. WO028 teaches a gRNA comprising 2’-OMe modifications within the H1 region. WO028 does not explicitly teach the gRNA wherein H1 region comprises the sequence CGAAAG. However, WO028 teaches an H1 region comprising AAAAAG. That sequence is shown in Fig. 21A in the 102 rejection above and in a modified excerpt of Fig. 15, shown here with mark up to illustrate the sequence within the H1 region:. PNG media_image3.png 389 872 media_image3.png Greyscale WO028 further teaches (¶113) the hairpin regions may comprise fewer nt than shown in Fig. 21A and (¶114) the hairpin regions may not be perfectly complementary to each other. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the gRNA comprising the H1 region comprising a sequence AAAAAG of WO028 with the teachings of WO028 about hairpins wherein hairpin may comprise fewer nt or wherein the loop comprises unpaired, noncomplementary nt. One would have done so for the benefit of optimizing the shape of the gRNA for any given purpose. One would have been motivated to do so with a reasonable expectation of success because WO028 teaches the hairpin may have nt deleted and may not be perfectly complementary. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides: It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions (In re Williams, 36 F.2d 436, 438 (CCPA 1929). Here, the focus is that general conditions are known in the prior art and changes in form or, possibly, substitution of equivalents, over the prior art that does the same thing as what is known in the prior art is not patentable. WO028 teaches H1 comprises a loop. It would have been obvious to an artisan to produce any H1 region that comprises a loop, and to build that loop using any suitable sequence of nt. In the instant case, and with regard to the hairpin shown in Fig. 15, an artisan would have had only to either (1) remove the nt U-U and A on the left side of the hairpin or (2) replace A-A on the right side of the hairpin with C-G to devise the claimed sequence CGAAAG. Therefore the limitations of Claim 91 would have been obvious in view of WO028. As discussed in the 102 rejection, WO028 teaches (¶117-118) a modified nt in the H1 region. Therefore the limitations of Claim 92 would have been obvious in view of WO028. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 79-80, 86-87, and 90-92 are rejected under 35 U.S.C. 103 as being obvious over International Publication Number WO 2018/107028 (published on 14 June 2018, “WO028”, of record on IDS) as applied to Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 79-80, 86-87, and 90 in the 102 and 103 rejections above and further in view of International Publication Number WO 2019/067910 (published 04 April 2019 and effectively filed on 28 September 2018, “WO910”, of record on IDS). The applied reference has a common Inventor and Applicant with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). The teachings of WO028 as applicable to Claim(s) 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, and 90-92 have been described above. WO028 teaches a gRNA comprising an sgRNA comprising all the elements in instant Claim 1. WO028 does not teach SEQ ID NO 1130 (a limitation of Claim 79). However, WO910, drawn to a Cas9 that provides improved editing efficiency, reduced immunogenicity, and/or other benefits, teaches SEQ ID NO 111 which is an mRNA encoding a Cas9 ORF. WO910 SEQ ID NO 111 has 100% identity to claimed SEQ ID NO 1130 as shown by the following alignment: BGE67323 (NOTE: this sequence has 47 duplicates in the database searched. See complete list at the end of this report) ID BGE67323 standard; DNA; 4140 BP. XX AC BGE67323; XX DT 30-MAY-2019 (first entry) XX DE Cas9 ORF sequence-1xNLS sequence, SEQ 111. XX KW CRISPR locus; CRISPR-Cas9 system; CRISPR-associated protein 9; KW Cas9 protein; KW Clustered Regularly Interspaced Short Palindromic Repeat locus; KW Genome editing; ds; gene; gene fusion; gene modification; nanotechnology. XX OS Macaca mulatta polyomavirus. OS Chimeric. OS Unidentified. XX CC PN WO2019067910-A1. XX CC PD 04-APR-2019. XX CC PF 28-SEP-2018; 2018WO-US053439. XX PR 29-SEP-2017; 2017US-0566144P. XX CC PA (INTE-) INTELLIA THERAPEUTICS INC. XX CC PI Dombrowski C, Finn JD, Smith AMR, Alexander SC; XX DR WPI; 2019-33085A/34. XX CC PT New mRNA useful in pharmaceutical composition for performing genome CC PT editing or modifying target gene, comprises open reading frame encoding CC PT RNA-guided DNA-binding agent. XX CC PS Claim 5; SEQ ID NO 111; 357pp; English. XX CC The present invention relates to a novel mRNA useful for performing CC genome editing or modifying a target gene. The mRNA comprises an open CC reading frame (ORF) encoding RNA-guided DNA-binding agent, wherein the CC ORF encodes a Cas9 nuclease of the type II CRISPR system and the RNA- CC guided DNA-binding agent comprises Cas cleavase, Cas nickase or dCas DNA CC binding domain. The invention further provides: an expression construct CC comprising a promoter operably linked to a sequence encoding the mRNA; a CC plasmid comprising the expression construct; a host cell comprising the CC expression construct or the plasmid; a method for preparing the mRNA; a CC composition comprising the mRNA and a guide RNA (gRNA); a lipid CC nanoparticle comprising the mRNA; a pharmaceutical composition comprising CC the mRNA and a carrier; and a method for genome editing or modifying the CC target gene, by contacting the cell with the mRNA, expression construct, CC composition or lipid nanoparticle. The present sequence represents a Cas9 CC ORF sequence comprising a Simian virus 40 (SV40) nuclear localization CC signal (1xNLS) at the C-terminal end, which is used in the invention for CC preparing the novel mRNA for performing genome editing or modifying a CC target gene. XX SQ Sequence 4140 BP; 975 A; 1332 C; 1228 G; 605 T; 0 U; 0 Other; Query Match 100.0%; Score 4140; Length 4140; Best Local Similarity 100.0%; Matches 4140; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 Qy 61 ATCACCGACGAGTACAAGGTGCCCTCCAAGAAGTTCAAGGTGCTGGGCAACACCGACCGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ATCACCGACGAGTACAAGGTGCCCTCCAAGAAGTTCAAGGTGCTGGGCAACACCGACCGG 120 Qy 121 CACTCCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGACTCCGGCGAGACCGCCGAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CACTCCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGACTCCGGCGAGACCGCCGAG 180 Qy 181 GCCACCCGGCTGAAGCGGACCGCCCGGCGGCGGTACACCCGGCGGAAGAACCGGATCTGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GCCACCCGGCTGAAGCGGACCGCCCGGCGGCGGTACACCCGGCGGAAGAACCGGATCTGC 240 Qy 241 TACCTGCAGGAGATCTTCTCCAACGAGATGGCCAAGGTGGACGACTCCTTCTTCCACCGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TACCTGCAGGAGATCTTCTCCAACGAGATGGCCAAGGTGGACGACTCCTTCTTCCACCGG 300 Qy 301 CTGGAGGAGTCCTTCCTGGTGGAGGAGGACAAGAAGCACGAGCGGCACCCCATCTTCGGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTGGAGGAGTCCTTCCTGGTGGAGGAGGACAAGAAGCACGAGCGGCACCCCATCTTCGGC 360 Qy 361 AACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGCGGAAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGCGGAAG 420 Qy 421 AAGCTGGTGGACTCCACCGACAAGGCCGACCTGCGGCTGATCTACCTGGCCCTGGCCCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAGCTGGTGGACTCCACCGACAAGGCCGACCTGCGGCTGATCTACCTGGCCCTGGCCCAC 480 Qy 481 ATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACTCCGAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 ATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACTCCGAC 540 Qy 541 GTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAGAACCCC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAGAACCCC 600 Qy 601 ATCAACGCCTCCGGCGTGGACGCCAAGGCCATCCTGTCCGCCCGGCTGTCCAAGTCCCGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ATCAACGCCTCCGGCGTGGACGCCAAGGCCATCCTGTCCGCCCGGCTGTCCAAGTCCCGG 660 Qy 661 CGGCTGGAGAACCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAACGGCCTGTTCGGCAAC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CGGCTGGAGAACCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAACGGCCTGTTCGGCAAC 720 Qy 721 CTGATCGCCCTGTCCCTGGGCCTGACCCCCAACTTCAAGTCCAACTTCGACCTGGCCGAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CTGATCGCCCTGTCCCTGGGCCTGACCCCCAACTTCAAGTCCAACTTCGACCTGGCCGAG 780 Qy 781 GACGCCAAGCTGCAGCTGTCCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GACGCCAAGCTGCAGCTGTCCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCC 840 Qy 841 CAGATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGTCCGACGCCATC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CAGATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGTCCGACGCCATC 900 Qy 901 CTGCTGTCCGACATCCTGCGGGTGAACACCGAGATCACCAAGGCCCCCCTGTCCGCCTCC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CTGCTGTCCGACATCCTGCGGGTGAACACCGAGATCACCAAGGCCCCCCTGTCCGCCTCC 960 Qy 961 ATGATCAAGCGGTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGCGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATGATCAAGCGGTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGCGG 1020 Qy 1021 CAGCAGCTGCCCGAGAAGTACAAGGAGATCTTCTTCGACCAGTCCAAGAACGGCTACGCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CAGCAGCTGCCCGAGAAGTACAAGGAGATCTTCTTCGACCAGTCCAAGAACGGCTACGCC 1080 Qy 1081 GGCTACATCGACGGCGGCGCCTCCCAGGAGGAGTTCTACAAGTTCATCAAGCCCATCCTG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GGCTACATCGACGGCGGCGCCTCCCAGGAGGAGTTCTACAAGTTCATCAAGCCCATCCTG 1140 Qy 1141 GAGAAGATGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACCGGGAGGACCTGCTGCGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAGAAGATGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACCGGGAGGACCTGCTGCGG 1200 Qy 1201 AAGCAGCGGACCTTCGACAACGGCTCCATCCCCCACCAGATCCACCTGGGCGAGCTGCAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AAGCAGCGGACCTTCGACAACGGCTCCATCCCCCACCAGATCCACCTGGGCGAGCTGCAC 1260 Qy 1261 GCCATCCTGCGGCGGCAGGAGGACTTCTACCCCTTCCTGAAGGACAACCGGGAGAAGATC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCCATCCTGCGGCGGCAGGAGGACTTCTACCCCTTCCTGAAGGACAACCGGGAGAAGATC 1320 Qy 1321 GAGAAGATCCTGACCTTCCGGATCCCCTACTACGTGGGCCCCCTGGCCCGGGGCAACTCC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 GAGAAGATCCTGACCTTCCGGATCCCCTACTACGTGGGCCCCCTGGCCCGGGGCAACTCC 1380 Qy 1381 CGGTTCGCCTGGATGACCCGGAAGTCCGAGGAGACCATCACCCCCTGGAACTTCGAGGAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CGGTTCGCCTGGATGACCCGGAAGTCCGAGGAGACCATCACCCCCTGGAACTTCGAGGAG 1440 Qy 1441 GTGGTGGACAAGGGCGCCTCCGCCCAGTCCTTCATCGAGCGGATGACCAACTTCGACAAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GTGGTGGACAAGGGCGCCTCCGCCCAGTCCTTCATCGAGCGGATGACCAACTTCGACAAG 1500 Qy 1501 AACCTGCCCAACGAGAAGGTGCTGCCCAAGCACTCCCTGCTGTACGAGTACTTCACCGTG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 AACCTGCCCAACGAGAAGGTGCTGCCCAAGCACTCCCTGCTGTACGAGTACTTCACCGTG 1560 Qy 1561 TACAACGAGCTGACCAAGGTGAAGTACGTGACCGAGGGCATGCGGAAGCCCGCCTTCCTG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TACAACGAGCTGACCAAGGTGAAGTACGTGACCGAGGGCATGCGGAAGCCCGCCTTCCTG 1620 Qy 1621 TCCGGCGAGCAGAAGAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAGGTGACC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TCCGGCGAGCAGAAGAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAGGTGACC 1680 Qy 1681 GTGAAGCAGCTGAAGGAGGACTACTTCAAGAAGATCGAGTGCTTCGACTCCGTGGAGATC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GTGAAGCAGCTGAAGGAGGACTACTTCAAGAAGATCGAGTGCTTCGACTCCGTGGAGATC 1740 Qy 1741 TCCGGCGTGGAGGACCGGTTCAACGCCTCCCTGGGCACCTACCACGACCTGCTGAAGATC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 TCCGGCGTGGAGGACCGGTTCAACGCCTCCCTGGGCACCTACCACGACCTGCTGAAGATC 1800 Qy 1801 ATCAAGGACAAGGACTTCCTGGACAACGAGGAGAACGAGGACATCCTGGAGGACATCGTG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 ATCAAGGACAAGGACTTCCTGGACAACGAGGAGAACGAGGACATCCTGGAGGACATCGTG 1860 Qy 1861 CTGACCCTGACCCTGTTCGAGGACCGGGAGATGATCGAGGAGCGGCTGAAGACCTACGCC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CTGACCCTGACCCTGTTCGAGGACCGGGAGATGATCGAGGAGCGGCTGAAGACCTACGCC 1920 Qy 1921 CACCTGTTCGACGACAAGGTGATGAAGCAGCTGAAGCGGCGGCGGTACACCGGCTGGGGC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CACCTGTTCGACGACAAGGTGATGAAGCAGCTGAAGCGGCGGCGGTACACCGGCTGGGGC 1980 Qy 1981 CGGCTGTCCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACCATCCTG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 CGGCTGTCCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACCATCCTG 2040 Qy 2041 GACTTCCTGAAGTCCGACGGCTTCGCCAACCGGAACTTCATGCAGCTGATCCACGACGAC 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GACTTCCTGAAGTCCGACGGCTTCGCCAACCGGAACTTCATGCAGCTGATCCACGACGAC 2100 Qy 2101 TCCCTGACCTTCAAGGAGGACATCCAGAAGGCCCAGGTGTCCGGCCAGGGCGACTCCCTG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 TCCCTGACCTTCAAGGAGGACATCCAGAAGGCCCAGGTGTCCGGCCAGGGCGACTCCCTG 2160 Qy 2161 CACGAGCACATCGCCAACCTGGCCGGCTCCCCCGCCATCAAGAAGGGCATCCTGCAGACC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 CACGAGCACATCGCCAACCTGGCCGGCTCCCCCGCCATCAAGAAGGGCATCCTGCAGACC 2220 Qy 2221 GTGAAGGTGGTGGACGAGCTGGTGAAGGTGATGGGCCGGCACAAGCCCGAGAACATCGTG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 GTGAAGGTGGTGGACGAGCTGGTGAAGGTGATGGGCCGGCACAAGCCCGAGAACATCGTG 2280 Qy 2281 ATCGAGATGGCCCGGGAGAACCAGACCACCCAGAAGGGCCAGAAGAACTCCCGGGAGCGG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 ATCGAGATGGCCCGGGAGAACCAGACCACCCAGAAGGGCCAGAAGAACTCCCGGGAGCGG 2340 Qy 2341 ATGAAGCGGATCGAGGAGGGCATCAAGGAGCTGGGCTCCCAGATCCTGAAGGAGCACCCC 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 ATGAAGCGGATCGAGGAGGGCATCAAGGAGCTGGGCTCCCAGATCCTGAAGGAGCACCCC 2400 Qy 2401 GTGGAGAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAACGGCCGG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GTGGAGAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAACGGCCGG 2460 Qy 2461 GACATGTACGTGGACCAGGAGCTGGACATCAACCGGCTGTCCGACTACGACGTGGACCAC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 GACATGTACGTGGACCAGGAGCTGGACATCAACCGGCTGTCCGACTACGACGTGGACCAC 2520 Qy 2521 ATCGTGCCCCAGTCCTTCCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCCGGTCC 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 ATCGTGCCCCAGTCCTTCCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCCGGTCC 2580 Qy 2581 GACAAGAACCGGGGCAAGTCCGACAACGTGCCCTCCGAGGAGGTGGTGAAGAAGATGAAG 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 GACAAGAACCGGGGCAAGTCCGACAACGTGCCCTCCGAGGAGGTGGTGAAGAAGATGAAG 2640 Qy 2641 AACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATCACCCAGCGGAAGTTCGACAACCTG 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 AACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATCACCCAGCGGAAGTTCGACAACCTG 2700 Qy 2701 ACCAAGGCCGAGCGGGGCGGCCTGTCCGAGCTGGACAAGGCCGGCTTCATCAAGCGGCAG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 ACCAAGGCCGAGCGGGGCGGCCTGTCCGAGCTGGACAAGGCCGGCTTCATCAAGCGGCAG 2760 Qy 2761 CTGGTGGAGACCCGGCAGATCACCAAGCACGTGGCCCAGATCCTGGACTCCCGGATGAAC 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 CTGGTGGAGACCCGGCAGATCACCAAGCACGTGGCCCAGATCCTGGACTCCCGGATGAAC 2820 Qy 2821 ACCAAGTACGACGAGAACGACAAGCTGATCCGGGAGGTGAAGGTGATCACCCTGAAGTCC 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 ACCAAGTACGACGAGAACGACAAGCTGATCCGGGAGGTGAAGGTGATCACCCTGAAGTCC 2880 Qy 2881 AAGCTGGTGTCCGACTTCCGGAAGGACTTCCAGTTCTACAAGGTGCGGGAGATCAACAAC 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 AAGCTGGTGTCCGACTTCCGGAAGGACTTCCAGTTCTACAAGGTGCGGGAGATCAACAAC 2940 Qy 2941 TACCACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCTGATCAAGAAG 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 TACCACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCTGATCAAGAAG 3000 Qy 3001 TACCCCAAGCTGGAGTCCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAG 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 TACCCCAAGCTGGAGTCCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAG 3060 Qy 3061 ATGATCGCCAAGTCCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTCTACTCC 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 ATGATCGCCAAGTCCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTCTACTCC 3120 Qy 3121 AACATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCCGGAAGCGG 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 AACATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCCGGAAGCGG 3180 Qy 3181 CCCCTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCCGGGACTTC 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 CCCCTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCCGGGACTTC 3240 Qy 3241 GCCACCGTGCGGAAGGTGCTGTCCATGCCCCAGGTGAACATCGTGAAGAAGACCGAGGTG 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 GCCACCGTGCGGAAGGTGCTGTCCATGCCCCAGGTGAACATCGTGAAGAAGACCGAGGTG 3300 Qy 3301 CAGACCGGCGGCTTCTCCAAGGAGTCCATCCTGCCCAAGCGGAACTCCGACAAGCTGATC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 CAGACCGGCGGCTTCTCCAAGGAGTCCATCCTGCCCAAGCGGAACTCCGACAAGCTGATC 3360 Qy 3361 GCCCGGAAGAAGGACTGGGACCCCAAGAAGTACGGCGGCTTCGACTCCCCCACCGTGGCC 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 GCCCGGAAGAAGGACTGGGACCCCAAGAAGTACGGCGGCTTCGACTCCCCCACCGTGGCC 3420 Qy 3421 TACTCCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGTCCAAGAAGCTGAAGTCCGTG 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 TACTCCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGTCCAAGAAGCTGAAGTCCGTG 3480 Qy 3481 AAGGAGCTGCTGGGCATCACCATCATGGAGCGGTCCTCCTTCGAGAAGAACCCCATCGAC 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 AAGGAGCTGCTGGGCATCACCATCATGGAGCGGTCCTCCTTCGAGAAGAACCCCATCGAC 3540 Qy 3541 TTCCTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATCAAGCTGCCCAAG 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 TTCCTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATCAAGCTGCCCAAG 3600 Qy 3601 TACTCCCTGTTCGAGCTGGAGAACGGCCGGAAGCGGATGCTGGCCTCCGCCGGCGAGCTG 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 TACTCCCTGTTCGAGCTGGAGAACGGCCGGAAGCGGATGCTGGCCTCCGCCGGCGAGCTG 3660 Qy 3661 CAGAAGGGCAACGAGCTGGCCCTGCCCTCCAAGTACGTGAACTTCCTGTACCTGGCCTCC 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 CAGAAGGGCAACGAGCTGGCCCTGCCCTCCAAGTACGTGAACTTCCTGTACCTGGCCTCC 3720 Qy 3721 CACTACGAGAAGCTGAAGGGCTCCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAG 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 CACTACGAGAAGCTGAAGGGCTCCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAG 3780 Qy 3781 CAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCTCCGAGTTCTCCAAGCGGGTG 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3781 CAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCTCCGAGTTCTCCAAGCGGGTG 3840 Qy 3841 ATCCTGGCCGACGCCAACCTGGACAAGGTGCTGTCCGCCTACAACAAGCACCGGGACAAG 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3841 ATCCTGGCCGACGCCAACCTGGACAAGGTGCTGTCCGCCTACAACAAGCACCGGGACAAG 3900 Qy 3901 CCCATCCGGGAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCC 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3901 CCCATCCGGGAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCC 3960 Qy 3961 CCCGCCGCCTTCAAGTACTTCGACACCACCATCGACCGGAAGCGGTACACCTCCACCAAG 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3961 CCCGCCGCCTTCAAGTACTTCGACACCACCATCGACCGGAAGCGGTACACCTCCACCAAG 4020 Qy 4021 GAGGTGCTGGACGCCACCCTGATCCACCAGTCCATCACCGGCCTGTACGAGACCCGGATC 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4021 GAGGTGCTGGACGCCACCCTGATCCACCAGTCCATCACCGGCCTGTACGAGACCCGGATC 4080 Qy 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the composition comprising the sgRNA and mRNA encoding a Cas9 nuclease of WO028 with the Cas9 encoded by WO910 SEQ ID NO 111 of WO910 for the benefit of improving editing efficiency and reducing immunogenicity. One would have been motivated to do so with a reasonable expectation of success because WO910 teaches their polynucleotides encoding Cas9 improve editing efficiency and reduce immunogenicity. An artisan would have used any sequence encoding a nuclease in the invention of WO028. Modifying the composition of WO028 with the Cas9 of WO910 would have produced the limitations of Claim 79. This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Note: The claims are directed to a guide RNA that comprises elements known in the prior art (as discussed in the 102 rejection). Therefore ANY and ALL of Applicant’s issued patents or copending applications whose claims recite any guide RNA (gRNA) are subject to an NSDP rejection over either the patented/copending claims or the patented/copending claims in view of WO028. Because the time for examination is limited, only some of those patents/copending applications are explicitly rejected in the following. Since there are no laboratories at the USPTO, the burden is on Applicant to demonstrate that the patented or copending gRNAs do not or cannot possess the claimed structure as the instantly claimed gRNA. (Or to narrow the instant claims.) Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, 90-92 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims in the following issued patents in view of International Patent Application Publication No. WO 2018/107028 (published on 14 June 2018, “WO028”, of record on IDS). Patents whose claims recite a guide RNA (gRNA) or any gRNA: Pat. # Claims US 11466271 All claims that recite gRNA US 11479767 All claims that recite gRNA US 11549107 All claims that recite gRNA US 11795460 All claims that recited gRNA US 11851659 All claims that recited gRNA US 11965165 All claims that recited gRNA US 12037583 All claims that recited gRNA US 12077483 18 US 12173284 All claims that recited gRNA US 12214023 All claims that recited gRNA US 12460205 All claims that recited gRNA Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a single gRNA comprising upper and lower stem regions, a bulge region, a nexus region, a nt, and two hairpin regions, wherein either the 5’ end, 3’ end, or both ends are modified; wherein the gRNA can comprise nt modification(s), including in certain region(s); wherein the gRNA can comprise any of a number of SEQ ID NOs recited in Claims 61-62; wherein the gRNA is associated with an LNP; wherein the gRNA can be in a composition further comprising a nuclease or a nucleic acid encoding a nuclease, wherein the nuclease can be a Cas protein, wherein the nucleic acid encoding the nuclease can be SEQ ID NO 1130; wherein the gRNA’s hairpin region 1 can comprise any sequence recited in Claims 90-91. The patented claims at least one gRNA as part of the invention. US767 and US284 claims recite some of the same features as the instant claims: an upper stem that can be US1-US12, a lower stem comprising LS1-LS12, a bulge, a nexus N1-N18, two hairpin regions H1-1–H1-12 and H2-1–H2-15, modifications in those regions, modifications at the 3’ and 5’ends. It is not possible to determine whether each gRNA in each of the patented claim sets comprises all the structures of the claimed gRNA. Each of the patented claim sets doesn’t necessarily recite a gRNA that comprises all the components of the claimed gRNA. However, WO028 teaches (Fig. 21) such a gRNA, that (¶117-151) it can comprise modifications at the 5’ and/or 3’ ends, and (¶110-115, ¶117-120 and ¶183) it is acceptable to shorten, replace, or modify the H1 region. WO028 teaches (§Abstract) their gRNA has improved in vitro and in vivo activity, including in gene editing methods. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention modify the invention of the patented claims by using the gRNA structure of WO028 and one would have been motivated to do so with a reasonable expectation of success because the patented claims are directed to compositions or methods (including methods for gene editing) that comprise gRNA, and WO028 teaches their gRNA structure has improved activity, including in gene editing methods. An artisan would have wanted to improve gRNA’s in vitro and in vivo activity, and it would have been a simple matter to swap the gRNA structure of WO028 for the gRNA of the patented claims and in doing so, they would have produced the instant claims. Therefore the instant claims would have been obvious in view of the patented claims (as indicated in the table above) and WO028. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 80, 86-87, 90-92 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims in the following copending applications in view of International Patent Application Publication No. WO 2018/107028 (published on 14 June 2018, “WO028”, of record on IDS). Copending applications whose claims recite a guide RNA (gRNA) or any gRNA: Copending App# Claims 16651911 All claims that recite gRNA 16657967 All claims that recite gRNA 17231556 Claims that recite gRNA ****Note: a notice of allowance has been mailed in this application. Once the patent issues this rejection will convert to a nonprovisional rejection. That will not be considered a new grounds of rejection**** 17735929 All claims that recite gRNA 17808802 Claims that recite gRNA ****Note: a notice of allowance has been mailed in this application. Once the patent issues this rejection will convert to a nonprovisional rejection. That will not be considered a new grounds of rejection**** 17897878 All claims that recite gRNA 17965366 All claims that recite gRNA 18050333 All claims that recite gRNA 18287227 All claims that recite gRNA 18287239 All claims that recite gRNA 18332335 All claims that recite gRNA 18332390 All claims that recite gRNA 18366051 All claims that recite gRNA 18366064 All claims that recite gRNA 18366117 All claims that recite gRNA 18415032 All claims that recite gRNA 18486393 All claims that recite gRNA 18534209 All claims that recite gRNA 18572155 All claims that recite gRNA 18585231 All claims that recite gRNA 18652180 All claims that recite gRNA 18700487 All claims that recite gRNA: 109-110, 112 18940080 All claims that recite gRNA 18980502 All claims that recite gRNA: 2, 11-12, 14, 21, 25, 29, 31, 35, 45, 48, 50, 62, 65, 67 18980462 All claims that recite gRNA 18941127 All claims that recite gRNA 18992548 All claims that recite gRNA 19066800 All claims that recite gRNA 19140782 All claims that recite gRNA 19174328 All claims that recite gRNA 19210426 All claims that recite gRNA 19246289 All claims that recite gRNA 19256778 All claims that recite gRNA 19327529 All claims that recite gRNA 19331096 All claims that recite gRNA 19353412 All claims that recite gRNA 19354595 All claims that recite gRNA 19357943 All claims that recite gRNA 19364537 All claims that recite gRNA 19377478 All claims that recite gRNA 19484700 All claims that recite gRNA 19485395 All claims that recite gRNA 19492619 All claims that recite gRNA Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a single gRNA comprising upper and lower stem regions, a bulge region, a nexus region, a nt, and two hairpin regions, wherein either the 5’ end, 3’ end, or both ends are modified; wherein the gRNA can comprise nt modification(s), including in certain region(s); wherein the gRNA can comprise any of a number of SEQ ID NOs recited in Claims 61-62; wherein the gRNA is associated with an LNP; wherein the gRNA can be in a composition further comprising a nuclease or a nucleic acid encoding a nuclease, wherein the nuclease can be a Cas protein, wherein the nucleic acid encoding the nuclease can be SEQ ID NO 1130; wherein the gRNA’s hairpin region 1 can comprise any sequence recited in Claims 90-91. The copending claims recite at least one gRNA as part of the invention. Some of the copending gRNAs comprise many of the structures recited in the instant claims: an upper stem that can be US1-US12, a lower stem comprising LS1-LS12, a bulge, a nexus N1-N18, two hairpin regions H1-1–H1-12 and H2-1–H2-15, modifications in those regions, modifications at the 3’ and 5’ends. It is not possible to determine whether each gRNA in each of the copending claim sets comprises all the structures of the claimed gRNA. Each of the copending claim sets doesn’t necessarily recite a gRNA that comprises all the components of the claimed gRNA. However, WO028 teaches (Fig. 21) such a gRNA, that (¶117-151) it can comprise modifications at the 5’ and/or 3’ ends, and (¶110-115, ¶117-120 and ¶183) it is acceptable to shorten, replace, or modify the H1 region. WO028 teaches (§Abstract) their gRNA has improved in vitro and in vivo activity, including in gene editing methods. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the copending claims by using the gRNA structure of WO028 and one would have been motivated to do so with a reasonable expectation of success because the copending claims are directed to compositions or methods (including methods for gene editing) that comprise gRNA, and WO028 teaches their gRNA structure has improved activity, including in gene editing methods. An artisan would have wanted to improve any gRNA’s in vitro and in vivo activity, and it would have been a simple matter to swap the gRNA structure of WO028 for the gRNA of the copending claims and in doing so, they would have produced the instant claims. Therefore the instant claims would have been obvious in view of the copending claims (as indicated in the table above) and WO028. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 79-80, 86-87, 90-92 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following U.S. Patents in view of International Patent Application Publication No. WO 2018/107028 (published on 14 June 2018, “WO028”, of record on IDS). Patents whose claims recite a guide RNA (gRNA) or any gRNA and claim a nuclease comprising a sequence that is the same as SEQ ID NO 1130: Pat. # Claims Same as Claimed SEQ ID NO 1130 (at least the following SEQ ID NO) 11697806 1-26 SEQ ID NO 111, 114, or 117, or sequences at least 98% identical thereto (Claim 1) 12480109 (App 19028692) All claims that recite gRNA SEQ ID NO 516 (Claim 15) Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a single gRNA comprising upper and lower stem regions, a bulge region, a nexus region, a nt, and two hairpin regions, wherein either the 5’ end, 3’ end, or both ends are modified; wherein the gRNA can comprise nt modification(s), including in certain region(s); wherein the gRNA can comprise any of a number of SEQ ID NOs recited in Claims 61-62; wherein the gRNA is associated with an LNP; wherein the gRNA can be in a composition further comprising a nuclease or a nucleic acid encoding a nuclease, wherein the nuclease can be a Cas protein, wherein the nucleic acid encoding the nuclease can be SEQ ID NO 1130; wherein the gRNA’s hairpin region 1 can comprise any sequence recited in Claims 90-91. The patented claims are directed to mRNA encoding a nuclease that comprise(s) identity to claimed SEQ ID NO 1130; and a gRNA, and methods of using the mRNA for genome editing. Both claim sets are directed to RNA encoding identical nucleases, as shown by the following exemplary sequence alignment: US-16-828-615A-111 Sequence 111, US/16828615A Patent No. 11697806 GENERAL INFORMATION APPLICANT: INTELLIA THERAPEUTICS, INC. TITLE OF INVENTION: POLYNUCLEOTIDES, COMPOSITIONS, AND METHODS FOR GENOME EDITING FILE REFERENCE: 01155-0020-00US CURRENT APPLICATION NUMBER: US/16/828,615A CURRENT FILING DATE: 2020-03-24 PRIOR APPLICATION NUMBER: PCT/US2018/053439 PRIOR FILING DATE: 2018-09-28 PRIOR APPLICATION NUMBER: US 62/566,144 PRIOR FILING DATE: 2017-09-29 NUMBER OF SEQ ID NOS: 198 SEQ ID NO 111 LENGTH: 4140 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic: Cas9 ORF using low A codons of Table 4, with start and stop codons Query Match 100.0%; Score 4140; Length 4140; Best Local Similarity 100.0%; Matches 4140; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 SEQ ID NO 1130 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 SEQ ID NO 111 [truncated for brevity] Qy 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 The patented claims don’t teach a gRNA that comprises all the components of the claimed gRNA but WO028 teaches (Fig. 21) such a gRNA, that (¶117-151) can comprise modifications at the 5’ and/or 3’ ends, and (¶110-115, ¶117-120 and ¶183) it is acceptable to shorten, replace, or modify the H1 region. WO028 teaches (§Abstract) their gRNA has improved in vitro and in vivo activity, including in gene editing methods. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the patented claims with the gRNA structure of WO028 and one would have been motivated to do so with a reasonable expectation of success because the US806 claims are directed to gene editing and WO028 teaches their gRNA structure has improved activity, including in gene editing methods. An artisan would have wanted to improve gRNA’s in vitro and in vivo activity, and it would have been a simple matter to swap the gRNA structure of WO028 for the gRNA of the copending claims and in doing so, they would have produced the instant claims. Therefore the instant claims would have been obvious in view of the patented claims and WO028. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-60, 70-72, 79-80, 86-87, 90-92 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 14, 101-123, 125-134 of copending Application No. 18132278 (App278) in view of International Patent Application Publication No. WO 2018/107028 (published on 14 June 2018, “WO028”, of record on IDS). Copending applications whose claims recite a guide RNA (gRNA) or any gRNA and claim a nuclease comprising a sequence that is the same as SEQ ID NO 1130: Copending App# Claims Same as Claimed SEQ ID NO 1130 (at least the following SEQ ID NO/claim) 18132278 14, 101-123, 125-134 111 (Claim 14) 19439064 1-98 111 (Claim 5) 19295369 All claims that recite gRNA 311 (Claim 1) 17111769 All claims that recite gRNA 3530 (Claim 469) 18362867 All claims that recite gRNA 311, 377 (Claims 2, 33) 18980643 All claims that recite gRNA 295 (Claim 18, 51) 18652176 All claims that recite gRNA 662 (Claim 147) Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a single gRNA comprising upper and lower stem regions, a bulge region, a nexus region, a nt, and two hairpin regions, wherein either the 5’ end, 3’ end, or both ends are modified; wherein the gRNA can comprise nt modification(s), including in certain region(s); wherein the gRNA can comprise any of a number of SEQ ID NOs recited in Claims 61-62; wherein the gRNA is associated with an LNP; wherein the gRNA can be in a composition further comprising a nuclease or a nucleic acid encoding a nuclease, wherein the nuclease can be a Cas protein, wherein the nucleic acid encoding the nuclease can be SEQ ID NO 1130; wherein the gRNA’s hairpin region 1 can comprise any sequence recited in Claims 90-91. The copending claims are directed to compositions comprising an mRNA encoding a nuclease that comprises SEQ ID NO(s) that are identical to the claimed nuclease of SEQ ID NO 1130, or sequences at least 98% or 90% identical thereto; and a gRNA, and methods of using the compositions or mRNA for genome editing, and additional components. Both the instant and copending claim sets are directed to RNA encoding identical nucleases, as shown by the following exemplary sequence alignment: Query Match 100.0%; Score 4140; Length 4140; Best Local Similarity 100.0%; Matches 4140; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 SEQ ID NO 1130 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 SEQ ID NO 111 [truncated for brevity] Qy 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 The copending claim sets don’t teach a gRNA that comprises all the components of the claimed gRNA but WO028 teaches (Fig. 21) such a gRNA, that (¶117-151) can comprise modifications at the 5’ and/or 3’ ends, and (¶110-115, ¶117-120 and ¶183) it is acceptable to shorten, replace, or modify the H1 region. WO028 teaches (§Abstract) their gRNA has improved in vitro and in vivo activity, including in gene editing methods. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the copending claims with the gRNA structure of WO028 and one would have been motivated to do so with a reasonable expectation of success because the copending claims are directed to gene editing and WO028 teaches their gRNA structure has improved activity, including in gene editing methods. An artisan would have wanted to improve in vitro and in vivo activity, and it would have been a simple matter to swap the gRNA structure of WO028 for the gRNA of the copending claims and in doing so, they would have produced the instant claims. Therefore the instant claims would have been obvious in view of the copending claims as indicated in the table above, and WO028. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 79-80, 86-92 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending Application Nos. Copending applications whose claims recite a guide RNA (gRNA) comprising a sequence that is the same as SEQ ID NO 281 and a nuclease comprising a sequence that is the same as SEQ ID NO 1130: Copending App# Claims Same as Claimed SEQ ID NO 281 (at least the following SEQ ID NO) Same as Claimed SEQ ID NO 1130 (at least the following SEQ ID NO) 19241998 31, 33, 36-37, 40, 42, 45-47, 50-51, 53, 55, 59-63, 71-80 166 (Claim 74) 104 (Claim 33) 19242255 1-2, 12-17, 19, 21, 24-25, 32-33, 35-36, 41, 55-56 309 (Claim 1) 1003 (Claim 21) 18532127 All claims that recite gRNA 9-10, 14, 63-64, 70-71, 109-110, 114, 163-164, 170-171, 201 (at least Claim 32-33) 322 (Claim 156) 19242255 All claims that recite gRNA 221, 309, 512 (Claims 1, 13, 15) 1003 (Claim 21) Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a single gRNA comprising upper and lower stem regions, a bulge region, a nexus region, a nt, and two hairpin regions, wherein either the 5’ end, 3’ end, or both ends are modified; wherein the gRNA can comprise nt modification(s), including in certain region(s); wherein the gRNA can comprise any of a number of SEQ ID NOs recited in Claims 61-62; wherein the gRNA is associated with an LNP; wherein the gRNA can be in a composition further comprising a nuclease or a nucleic acid encoding a nuclease, wherein the nuclease can be a Cas protein, wherein the nucleic acid encoding the nuclease can be SEQ ID NO 1130; wherein the gRNA’s hairpin region 1 can comprise any sequence recited in Claims 90-91. The copending claims are directed to compositions that comprise gRNAs that comprise all of those same regions and features (e.g. because at least one copending claim recites at least one SEQ ID NO that is identical to or comprises instantly claimed SEQ ID NO 281) and an identical nuclease (e.g. because at least one copending claim recites at least one SEQ ID NO that is identical to or comprises instantly claimed SEQ ID NO 1130). Note that there are more overlapping sequences but the two elected SEQ ID NOs are highlighted here. Both the copending and instant claim sets are directed to gRNA comprising instant SEQ ID NO 281 and nuclease comprising instant SEQ ID NO 1130, as shown by the following alignments: ALIGNMENT: Query Match 100.0%; Score 70; Length 70; Best Local Similarity 77.1%; Matches 54; Conservative 16; Mismatches 0; Indels 0; Gaps 0; Qy 1 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACC 60 SEQ ID NO 281 |::::|||||:|||||:||||||::||||:|||||:||:|||::|:|||||||||||||| Db 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCACGAAAGGGCACC 60 copend. gRNA SEQ Qy 61 GAGUCGGUGC 70 |||:|||:|| Db 61 GAGTCGGTGC 70 ALIGNMENT: Query Match 100.0%; Score 4140; Length 4140; Best Local Similarity 100.0%; Matches 4140; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 SEQ ID NO 1130 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTG 60 copend. nucl. SEQ [truncated for brevity] Qy 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 GACCTGTCCCAGCTGGGCGGCGACGGCGGCGGCTCCCCCAAGAAGAAGCGGAAGGTGTGA 4140 SEQ ID NO 281 and each of the copending SEQ ID NOs listed in the table comprise identical sequences so they also possess all the same structures recited in the instant claims. SEQ ID NO 1130 and each of the copending SEQ ID NOs listed in the table comprise identical sequences so they also possess all the same structures recited in the instant claims. Therefore the copending claims inherently read on the instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1-2, 34, 36, 39, 41-42, 48, 56, 58-62, 70-72, 80, 86-92 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending Application Nos. Copending applications whose claims recite a guide RNA (gRNA) comprising a sequence that is the same as SEQ ID NO 281: Copending App# Claims Same as Claimed SEQ ID NO 281 (at least the following SEQ ID NO) 18706899 35, 37, 40 414 (Claim 40) 18339665 All claims that recite gRNA 1016 (Claim 82) 18339930 All claims that recite gRNA 1008 (Claim 59) 19241998 All claims that recite gRNA 166-167, 176-177, 186-191, 193-194 (Claim 74) Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a single gRNA comprising upper and lower stem regions, a bulge region, a nexus region, a nt, and two hairpin regions, wherein either the 5’ end, 3’ end, or both ends are modified; wherein the gRNA can comprise nt modification(s), including in certain region(s); wherein the gRNA can comprise any of a number of SEQ ID NOs recited in Claims 61-62; wherein the gRNA is associated with an LNP; wherein the gRNA can be in a composition further comprising a nuclease or a nucleic acid encoding a nuclease, wherein the nuclease can be a Cas protein, wherein the nucleic acid encoding the nuclease can be SEQ ID NO 1130; wherein the gRNA’s hairpin region 1 can comprise any sequence recited in Claims 90-91. The copending claims are directed to compositions or methods that comprise gRNAs that comprise all of those same regions and features (e.g. because at least one copending App claim recites at least one SEQ ID NO that is identical to or comprises instantly claimed SEQ ID NO 281). Note that there are or can be more overlapping sequences but the elected gRNA SEQ ID NO is highlighted here. Both the copending and instant claim sets are directed to gRNA comprising instant SEQ ID NO 281, as shown by the following alignment: ALIGNMENT: Query Match 100.0%; Score 70; Length 70; Best Local Similarity 77.1%; Matches 54; Conservative 16; Mismatches 0; Indels 0; Gaps 0; Qy 1 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACC 60 SEQ ID NO 281 |::::|||||:|||||:||||||::||||:|||||:||:|||::|:|||||||||||||| Db 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCACGAAAGGGCACC 60 copend. gRNA SEQ Qy 61 GAGUCGGUGC 70 |||:|||:|| Db 61 GAGTCGGTGC 70 SEQ ID NO 281 and each of the copending claimed SEQ ID NOs listed in the table comprise identical sequences so they also possess all the same structures recited in the instant claims. Therefore the copending claims inherently read on the instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The following copending applications have no claims filed so it is not possible to determine whether the claims overlap. If claims are later determined to have overlapping subject matter, rejections over the following applications will not prevent the next Office action from being final: 18878817 19162685 19133138 19131555. Sequence(s) Free of the Prior Art of Record The following sequences were searched and found to be free of the prior art of record: guide RNA sequences as described above. See above (the table in §Restriction) for an explanation of sequences that were found free of the prior art of record. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. RUTHIE S ARIETI Examiner (Ruth.Arieti@uspto.gov) Art Unit 1635 /RUTH SOPHIA ARIETI/Examiner, Art Unit 1635 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jun 09, 2022
Application Filed
Jan 23, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594349
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Apr 07, 2026
Patent 12584134
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 24, 2026
Patent 12540324
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12540326
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12534728
RNAi Agents for Inhibiting Expression of 17beta-HSD Type 13 (HSD17B13), Compositions Thereof, and Methods of Use
2y 5m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+72.7%)
2y 7m
Median Time to Grant
Low
PTA Risk
Based on 81 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month