DETAILED ACTION
Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
2. This application claims priory to a provisional application 63/211,582 filed on 06/17/2021.
Election/Restrictions
3. Applicant's election with traverse of Group I (claims 1-12) and a species election “a virus” as applied to claim 5 in the reply filed on 07/14/2025 is acknowledged.
The traversal is on the ground(s) that the subject matters of Group I (a vaccine composition) and Group II (a method) constitute complementary aspects of a unified inventive concept and the Groups I and II share the same technical feature "a vaccine composition," and thus involve a single, searchable, and unifying aspect that links all the pending claims. With regards to species election (claim 5), applicant argues that a bacterium and virus are merely different embodiments of the pathogens against by the vaccine composition of the claimed invention and the examination of the two different pathogens (a virus and a bacterium) will not impose a serious burden.
This is not found persuasive because A) The inventions “a vaccine composition” and “a method of use of a vaccine composition” are distinct as claimed and are not obvious variants of each other (see MPEP § 806.05 - § 806.05(j)); and (B) There would be a serious search and/or examination burden on the examiner if restriction is not required (see MPEP § 803.02, § 808, and § 808.02), See: MPEP § 803, 806.05, 808.02.
Therefore, the Election/Restriction is appropriate as indicated in office action dated 05/14/2025.
The requirement is still deemed proper and is therefore made FINAL.
The claim amendment filed on 02/11/2026 comprise claims 17-21 as newly added claims that read on elected Group I. Thus, the Group I now include claims 1-12 and 17-21.
Status of Claims (modified)
4. Claims 1-21 as amended in filing 02/11/2026 are pending.
5. Claims 13-16 are withdrawn from consideration due to requirement for Restriction/Election.
6. The amended claims 1-12 and new claims 17-21 and elected species “a virus” applicable to claim 5 are under examination.
Withdrawn Claim Rejection
7. Withdrawn rejection of claims 1-5 and 7-10 under 35 U.S.C. 102(a)(1) in view of applicant’s amendment of claim 1 (that also changed the scope of dependent claims) as per filing of amended claim listing on 02/11/2026.
Claim Objections (New)
8. Claims 1 and 18 are objected to because of the following informalities:
The claims 1 and 18 recite a limitation a sequence of “Psg” without reciting a full name/ full form at least one time in the claim 1. The specification recited “Psg” on page 10 in para [0040] without reciting a full form at least one time. Therefore, it is not clear what the “Psg” stand for as a claim limitation?
Appropriate correction is required.
Objection to Specification
9. The specification disclosure is objected to because of the following informalities:
The specification recited “Psg” on page 10 in para [0040]. The drawing recited “Psg” in Fig. 1 plasmid map without reciting a full name / full form at least one time in the drawing/legend of figure.
Therefore, it is not clear what the “Psg” stand for in the specification/ drawing Fig. 1?
Appropriate correction is required.
10. The abstract of the disclosure is objected to because the claims 1 and 18 recites “a capsid protein” encoding sequence, capsid is a structural protein. The abstract is missing “a capsid protein”. The abstract is not commensurate with the claimed invention.
A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Claim Rejections - 35 USC § 112 (New)
11. Claims 1-12 and 17-21 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection, see MPEP §608.04.
The claims 1 and 18 are directed a vaccine composition, inter alia, comprising a recombinant DNA vaccine comprising a Sindbis virus vector expressing an antigenic protein of a pathogen (elected species virus, the claimed virus is a sub-genus). The claim amendments recite a limitation, wherein a sequence of Psg and a sequence of Capsid are sequentially located, in a 5' to 3' direction, between a sequence encoding the non-structural protein and a sequence encoding the antigenic protein of the pathogen.
The applicant filed remarks (02/11/2026) independent claim 1 is amended to recite "Psg" and "Capsid" by reference to FIG. 1 of the Drawings and paragraphs [0040] and [0041] of the specification. Further, new claim 18 is added according to amended claim 1 and the sequence listing of the present application and claims 19-21 are added according to original claims 4-6.
The specification as claimed by the applicant having support by reference to FIG. 1 of the Drawings and paragraphs [0040] and [0041]), upon review by the examiner found that the indicated locations of the specification and drawing does not have a support for full scope of the claim.
Because the claim limitation is not commensurate with support found in specification that reads on a species coronavirus spike protein (See, instant specification para [0014], [0039]- [041]), and Fig. 1) whereas the claim reads on a sequence encoding antigenic protein of a pathogen (reads on elected subgenus virus). The claim is broader (directed to a subgenus virus of a genus pathogen) than the support in the specification and figure 1.
Applicant may amend the claims to narrow the claim limitation to overcome the New Matter rejection.
Claim Rejections - 35 USC § 102
12. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
13. Claims 1-2, 4-6, and 17-21 are rejected under 35 U.S.C. 102 (a)(1)/(a)(2) as being anticipated by Dubensky at al 2002 (US6451592B1, 09/17/2002) as evidenced by Sawai et al 1999 (Molecular Genetics and Metabolism 67, 36–42, 1999).
Claims 1-2, 4-6, and 17-21: Dubensky at al 2002 is in the art directed to recombinant alphavirus-based vectors and teaches a vaccine composition comprising a recombinant DNA vaccine against a pathogen (see, claim 1, claims 22-24, 25-26, col 3 lines 30-45) and a pharmaceutically acceptable carrier (see, col 5, lines 53-61), the recombinant DNA vaccine including an expression cassette operably linked to a promoter (see, col 6, lines 55-67), wherein the expression cassette encodes a non-structural protein of a Sindbis virus (see, abstract, claims, col 13 lines 52-67, col 14 lines 1-6) and an antigenic protein of the pathogen (see, claim 1, claims 22-24), wherein a sequence of Psg (see, col 13 lines 62-63 a viral subgenomic junction region promoter reads on Psg because Psg is a subgenomic promoter) and a sequence of Capsid (see, col 7 lines 11-16) are sequentially located, in a 5' to 3' direction, between a sequence encoding the non-structural protein and a sequence encoding the antigenic protein of the pathogen (see, Fig 1 the genome organization of Sindbis virus showing non-structural nsP 1-4, subgenomic promoter sequence is located at the junction of non-structural gene sequence and capsid gene sequence). Dubensky at al 2002 further disclosed SEQ ID NO: 103 that has 100% identity with the nucleotide sequence SEQ ID NO: 3 disclosed in the instant invention (see, col 10 Fig 8A-8E SEQ ID NO: 103) and para [0040] disclosed the SEQ ID NO:3, instant sequence listing SEQ ID NO: 3 of Sindbis Virus Genome comprising order of genes as Nonstructural protein + Psg + Capsid. Dubensky at al 2002 disclosed within another embodiment, the
alphavirus Structural protein expression cassette further comprises an alphavirus capsid protein gene or other sequence (see, col 7, lines 11-15). Dubensky at al 2002 further disclosed within a related aspect, such constructs further comprise a selected heterologous sequence downstream of and operably linked to a viral junction region (see, col 4 lines 52-60, col 5 line 53-55, a viral junction region reads on Spg, a subgenomic promoter, 26S subgenomic RNA promoter). Therefore, it is evident that the heterologous protein gene sequence from another pathogen (reads on virus) is placed after the capsid gene sequence within the structural protein encoding region of sindbis virus towdards the 3’end of the capsid gene sequence. Construction of sindbis vector in the form of DNA plasmid vector is taught in Example 4 (see, col 81, and elsewhere in the prior art Dubensky at al 2002). Genetic Selection of Variants Using Virus-Derived Vectors, In another approach, mutations may be generated in any region a virus-derived expression vector, including the regulatory, untranslated regions, or protein-encoding gene regions (interpreted to reads on mutated structural proteins or capsid encoding gene for instant claim 2 limitation the vector although comprise capsid gene is free from expression of capsid or structural proteins) (see, col 20 lines 12-17). A sindbis virus vector expression cassette can be made free from expressing capsid by introducing a mutation that would disrupt the expression of capsid in entirety to prevent immune response divergence against capsid (instant claim 2).
SEQ ID NO 103
LENGTH: 11740
TYPE: DNA
Query Match 100.0%; Score 8388; Length 11740;
Best Local Similarity 100.0%;
Matches 8388; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Partial sequence alignment is shown below (Instant Qy: SEQ ID NO; 3; Database SEQ ID NO: 103.
Qy 1 ATGGAGAAGCCAGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTGTCGTGCAACTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 60 ATGGAGAAGCCAGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTGTCGTGCAACTG 119
Qy 61 CAAAAAAGCTTCCCGCAATTTGAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 120 CAAAAAAGCTTCCCGCAATTTGAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCT 179
Qy 8281 GGTGGCGCTGATGAAGGAACACGAACTGCCCTTTCGGTCGTCACCTGGAATAGTAAAGGG 8340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 8340 GGTGGCGCTGATGAAGGAACACGAACTGCCCTTTCGGTCGTCACCTGGAATAGTAAAGGG 8399
Qy 8341 AAGACAATTAAGACGACCCCGGAAGGGACAGAAGAGTGGTCCGCAGCA 8388
||||||||||||||||||||||||||||||||||||||||||||||||
Db 8400 AAGACAATTAAGACGACCCCGGAAGGGACAGAAGAGTGGTCCGCAGCA 8447
Dubensky at al 2002 further disclosed SEQ ID NO: 103 that has 100% identity with the nucleotide sequence SEQ ID NO: 3 disclosed in the instant invention and therefore discloses instant claim 18 limitation “wherein the expression cassette comprises a polynucleotide sequence defined by nucleotides 7520-7544 and 7588-8380 of SEQ ID NO: 3, and wherein said polynucleotide sequence comprises a sequence of Psg and a sequence of Capsid, respectively, and is located between a sequence encoding the non-structural protein and a sequence encoding the antigenic protein.
Sawai et al 1999 provides evidence that the subgenomic promoter is a PSG as shown on page 39 in the figure 1 below (see, Fig 1 legend page 38 recited Abbreviations: PSG, Sindbis viral
subgenomic promoter).
PNG
media_image1.png
148
921
media_image1.png
Greyscale
Claim Rejections - 35 USC § 103 (modified)
14. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
15. Claims 1-12 and 17-21 are rejected under 35 U.S.C. 103 as being unpatentable over Dubensky at al 2002 (US6451592B1, 09/17/2002), and further in view of Tseng et al 2009 (Gene Therapy (2009) 16, 291–296), Sawai et al 1999 (Molecular Genetics and Metabolism 67, 36–42, 1999), Saxena et al 2008 (Vaccine 26 (2008) p. 6592–6601), Prompetchara et al 2021 (PLoS ONE 16(3):e0248007 p. 1-16), Yu et al 2020 (Science, 2020, 369, p. 806–811), Erasmus et al 2020 (Sci. Transl. Med. 12, 2020, eabc9396, p. 1-11), Bloom et al 2020 (Gene Therapy (2021) 28:117–129) and Perri et al 2017 (US9730997B2, published 08/15/2017).
Claims 1-12 and 17-21: Dubensky at al 2002 is in the art directed to recombinant alphavirus-based vectors and teaches a vaccine composition comprising a recombinant DNA vaccine against a pathogen (see, claim 1, claims 22-24, 25-26, col 3 lines 30-45) and a pharmaceutically acceptable carrier (see, col 5, lines 53-61), the recombinant DNA vaccine including an expression cassette operably linked to a promoter (see, col 6, lines 55-67), wherein the expression cassette encodes a non-structural protein of a Sindbis virus (see, abstract, claims, col 13 lines 52-67, col 14 lines 1-6) and an antigenic protein of the pathogen (see, claim 1, claims 22-24), wherein a sequence of Psg (see, col 13 lines 62-63 a viral subgenomic junction region promoter reads on Psg because Psg is a subgenomic promoter) and a sequence of Capsid (see, col 7 lines 11-16) are sequentially located, in a 5' to 3' direction, between a sequence encoding the non-structural protein and a sequence encoding the antigenic protein of the pathogen (see, Fig 1 the genome organization of Sindbis virus showing non-structural nsP 1-4, subgenomic promoter sequence is located at the junction of non-structural gene sequence and capsid gene sequence). Dubensky at al 2002 further disclosed SEQ ID NO: 103 that has 100% identity with the nucleotide sequence SEQ ID NO: 3 disclosed in the instant invention (see, col 10 Fig 8A-8E SEQ ID NO: 103) and para [0040] disclosed the SEQ ID NO:3, instant sequence listing SEQ ID NO: 3 of Sindbis Virus Genome comprising order of genes as Nonstructural protein + Psg + Capsid. Dubensky at al 2002 disclosed within another embodiment, the
alphavirus Structural protein expression cassette further comprises an alphavirus capsid protein gene or other sequence (see, col 7, lines 11-15). Dubensky at al 2002 further disclosed within a related aspect, such constructs further comprise a selected heterologous sequence downstream of and operably linked to a viral junction region (see, col 4 lines 52-60, col 5 line 53-55, a viral junction region reads on Spg, a subgenomic promoter, 26S subgenomic RNA promoter). Therefore, it is evident that the heterologous protein gene sequence from another pathogen (reads on virus) is placed after the capsid gene sequence within the structural protein encoding region of sindbis virus towdards the 3’end of the capsid gene sequence. Construction of sindbis vector in the form of DNA plasmid vector is taught in Example 4 (see, col 81, and elsewhere in the prior art Dubensky at al 2002). Genetic Selection of Variants Using Virus-Derived Vectors, In another approach, mutations may be generated in any region a virus-derived expression vector, including the regulatory, untranslated regions, or protein-encoding gene regions (interpreted to reads on mutated structural proteins or capsid encoding gene for instant claim 2 limitation the vector although comprise capsid gene is free from expression of capsid or structural proteins) (see, col 20 lines 12-17). A sindbis virus vector expression cassette can be made free from expressing capsid by introducing a mutation that would disrupt the expression of capsid in entirety to prevent immune response divergence against capsid (instant claim 2).
SEQ ID NO 103
LENGTH: 11740
TYPE: DNA
Query Match 100.0%; Score 8388; Length 11740;
Best Local Similarity 100.0%;
Matches 8388; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Partial sequence alignment is shown below (Instant Qy: SEQ ID NO; 3; Database SEQ ID NO: 103.
Qy 1 ATGGAGAAGCCAGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTGTCGTGCAACTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 60 ATGGAGAAGCCAGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTGTCGTGCAACTG 119
Qy 61 CAAAAAAGCTTCCCGCAATTTGAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 120 CAAAAAAGCTTCCCGCAATTTGAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCT 179
Qy 8281 GGTGGCGCTGATGAAGGAACACGAACTGCCCTTTCGGTCGTCACCTGGAATAGTAAAGGG 8340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 8340 GGTGGCGCTGATGAAGGAACACGAACTGCCCTTTCGGTCGTCACCTGGAATAGTAAAGGG 8399
Qy 8341 AAGACAATTAAGACGACCCCGGAAGGGACAGAAGAGTGGTCCGCAGCA 8388
||||||||||||||||||||||||||||||||||||||||||||||||
Db 8400 AAGACAATTAAGACGACCCCGGAAGGGACAGAAGAGTGGTCCGCAGCA 8447
Dubensky at al 2002 further disclosed SEQ ID NO: 103 that has 100% identity with the nucleotide sequence SEQ ID NO: 3 disclosed in the instant invention and therefore discloses instant claim 18 limitation “wherein the expression cassette comprises a polynucleotide sequence defined by nucleotides 7520-7544 and 7588-8380 of SEQ ID NO: 3, and wherein said polynucleotide sequence comprises a sequence of Psg and a sequence of Capsid, respectively, and is located between a sequence encoding the non-structural protein and a sequence encoding the antigenic protein.
Dubensky at al 2002 does not explicitly teach (i) the 26S subgenomic promoter is PSG and (ii) the sequence encoding the antigenic protein of a pathogen (heterologous gene sequence) is placed downstream of the sinbis virus capsid protein encoding sequence.
Sawai et al 1999 teaches that the subgenomic promoter is a PSG as shown on page 39 in the figure 1 below (see, Fig 1 legend page 38 recited Abbreviations: PSG, Sindbis viral
subgenomic promoter). Sawai et al 1999 is in the art and teaches a sindbis viral vector capable of expressing nonstructural genes and a Psg promoter that is operably linked to heterologous genes (PSG-bcl-2 gene, PSG-LacZ gene) within the structural gene location (see, abstract, Figure 1 A).
PNG
media_image1.png
148
921
media_image1.png
Greyscale
Tseng et al 2009 is in the art and teaches a sindbis viral vector that has therapeutic protein gene operably linked of subgenomic promoter (to the downstream) followed by a second subgenomic promoter and structural gene sequence of a sindbis virus (see, Figure 1-C).
Saxena et al 2008 teaches claims 1-5, and 7-10 directed to, inter alia (as recited supra), a vaccine composition comprising a Sindbis virus replicon-based DNA vaccine encoding the Rabies virus glycoprotein (G), the recombinant DNA vaccine includes an expression cassette operably linked to a CMV immediate early (CMV-IE) promoter, and the expression cassette the expression cassette encodes Sindbis virus nonstructural proteins nsP1, nsP2, nsP3 and nsP4 (See, Fig 1, and associated legend line 2) and Rabies virus envelope Glycoprotein that is antigenic. The recombinant Sindbis virus replicon-based DNA vaccine encoding the Rabies virus glycoprotein (G) is in a circular plasmid form (See, abstract, page 6593 Fig. 1, top figure and associated legends, col 2 section 2.2. construction of replicon-based DNA vaccine pAlpha-Rab-G, page 6594 2.5. Large scale preparation of plasmid DNA, 2.7. vaccination of mice intramuscular injection of 50 µg of the replicon vaccine pAplha-Rab-G to mice, thus inherently the pAplha-Rab-G plasmid DNA is dissolved or suspended in a carrier that is nuclease free water or nuclease free PBS). Saxena et al 2008 teaches expression of the heterologous gene is achieved by linking it to the highly active alphavirus 26S subgenomic promoter, the 26S subgenomic promoter reads on Psg (See, page 6593, col 1 para 1).
Saxena et al 2008, inter alia, teaches sindbis virus replicon DNA vaccine encoding Rabies virus glycoprotein (G), however, do not teach a sindbis virus replicon DNA vaccine encoding a SARS CoV-2 structural protein Spike (S) glycoprotein that is antigenic and induce protective immune response in a mammalian subject.
Prompetchara et al 2021 teaches DNA vaccine candidate encoding SARS-CoV-2 spike proteins elicited potent humoral and Th1 cell-mediated immune responses in mice. Prompetchara et al 2021 reported a construction strategy of DNA vaccine candidates expressing full length wild type SARS-CoV-2 spike (S) protein, S1 or S2 region and their immunogenicity in mice. The DNA vaccine constructs of pCMVkan-S, -S1 and -S2 induced high levels of specific binding IgG that showed a balance of IgG1/IgG2a response. The sera from mice vaccinated with pCMKkan-S or -S1 DNA vaccines could inhibit viral RBD and ACE2 interaction. The highest neutralizing antibody (NAb) titer was found in pCMVkan-S group, followed by -S1, while -S2 showed the lowest PRNT50 titers. The geometric mean titers (GMTs) were 2,551, 1,005 and 291 for pCMVkan-S, -S1 and -S2, respectively. pCMVkan-S construct vaccine also induced the highest magnitude and breadth of T cells response. Analysis of IFN-γ
positive cells after stimulation with SARS-CoV-2 spike peptide pools were 2,991, 1,376 and 1,885 SFC/106 splenocytes for pCMVkan-S, -S1 and -S2, respectively. The findings highlighted that full-length S antigen is more potent than the truncated spike (S1 or S2) in inducing of neutralizing antibody and robust T cell responses (See, abstract, See, Figures 1-5 and associated legends). DNA vaccine encoded protein expression analysis in transfected HEK293T cells with pCMVkan-S, pCMVkan-S1, pCMVkan-S2 or empty vector. Target proteins expressions were detected employing anti-S1(top) and anti-S2 (bottom) antibodies (See, page 7, Fig. 2, and associated legends, See entire article). Prompetchara et al 2021 further teaches those synthetic genes with humanized codon optimization encoding S, S1 or S2 were synthesized and used to construct a DNA vaccine plasmid (See, page 3, section on construction and preparation of recombinant plasmid DNA) and SARS CoV-2 Spike protein expression in transfected HEK293T cells (human embryonic kidney 293T cell line, mammalian cells) using pCMVkan-S, pCMVkan-S1, pCMVkan-S2 or empty vector is shown by detecting employing anti-S1 (top) and anti-S2 (bottom) antibodies (See, Figure 1, See entire article).
Yu et al 2020 teaches the global coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has made the development of a vaccine a top biomedical priority and further teaches DNA vaccine protection against SARS-CoV-2 in rhesus macaques (See, abstract, Fig 1-5 and associated legends and entire article).
Erasmus et al 2020 teaches an Alphavirus-derived replicon RNA vaccine induces SARS-CoV-2 neutralizing antibody and T cell responses in mice and nonhuman primates. The RNA replicons were formulated with lipid inorganic nanoparticles (LIONs) that were designed to enhance vaccine stability, delivery, and immunogenicity (See, abstract, Fig 1-5 and associated legends and entire article).
Bloom et al 2020 is in the art and reviewed self-amplifying RNA vaccines for infectious diseases including viral pathogens, SARS-CoV-2 pandemic (See, abstract, page 118 Fig. 1, table 1). The translation of (a) conventional mRNA encoding a pathogen (vaccine) immunogenic antigen gene, (b) self-amplifying RNA (alphavirus replicon RNA), and (c) Trans- amplifying RNA (alphavirus replicon) are shown in Fig. 1.
The Sindbis virus replicon DNA plasmid construct encoding human or mammalian cell codon optimized SARS CoV-2-Spike glycoprotein (S glycoprotein) which is claimed and rendered obvious by the applied prior art teachings, as recited supra, is expected to be reasonably superior to produce amplified/transcribed mRNA levels similar to that of Fig. 1 (b) self-amplifying RNA (alphavirus replicon RNA) that would be substantially more mRNA transcripts of SARS CoV-2 S encoding protein than a conventional DNA vaccine encoding SARS CoV-2 S as taught by Prompetchara et al 2021 and Yu et al 2020 as recited supra and interpreted by the ordinary skills in the art based on the recited articles.
Perri et al 2017 (US9730997B2) is in the art and teaches inventions on alphavirus replicons (Sindbis virus replicon), alphavirus/Sindbis virus vector constructs, alphavirus replicon particles expressing one or more antigens (influenza virus HA, NA or RSV F or G protein) derived from one or more respiratory pathogens (influenza virus, respiratory syncytial virus). The replicon vectors may be utilized in any of several formats, including DNA vector constructs, plasmid-based replicons and include sequences encoding the Sindbis virus nonstructural (nsP1, nsP2, nsP3, nsP4) proteins required for the replicon. The alphavirus replicon vector is vector derived from an alphavirus selected from the group consisting of a Sindbis virus (the Sindbis virus replicon backbone SINCR), a Semliki Forest virus, a Venezuelan equine encephalitis virus, and a Ross River virus (See claims 1-16, abstract and entire description of invention), the method of making and using these immunogenic compositions comprising a pharmaceutically acceptable carrier, diluent, or excipient (See, abstract, claims 1, 14, description of invention).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Dubensky at al 2002 with additional teachings of Tseng et al 2009, Sawai et al 1999, Saxena et al 2008, Prompetchara et al 2021, Yu et al 2020, Erasmus et al 2020, Bloom et al 2020 and Perri et al 2017 as recited supra to arrive at the invention of claims 1-12 and 17-21 to develop a vaccine composition comprising sindbis virus vector expressing a heterologous virus immunogenic protein with the additional prior art teachings of Yu et al 2020 on the DNA vaccine encoding human cell (mammalian cell) codon optimized SARS CoV-2 spike (S) glycoprotein gene expression and protection in mice; the prior art teachings of Yu et al 2020 on the global SARS CoV-2 coronavirus disease 2019 (COVID-19) pandemic and DNA vaccine, an Alphavirus-derived replicon RNA vaccine inducing SARS-CoV-2 neutralizing antibody and T cell responses in mice and nonhuman primates teachings of Erasmus et al 2020; and the prior art teachings of Bloom et al 2020 on a self-amplifying RNA vaccines for viral pathogen diseases to render obvious incorporation of the human codon optimized SARS CoV-2 Spike (S) gene into the Sindbis virus nsP1-4 replicon DNA construct encoding-Rab-G by replacing Rabi-G (encoding Rabies virus G protein) with SARS CoV-2 S; Perri et al 2017 (US9730997B2) teachings on Sindbis virus DNA replicon vector and immunogenic compositions comprising a pharmaceutically acceptable carrier, diluent, or excipient to arrive at the Sindbis virus replicon DNA plasmid construct encoding human or mammalian cell codon optimized SARS CoV-2-Spike glycoprotein (S glycoprotein) of instant claim 1-12 and 17-21. The motivation would be to develop a Sindbis virus replicon DNA plasmid construct encoding human or mammalian cell codon optimized SARS CoV-2-Spike glycoprotein (S glycoprotein) comprising vaccine that would provide stability to the nucleic acid conferred by DNA plasmid or DNA molecule, the replicon DNA vaccine construct will have properties to generate more mRNA transcripts encoding SARS CoV-2 S than SARS CoV-2 S DNA vaccine and would be more stable than alphavirus-derived replicon RNA encoding SARS CoV-2 S vaccine. The Sindbis virus replicon DNA plasmid construct encoding human, or mammalian cell codon optimized SARS CoV-2-Spike glycoprotein (S glycoprotein) would result in higher translation of the antigenic S gene producing more amount of S protein immunogen in the cells receiving the vaccine in the mammalian subject expected to result in strong humoral and antibody response and superior protection. The inventions of claims 1-12 and 17-21 would make development of the Sindbis replicon DNA vaccine faster (a short turnaround time frame) and in limited duration as only the variant S gene would need to be codon optimized and incorporated in the developed sindbis replicon DNA construct platform. The presence of sindbis virus capsid encoding gene would allow to induce immune response against sindbis virus (claim 1). Whereas as expression cassette can be made free from expressing capsid by introducing a mutation that would disrupt the expression of capsid in entirety to prevent immune response divergence against capsid (instant claim 2). The inventions of claims 1-12 and 17-21 would also be of a commercial interest given the ongoing cases or outbreaks of SARS CoV-2 infection. One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the inventions of claims 1-12 and 17-21 given the applied prior art teachings as recited supra. It would have been prima facie obvious to arrive at the inventions of the claims 1-12 and 17-21. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention in claims 1-12 and 17-21. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), examples of rationales, A-G.
16. Relevant Prior Arts:
Nivitchanyong et al 2009. An improved in vitro and in vivo Sindbis virus expression system through host and virus engineering. Virus Research 141 (2009) 1–12. Disclosed limiting the lethality inherent in the Sindbis virus vector in order to enable long term, sustained expression of recombinant proteins may be possible.
Response to Arguments
17. Applicant’s arguments with respect to the amended claims 1-12 and newly added claims 17-21 have been considered but are moot because the new ground of rejection rely on additional reference applied in the instant modified office action as compared to the references cited in the prior rejection of record for teaching or matter specifically challenged in the argument filed on 02/11/2026.
Applicant’s Argument 1:
Claim Rejections under 35 U.S.C. § 102
In the Office Action, claims 1-5 and 7-10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Saxena (Vaccine 26 (2008) p. 6592-6601).
The rejection is respectfully traversed for the following reasons.
Independent claim 1 of the present application is amended to explicitly recite a specific arrangement of an expression cassette, namely that "a sequence of Psg and a sequence of Capsid are sequentially located, in a 5' to 3' direction, between a sequence encoding a non- structural protein and a sequence encoding an antigenic protein of a pathogen."
Saxena fails to disclose, expressly or inherently, the specific structural feature. As shown in Figure 1 and described in Section 2.2 of Saxena, the pAlpha-Rab-G construct places the antigenic gene (Rabies G) directly downstream of the 26S subgenomic promoter, without the inclusion of a packaging signal (Psg) or any capsid-derived translation enhancer sequence at that location. Saxena neither discloses nor suggests inserting a Psg sequence and a capsid-derived enhancer between the non-structural protein coding sequence and the antigenic protein coding sequence, let alone in the specific sequential order now recited in amended claim 1.
Therefore, Applicant respectfully submits that the amended independent claim 1, as well as the claims dependent thereon, are novel over Saxena, and withdrawal of the rejection under 35 U.S.C. §102 is respectfully requested.
In Response: Withdrawn rejection of claims 1-5 and 7-10 under 35 U.S.C. 102(a)(1) in view of applicant’s amendment of claim 1 to sindbis virus vector comprise capsid gene sequence.
Applicant’s Argument 2:
Claim Rejections under 35 U.S.C. § 103
Claims 1-12 are rejected under 35 U.S.C. 103 as being unpatentable over Saxena in view of Prompetchara (PLoS ONE 16(3): e0248007 p. 1-16), Yu (Science, 2020, 369, p. 806-811), Erasmus (Sci. Transl. Med. 12, 2020, ea bc9396, p. 1-11), Bloom (Gene Therapy (2021) 28:117- 129) and Perri (US9 73099782, published 08 15 2017).
The rejections are respectfully traversed for the following reasons.
As mentioned above, the amended claim 1 of the present application recites a specific expression cassette including:
a sequence encoding a Sindbis virus non-structural protein;
followed, in a 5' to 3' direction, a Psg sequence and a Capsid sequence sequentially located; and
followed by a sequence encoding an antigenic protein of a pathogen.
Saxena does not disclose this structure, as discussed above. Moreover, none of the
additional cited references cures this deficiency. Specifically, as shown in Fig. 1 and Section 2.2 of Saxena, the pAlpha-Rab-G construct places the antigenic gene directly downstream of the 26S subgenomic promoter, thereby omitting any Psg or capsid-derived sequence at the claimed location.
Prompetchara discloses a DNA vaccine encoding SARS-CoV-2 spike proteins, but does not relate to Sindbis-based expression cassette design or the placement of Psg or capsid-derived enhancer sequences. Yu discusses the importance of SARS-CoV-2 vaccine development, but provides no teaching regarding alphavirus replicon vector architecture. Erasmus, Bloom, and Perri generally disclose alphavirus-derived replicon RNA vaccines or self-amplifying RNA platforms; however, none of these references discloses or suggests inserting a Psg sequence and a capsid-derived translation enhancer between the non-structural protein coding sequence and the antigen coding sequence in the specific order recited in the amended independent claim 1. Accordingly, even in combination, the cited references fail to teach or suggest the claimed structural arrangement.
Furthermore, the claimed arrangement is not a routine or obvious design choice and, in fact, runs counter to conventional Sindbis-based vector design. In wild-type Sindbis virus, the packaging signal (Psg) is located within the nsPl region (approximately nucleotides 945-1076). By contrast, the present application deliberately repositions the Psg downstream of the non- structural protein coding region, as shown in FIG. 1 of the present application, to improve RNA stability and to facilitate efficient viral replicon particle (VRP) production when used in conjunction with a helper plasmid.
Further, the Capsid sequence applied in the present application is derived from the N- terminal portion of the Sindbis virus capsid gene (approximately the first 100-114 nucleotides), which is known to form a stable stem-loop structure functioning as a strong translation enhancer.
In conventional Sindbis-based vectors, including the pAlpha vector used by Saxena, the entire structural protein region (including the capsid gene) is typically deleted to maximize space for foreign genes, and the antigen gene is directly placed downstream of the 26S promoter. The prior art thus teaches away from retaining any capsid-derived sequence.
By contrast, the claimed invention of the present application intentionally retains this capsid-derived enhancer sequence and positions it between the Psg and the antigenic protein coding sequence, thereby significantly enhancing antigen expression. As demonstrated in Examples 2-5 and Figures 5-8 of the present application, the dSinC platform exhibits unexpectedly superior immunogenic efficacy even in challenging models, such as obese and aged mice. None of the cited references provides any teaching or reasonable expectation that such results could be achieved by the claimed sequence arrangement.
In light of the above, neither Saxena nor Saxena in combination with the additional cited references teaches or suggests the claimed expression cassette, and the claimed invention achieves unexpected technical effects; therefore the claimed inventions of the present application are not obvious under 35 U.S.C. §103. Reconsideration and withdrawal of the rejections under 35 U.S.C. §103 are respectfully requested.
In Response: The modified office action renders obvious the amended claims 1-12 and 17-21 as recited supra including added claim limitations Psg and capsid gene sequences and the order of “nonstructural protein genes-Psg-Capsid-heterologous gene spike of coronavirus” in the 5’[Wingdings font/0xE0] 3’ direction (instant drawing Fig 1 and specification) in the sindbis virus vector as recited supra. The applicant’s arguments are moot in view of the modified office action.
Conclusion
18. No claim is allowed.
19. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
20. A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
21. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672
/BENNETT M CELSA/Primary Examiner, Art Unit 1600
Prosecution Insights