Prosecution Insights
Last updated: August 17, 2026
Application No. 17/846,636

NOVEL RNA THERAPEUTICS AND USES THEREOF

Non-Final OA §103§112
Filed
Jun 22, 2022
Priority
Jun 24, 2021 — provisional 63/214,555 +1 more
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Eli Lilly and Company
OA Round
4 (Non-Final)
52%
Grant Probability
Moderate
4-5
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
38 granted / 73 resolved
-7.9% vs TC avg
Strong +64% interview lift
Without
With
+64.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
37 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.6%
-34.4% vs TC avg
§103
34.2%
-5.8% vs TC avg
§102
18.0%
-22.0% vs TC avg
§112
26.5%
-13.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 73 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 1, 3-27 are pending. Claims 1, 3-13 are examined here, along with elected species of SEQ ID NO: 256. Claims 14-27 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 08/30/2023. Priority Application’s benefit to U.S. Provisional Applications 63/214, 584, filed on 06/24/2021, and 63/214,555, filed on 06/24/2021, is acknowledged. Claims 1-13 enjoy the benefit of 06/24/2021. Claim Rejections - 35 USC § 112 35 U.S.C. 112(b): Rejection of claims 1, 3-13 is withdrawn in view of the amendments. 35 U.S.C. 112(d): Rejection of claims 6-13 under 112(d) is withdrawn, the limitation “or a sequence having at least 90% sequence identity thereto” is canceled. Claim Rejections - 35 USC § 103 Rejection of claims 1, 3-13 is maintained as noted below and the rejection is edited to reflect the claim amendments. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 3-8, 13 are rejected under 35 U.S.C. 103 as being unpatentable over Delacote et al. (US20120244131, pub. 09/27/2012) in view of Amarzguioui et al. (2005, FEBS Letters, 579, pg. 5974-5981) and Li et al. (US20180064819, pub. 03/08/2018, referred as Li) and Matsuda et al. (2015, ACS Chem. Biol. 10, 1181-1187) and K. Regarding instant claim 1, SEQ ID NOs: 417-420 (antisense), each a 18 nt. sequence, have at least 18 contiguous nt. identical to elected SEQ ID NO: 256 (Antisense): ugugcggccauagagacccagua, a 23 nt. sequence, while the complementary sense strand is SEQ ID NO: 133, 5' – cugggucucuauggccgcaca, a 21 nt. sequence (all sequence are from 5’ to 3’ unless indicated otherwise). It should be noted that SEQ ID NO: 256 comprises two nt. overhangs at the 3’ end of the antisense strand comprising nts. U and A, and the overhang is not complementary with the target sequence. SEQ ID NO: 418: gcggccauag agacccag. Delacote discloses a novel approach to increase the efficiency of DSB-induced mutagenesis by using interfering agents in an in vivo assay (par. 13). Following a screen to identify genes involved in DSB-mutagenesis repair, one of the 481 siRNA hit stimulated an endonuclease induced mutagenic NHEJ repair luciferase signal with at least a stimulation factor of 1.83 and targeted a sequence of SEQ ID NO: 555 (par. 283). The siRNA was expressed on a vector and targeted SEQ ID NO: 555: ctggguctctatggccgcaca (Table IV, par. 284, a 21 nt. sequence). siRNA comprising SEQ ID NO: 555, once expressed with a uracil, is 100% identical to instant sense sequence SEQ ID NO: 133, thus, inherently, the antisense strand at 100% complementarity of SEQ ID NO: 555 reads on instant SEQ ID NOs: 418-420 (relevant to instant cl. 1, 3). Delacote discloses that siRNAs duplex comprises 21 and 23 nt. (par. 124, relevant to instant cl. 4 and 5) and can be generated from two RNA molecules that hybridize together without a mismatch or with one or more mismatch (par. 125, relevant to instant cl. 8). Delacote does not disclose a non-vector based siRNA and Formula I of claim 1. Amarzguioui et al. (2005, FEBS Letters, 579, pg. 5974-5981) compares chemically synthesized siRNA and vector mediated RNAi and notes advantages of each; the chemically synthesized siRNA representing a “gold standard for RNAi applications” because of its uniform composition and its ability for wider range of chemical modifications, however note that the inhibition is transient, lasting only days in cell culture (pg. 5975, 5976). While the vector based is a stable-expression of RNAi effector molecules for cell lines that are difficult to or are inconsistent in transfecting (pg. 5976). Amarzguioui discloses that changing a siRNA from 19 + UU overhangs to 21 + AA overhangs (thus a 23 nt. sequence), with a 21 nt. target complementary duplex region was associated with enhanced RNAi activity and indicates that increased potency was observed with 5’ overhangs or blunt ends (pg. 5975, relevant to instant cl. 1, 4 and 5). Delacote and Amarzguioui do not disclose the siRNA with delivery moiety of Formula I conjugated to the siRNA (cl. 1). Li discloses RNAi agents conjugated to N-acetyl-galactosamine (GalNAc or NAG) targeting ligand via linkers bind to asialoglycoprotein receptor (ASGPR) on liver cells thus aiding in delivery of RNAi agents to liver cells (par. 94). Li tested various siRNAs NAGs in mice, one is NAG25 (see structure below, Fig 9, also similar structures at par. 17 (structure 1002a, 1003a)), which has prolonged potent inhibitory activity in vivo (see Fig. 12, which shows 71% knockdown, 14, 15). The NAG25 is conjugated at the 5’ end of a sense strand (par. 519, Table 3, Duplex ID: AD03549). PNG media_image1.png 230 360 media_image1.png Greyscale Li’s NAG25 is similar in structure as instant Formula I. Both have a triantennary GalNAc bound to siRNA with a linker that has a similar branch structure. The distinction is in the structure of the linker: Li’s linker has a polyethylene glycol chain as opposed to instant 4-carbon chain of Formula I, Li’s NAG 25 lacks a tertiary amine, and the orientation of the amide groups are different. Matsuda et al. (2015, ACS Chem. Biol. 10, 1181-1187) disclosed that evaluating clustered and dispersed incorporation of GalNAc units to the sense strand indicated that sugar proximity is critical for ASPGR recognition, and location of the clustered ligand impacts the intrinsic potency of the siRNA (abstract, see Fig. 1 below for placements of GalNAc moiety). PNG media_image2.png 523 789 media_image2.png Greyscale The results of Table 1 disclose that compared to the parent design (i.e. labeled I above, a triantennary GalNAc), a monovalent GalNAc moiety bound at 2’ position (labeled II in figure above and compounds 42-44, and 48 in Table 1) that were clustered ligands (all three modified nt. with a monovalent GalNAc moiety are contiguous) near either the 5’ or 3’ ends of the sense strand had in vitro potency similar to or slightly better than that of the parent design under receptor-mediated free uptake conditions (i.e. without transfection agent, pg. 1183). Design II has polyethylene glycol and lacks amide group, while design III has carbon chain with amide group and results with both design have similar inhibitory outcome (see compounds 52 and 54, respectively). The compounds where the monovalent GalNAc was dispersed throughout the siRNA (i.e. two modified nt. with a single GalNAc moiety at terminal positions and one dispersed in a central location on the sense strand, compounds 49-50) showed a significant loss of potency under free uptake condition. The results indicate that “efficient receptor binding and hepatocellular uptake require multiple GalNAc units in close proximity to each other” (pg. 1183-1184). Thus, the essential importance is having the GalNAc/NAG moieties in close proximity and minor structural differences of the linker molecule do not affect the ability to inhibit the target gene. One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified SEQ ID NO: 555 of Delacote in view of Amarzguioui, which discloses synthetic siRNA can be chemically modified, and Li, which discloses modified siRNAs with a GalNAc conjugate tethered by a linker, and arrive at the claimed invention with a reasonable expectation of success. Based on Delacote’s screen using a siRNA expressed on a vector, a skilled artisan would confirm the results using synthetic siRNA because they can be modified and are a “gold standard” as indicated by Amarzguioui and would introduce a GalNAc moiety by the use of a linker, which clusters the GalNAc moieties together, of Li in hepatocyte to confirm if SEQ ID NO: 555 increases the efficiency of DSB-induced mutagenesis in both hepatocytes and in-vivo. The modifications based on Amarzguioiu and Li of SEQ ID NO: 555 of Delacote would successfully result in siRNA at least being incorporated into hepatocyte cell without a transfection agent and be able to confirm the screen results. Thus, claims 1, 3, 4, 5, 8, 13 are obvious. Regarding instant cl. 6, 7 a siRNA of Li comprising SEQ ID NO: 555, a 21 nt. sequence, does not have the non-complementary UA overhang of instant SEQ ID NO: 256. As indicated by Amarzguioui, a 2 nt. overhang can comprise AA or UU, thus it would be obvious that U and A can be interchangeable or substituted (i.e. AU or UA, latter applies to instant SEQ ID NO: 256), since the overhang do not bind to the target transcript. Thus claims 6, 7 are obvious. Regarding instant cl. 13, the limitation of “a phosphate group,” analyzed broadly, would include a phosphodiester bond, which comprises a phosphate group. Thus, the 5’ nucleotide of the antisense strand bound to position 2 via a phosphodiester bond would necessarily have “a phosphate group”. Here, the specification does not clearly define “a phosphate group,” the specification describes a phosphate group as a phosphodiester linkage (see pg. 10, line 23-25: A modified deoxyribonucleotide has one or more modifications . . . including modifications or substitutions in or of the nucleobase, sugar, or phosphate group”). Claims 9, 10, 11, and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Delacote et al. (US20120244131, pub. 09/27/2012) in view of Amarzguioui et al. (2005, FEBS Letters, 579, pg. 5974-5981) and Li et al. (US20180064819, pub. 03/08/2018, referred as Li) and Matsuda et al. (2015, ACS Chem. Biol. 10, 1181-1187) as applied to claims 1, 3, 4, 5, 6, 7, 8, 13 above, and further in view of Khvorova and Watts (2017, Nature Biotech., 35, 238-248, referred as Khvorova). Regarding instant cl. 9, 10, 11, and 12, Li provides example of RNAi agents with each nucleotide either with 2’-O-methyl (2OMe) modification or 2’-fluoro (2F) modification (par. 519, see below of Duplex ID: AD03549 comprising NAG25, Table 3, lower case is 2OMe modified nt. and upper case letter with f is 2F modified nt. (par. 301), and results provided in Fig. 12, relevant to instant cl. 9, 10). Further, the RNAi agent comprise phosphorothioate (PS) linkage, with the antisense strand of Duplex ID AD03549 with 4 PS linkage while the sense strand has 2 PS linkage (see below, s is PS linkage, par. 303) (relevant to instant cl. 11). Li discloses that any nucleotide can be modified with a modified internucleotide linkage, including modified PS linkage between linker and siRNA, thus based on numbers of internucleotide linkage, each linkage could be a PS linkage (par. 119). These modifications provide a potent inhibitory effect as seen in results of Fig. 12. PNG media_image3.png 112 510 media_image3.png Greyscale Li does not disclose the sense strand comprising four phosphorothioate linkages. Khvorova discloses that nucleotide modifications, including 2OMe, 2F and PS linkages, are required for the siRNA to be sufficiently active in vivo (pg. 239). The PS linkage providing nuclease stability, while 2OMe and 2F improve binding affinity and nuclease resistance (pg. 239, relevant to instant cl. 9-12). Khvorova discloses that PS linkages at every internucleotide site result in reduced binding affinity (pg. 239) thus suggests that two terminal linkages of each strand should be modified with PS; thus each sense and antisense strand has 4 PS linkages (see Fig. 3, pg. 243 (“limited phosphorothioates”), relevant to instant cl. 12). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the SEQ ID NO: 555 of Delacote in view of Amarzguioui, Li and Khvorova arrive at the claimed invention with a reasonable expectation of success. Here, Amarzguioui discloses the use of synthetic siRNA based on its ability to be modified as an advantage and Li provides a NAG, 2OMe, 2F and PS-linkage modified form of an siRNA that provide nuclease stability and improved binding and results in successful inhibitory activity of target gene, and Khvorova discloses a limited modification of siRNA with PS linkages, thus, a synthetic, fully modified siRNA conjugated to a GalNAc/NAG with a linker would successfully result in at least being endocytosed into a hepatocyte cell and inhibit the target gene and be able to confirm the screen results. Thus, claims 9-12 are obvious. Response to Arguments Applicant's arguments filed 08/19/2025 (“the Remarks”) have been fully considered but they are not persuasive. The Remarks highlight the differences between structure of Formula I and NAG25 of Li, see below: PNG media_image4.png 417 451 media_image4.png Greyscale The Remarks indicate that efficacy of GalNAc moieties at delivering oligonucleotide is unpredictable, because citing Li, GalNAc moieties “do so with different efficacy” nor would look to Li to find guidance to make the noted “eight (or eleven) changes” (pg. 15- 16). The argument is not persuasive. Examiner does not dispute the differences since the differences were noted in the action. The issue is that structures are not patentably distinct, i.e. lack a relevant difference in function or effect, and as noted in the action “GalNAc/NAG moieties [are] in close proximity and minor structural differences of the linker molecule do not affect the ability to inhibit the target gene” (pg. 9). Here, the specification and the Remarks do not provide a rationale or evidence that the linker molecule improves the function/effect of the siRNA or do not provide an unexpected result compared to that of the prior art due to the differences in the linker moiety. Regarding the unpredictability and efficacy argument, the GalNAc moieties of instant application and of prior art are the same, thus the structure of GalNAc moieties are not in dispute but rather the differences in linker moiety and the Remarks do not point to specific differences in the linker structure affecting the function/effect of the siRNA conjugated to a GalNAc moieties via a linker. The Remarks further argue that Matsuda Formula II illustrates three consecutive nucleotides of an RNA molecule, each of which has a monovalent GalNAc moiety conjugated to the 2’ position of the ribose, and even if applicable, do not provide “guidance how or even whether to alter a triantennary GalNAc as in Li or in Formula I” (pg. 16-17). The argument is not persuasive. The purpose of Matsuda reference is to illustrate that as long as the triantennary GalNAcs are in close proximity they fulfill their intended function, which is to bind to the ASGPR receptor on hepatic cells and aid in delivering the siRNA molecule across the cell membrane, and that a skilled artisan would not consider the minor differences in the linker moiety to interfere with its binding function. The guidance is not “how or even whether to alter a triantennary GalNAc” but rather Matsuda’s guidance is that nucleoside-GalNAc monovalent that are clustered, i.e. on contiguous on 3 nt., behave like a trivalent ligand design (see pg. 1185), and this guidance provides that noted minor differences in linker molecule are not patentably distinct or are obvious based on prior art, since the siRNA molecule (i.e. R of claim 1) and GalNAc structure are indistinct from prior art. The Remarks also note that the claim has been amended to recite the full sequence, however the prior art of record reads on a couple of full antisense sequence of cl. 1. Thus the rejection is maintained. Conclusion THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Show 5 earlier events
Jun 28, 2024
Interview Requested
Jul 18, 2024
Examiner Interview Summary
Jul 22, 2024
Request for Continued Examination
Jul 26, 2024
Response after Non-Final Action
May 20, 2025
Non-Final Rejection mailed — §103, §112
Aug 19, 2025
Response Filed
Nov 06, 2025
Final Rejection mailed — §103, §112
Jan 06, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703863
AN RNA G-QUADRUPLEX STRUCTURE IN PRE-miRNA-1229 AS A THERAPEUTIC TARGET FOR ALZHEIMER'S DISEASE AND VARIOUS CANCERS
5y 3m to grant Granted Aug 11, 2026
Patent 12703865
SMALL INTERFERING RNA TARGETING C3 AND USES THEREOF
2y 3m to grant Granted Aug 11, 2026
Patent 12648958
TREM COMPOSITIONS AND USES THEREOF
1y 9m to grant Granted Jun 09, 2026
Patent 12630839
METHODS AND COMPOSITIONS FOR THE TREATMENT OF FABRY DISEASE
6y 4m to grant Granted May 19, 2026
Patent 12624356
COMPOUNDS AND METHODS FOR MODULATING PLP1
2y 10m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+64.0%)
3y 7m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 73 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month