DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election Restrictions
Applicant's election with traverse of Group II, drawn to a method of detecting (claims 13-19) in the reply filed on 06/16/2025 is acknowledged.
The traversal is on the ground(s) that: there should be no undue burden on the Examiner to consider all claims. This is not found persuasive because: as indicated in the Restriction Action more completely, the analysis used to determine the restriction requirement issued by the Examiner pertains to national applications filed under 35 U.S.C. 111(a) (independent and distinct analysis). See MPEP 823. Under the statute, the claims of an application may properly be required to be restricted to one of two or more claimed inventions only if they are able to support separate patents and they are either independent or distinct (MPEP § 802.01, § 806.06, and § 808.01)(MPEP § 806.05 - § 806.05(j)). See MPEP 803. Furthermore, a rationale was provided in the Restriction Action as to why restriction for examination purposes is proper, and the reasoning was provided as to how all the inventions listed in the Restriction Action are independent or distinct. Regarding the search, it is noted that a search for one group does not necessarily result in art related to another group, that is, in the instant case, prior art search for the method of Group II would not be co-extensive with prior art search for a product of group I and the considerations regarding each group of invention are not the same with respect to 35 U.S.C. 112 and 35 U.S.C. 101 statutes. Given that the reasoning for the Restriction Action was provided and that Applicant has not appeared to provide persuasive arguments as to how the inventions of Groups I-II are not independent or distinct; the requirement is still deemed proper and is therefore made FINAL.
Claims 1-12 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 9/10/2024.
Claims 13-19 are under examination on the merits.
Priority
Applicant’s claim for foreign priority of prior-filed Chinese application No. CN- 202210007779.4 filed on 01/06/2022 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The information disclosure statement (IDS) was submitted on 06/28/2022. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
The drawings were received on 06/28/2022. The drawings are objected to because figures 1-9 contain text that is illegible on the graphs as well as the keys.
Any structural detail that is essential for a proper understanding of the disclosed invention should be shown in the drawing. MPEP § 608.02(d). Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The use of the term ‘Tiangen Biotech’ on pages 15, 18, and 19 which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Note that ‘Tiangen Biotech’ is merely an example and all improper uses of trademarks in the specification should be identified by Applicant and properly addressed.
It is noted that the Specification is missing a paragraph indicating cross-references to related applications.
Claim Objections
Claims 13-16 are objected to because of the following informalities:
On claim 13, the following recitations bears typographical or grammatical errors. Appropriate correction is required.
“nucleic acid” on lines 2, 5 should read “nucleic acids”
“preparing recombinase dry powder and placing into a reaction tube” should read “preparing a recombinase dry powder and placing it into a reaction tube”
“Buffer” on lines 4, 6 should read “buffer”
On claim 14, the recitation of “comprises uvsY protein, ssb protein and Exo protein.” should read “comprises a uvsY protein, an ssb protein and an Exo protein. ”. Appropriate correction is required.
On claim 15, the recitation of “comprises 20ng/ L-50ng/ L of RecA protein, 10ng/ L-50ng/ L of usvY protein, 10ng/L-50ng/ L of DNA polymerase P, 30ng/L-100ng/ L of ssb protein, 20ng/ L-60ng/ L of Exo protein.” Should read “comprises 20ng/ L-50ng/ L of the RecA protein, 10ng/ L-50ng/ L of an usvY protein, 10ng/L-50ng/ L of a DNA polymerase P, 30ng/L-100ng/ L of an ssb protein, 20ng/ L-60ng/ L of an Exo protein.” Appropriate correction is required.
On claim 15, the recitation of “usvY” bears a typographical. It should read “UvsY”. Appropriate correction is required.
On claim 16, the recitation of “Deinococcus radiodurans” should be italicized “Deinococcus radiodurans” as it refers to a species. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 13-19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 13 recites "the sample to be tested". There is insufficient antecedent basis for this recitation in the claim. The dependent claims do not add additional clarity and, therefore, are also indefinite.
Claim 13 recites the term "shaking and mixing well”. It is unclear what this term refers to or how the term is to be understood. The specification lacks a proper definition of this term. It is unclear what is the difference between ‘mixing well’ and ‘mixing’. Further is not clear what is the distinction between “shaking” and “mixing” as both terms seems to accomplish the same process of forming a reaction mixture. The scope of the claimed invention is indefinite where the meets and bounds of the term were not defined in the specification. The dependent claims do not add additional clarity and, therefore, are also indefinite.
On claim 13, the recitation of “the nucleotide sequence is the sequence described in SEQ ID NO: 6”. It is not clear what “described” means. Further, it is not clear if Applicant intended to recite “comprising”, “consisting essentially of” or “consisting of” to define the scope of a claim in relation to SEQ ID NO: 6. See MPEP 2111.03. The dependent claims do not add additional clarity and, therefore, are also indefinite. For the purposes of compact prosecution and applying prior art, claim 13 was interpreted herein as reciting the open-ended language of comprising the SEQ ID NO: 6.
The term “novel” in claim 13 is a relative term which renders the claim indefinite. The term refers to something considered new at the present time, therefore the interpretation of the term and the claim relies on the time when the claim is considered. The dependent claims do not provide additional clarity. Therefore, the claims are indefinite.
Claim 15 recites “comprises 20ng/ L-50ng/ L of RecA protein”. There is insufficient antecedent basis for this recitation in the claim because independent claim 13 refers to “a novel RecA protein”. The language is inconsistent. Therefore, the claim is indefinite.
Claim 16 recites "the nucleotide sequence of the partial…". It is not clear whether the nucleotide sequence of claim 16 is the same as the nucleotide sequence in claim 13 because claim 13 refers to “a nucleotide sequence” of SEQ ID NO: 6. Therefore, the claim is indefinite.
On claim 16, the recitation of “the sequence shown in SEQ ID NO: 5 in the Sequence Listing, and the nucleotide sequence SEQ ID NO: 5 is a partial sequence…” renders the claim indefinite because it is not clear if Applicant intended to recite “comprising”, “consisting essentially of” or “consisting of” to define the scope of a claim in relation to SEQ ID NO: 5. See MPEP 2111.03. For the purposes of compact prosecution and applying prior art, claim 16 was interpreted herein as reciting the open-ended language of comprising SEQ ID NO: 5.
On claim 17, the recitation of “protein is shown in SEQ ID NO: 13” renders the claim indefinite because it is not clear if Applicant intended to recite “comprising”, “consisting essentially of” or “consisting of” to define the scope of a claim in relation to SEQ ID NO: 5. See MPEP 2111.03. For the purposes of compact prosecution and applying prior art, claim 17 was interpreted herein as reciting the open-ended language of comprising SEQ ID NO: 13.
Claim 17 recites “the T4 bacteriophage". There is insufficient antecedent basis for these recitations in the claim.
Claim 17 recites "the nucleotide sequence encoding the T4”, it is not clear whether the nucleotide sequence of claim 17 is the same as the nucleotide sequence in claim 13 because claim 13 refers to “a nucleotide sequence” of SEQ ID NO: 6. Therefore, the claim is indefinite.
On claim 18, the recitation of “whose sequence is shown in SEQ ID NO: 1 in the Sequence Listing; a downstream primer, whose sequence is shown in SEQ ID NO: 2 in the Sequence Listing; and a fluorescent probe sequence whose sequence is shown in SEQ ID NO: 3 in the Sequence Listing” renders the claim indefinite because it is not clear if Applicant intended to recite “comprising”, “consisting essentially of” or “consisting of” to define the scope of a claim in relation to SEQ ID NOs: 1-3. See MPEP 2111.03. For the purposes of compact prosecution and applying prior art, claim 18 was interpreted herein as reciting the open-ended language of comprising the SEQ ID NOs recited in claim 18.
Claim 18 recites "the primer-probe set". There is insufficient antecedent basis for this recitation in the claim. Therefore, the claim is indefinite.
Claim 19 recites "the concentration". There is insufficient antecedent basis for this recitation in the claim. Therefore, the claim is indefinite.
Claim 19 recites “the usvY protein”, “the DNA polymerase P”, “the ssb protein”, and “the Exo protein”. There is insufficient antecedent basis for this recitation in the claim because this claim depend on claim 13. Therefore, the claim is indefinite. For the purposes of compact prosecution and applying prior art, claim 19 was interpreted herein to depend on claim 15.
It is noted that any interpretation of the claims set forth above does not relieve Applicant of the responsibility of responding to this Office Action. If the actual interpretation of the claims is different than that posited by the Examiner, additional rejections and art may be readily applied in a subsequent final Office Action.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 13, 14 and 16-18 are rejected under 35 U.S.C. 103 as being unpatentable over US PG-Pub US 2020/0362399 A1 to Chen et al. published 11/19/2020, in view of Rajan R, et al. “Crystal structure of RecA from Deinococcus radiodurans: insights into the structural basis of extreme radioresistance”. J Mol Biol. 2004;344(4):951-963. Published 12/03/2004, and Gajewski S, et al. “Crystal structure of the phage T4 recombinase UvsX and its functional interaction with the T4 SF2 helicase UvsW.” J Mol Biol. 2011;405(1):65-76. Published 01/07/2011. (See PTO-892: Notice of References Cited for all three references)
See claims 13, 14 and 16-18 as submitted on 06/28/2022.
Regarding claim 13, Chen et al. teach a method for detecting African swine fever virus (ASFV) comprising recombinase-aided amplification (RAA) (Abstract). The method of Huang et al. includes the following steps:
extracting nucleic acid to be tested, (¶ [0076])
preparing a positive control and a negative control; (¶ [0077])
preparing recombinase dry powder and placing into a reaction tube, (¶ [0079])
adding a reaction buffer (buffer A), an upstream primer, a downstream primer, and a fluorescent probe; (¶ [0079]; Table 1)
adding the nucleic acid to be tested, the positive control and the negative control to the reaction tube, (¶¶ [0079], [0083]; Table 1)
then adding second buffer (buffer B), (¶ [0079]; Table 1)
mixing and centrifuging with an amplification instrument; (¶¶ [0079]-[0087])
performing isothermal amplification and fluorescence analysis of the sample with an amplification instrument; (¶¶ [0105]-[0108]; Fig. 6)
Chen et al. do not teach a RecA protein encoded by the nucleotide sequence of SEQ ID NO: 6.
It is noted that the nucleotide sequence of SEQ ID NO: 6 is 1197 nucleotides long and it comprises a gene fusion of a wild type Rec A from Deinococcus radiodurans with an insertion of a 105-nucleotide fragment of the wild type UvsX gene from T4 bacteriophage. UvsX of T4 phage is the ortholog gene of the bacterial RecA (See Specification page 10, Rajan et al. pages 1-3, Gajewski et al. pages 1-4.)
Rajan et al. teach a RecA protein of a Deinococcus radiodurans (Dr), wherein the Dr RecA protein is highly resistant to a broad spectrum of DNA damaging agents, it can recover from particularly high doses of ionizing radiation and it is capable of facilitating dsDNA break repair (Abstract, page 1, Figs. 1, 5). Rajan et al. further teach the Dr RecA is toxic to E. coli and difficult to express due to aggregation (page 1).
Gajewski et al. teach a soluble wild type ortholog UvsX protein sequence of a T4 phage comprising a 105-nucleotide fragment encoding the regions that account for the insertion between amino acid residues 890-993 of SEQ ID NO: 6 (pages 1-3, Fig. 1). The teachings of Gajewski et al. further show that the 105-nucleotide fragment that makes up the insertion in SEQ ID NO: 6 encodes an amino acid sequence 35 residues long comprising amino acids 286-320 of the UvsX amino acid sequence. Gajewski et al. further teach an alignment of the UvsX T4 phage against a canonical RecA amino acid sequence (Fig. 1) which demonstrates that the 35 residues long amino acid sequence that makes up the insertion in SEQ ID NO: 6 comprises strands β10 and β11 to create an extended β-hairpin. This extended β-sheet is exposed on the surface of UvsX protein and interacts with the solution (pages 3-4).
Given the teachings of Rajan et al. and Gajewski et al., it is noted that the gene fusion of instant SEQ ID NO: 6 comprises sequences of the Dr RecA protein taught by Rajan et al. (indicated under NCBI accession number 1XP8) and the insertion fragment from the wild type ortholog UvsX protein taught by Gajewski et al. These two amino acid sequences are encoded by nucleotide sequences that share sequence identity with instant SEQ ID NO: 6 as follows:
Nucleotides 1-888 share 100% sequence identity with Rajan et al.’s RecA (see alignment 1 below)
Nucleotides 889-993 share 100% sequence identity with Gajewski et al.’s et al. UvsX sequence (see alignment 2 below)
Nucleotides 994-1197 share 100% sequence identity with Rajan et al.’s RecA (see alignment 3 below)
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have constructed a fused gene for the RecA protein comprising the wild type Dr RecA with an insertion of the ortholog UvsX T4 phage sequence which comprises an extended β-sheet that is exposed on the surface of the protein and interacts with the solution given that the wild type Dr RecA was known to form aggregates and the ortholog UvsX T4 phage gene was known to have optimal expression and solubility. One of ordinary skill in the art would have been motivated to do so for the benefit of formulating a Dr RecA with higher solubility that is highly resistant to a broad spectrum of DNA damaging agents and is capable of facilitating dsDNA break repair. See MPEP 2144.07. The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).
Further, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have incorporated such RecA comprising the gene fusion as outlined above into the RAA method of Chen et al. for the benefit of including a Dr RecA highly resistant to a broad spectrum of DNA damaging agents.
One of ordinary skill in the art would have had reasonable expectation of success in formulating such RecA comprising the gene fusion as outlined above and including it in a method for DNA detection given that the wild type sequences and the structure features were known in the art and the methods of cloning and DNA detection with RecA proteins are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
PNG
media_image1.png
769
445
media_image1.png
Greyscale
Alignment 1: Qy: instant SEQ ID NO:6 nucleotides 1-888; Db: Rajan et al. Dr RecA NCBI accession number 1XP8 (P@N)
Alignment 2: Qy: instant SEQ ID NO:6 nucleotides 889-993; Db: Gajewski et al.’s et al. T4 phage UvsX sequence (P@N)
PNG
media_image2.png
328
816
media_image2.png
Greyscale
PNG
media_image3.png
493
813
media_image3.png
Greyscale
Alignment 3: Qy: instant SEQ ID NO:6 nucleotides 889-993; Db: Rajan et al.’s et al. NCBI accession number 1XP8 (P@N)
Regarding claim 14, Chen et al. further teach that an RRA reaction comprises a Rec protein, a UvsY protein, an ssb protein, a DNA polymerase, and an exonuclease, and these reagents are provided in powder form (¶¶ [0044]-[0048]).
Regarding claim 16, as indicated above Rajan et al. teach the wild type sequence of Dr RecA, this sequence shares 100% sequence identity with instant SEQ ID NO:5 (See alignment 4 below). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have constructed a fused gene for the RecA protein comprising the wild type Dr RecA with an insertion of the ortholog UvsX T4 phage sequence after nucleotides GACATC which encode amino acids D and I at positions 295 and 296 of the Dr RecA protein and lie before strands β10 and β11 to create an extended β-hairpin (Rajan et al. Fig. 1). This insertion point would have been prima facie obvious to one of ordinary skill in the art before the effective filing date because Gajewski et al. already teach that the soluble fragment comprising an extended β-sheet that is exposed on the surface of the protein lies before strands β10 and β11. See MPEP 2144.07. The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).
One of ordinary skill in the art would have had reasonable expectation of success in formulating such RecA comprising an insertion of the ortholog UvsX T4 phage sequence after nucleotides GACATC given that the wild type sequences and the structure features were known in the art and the methods of cloning are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
PNG
media_image4.png
840
436
media_image4.png
Greyscale
Alignment 4: Qy: instant SEQ ID NO:5 nucleotides 1-1092; Db: Rajan et al. Dr RecA NCBI accession number 1XP8 (P@N)
Regarding claim 17, as indicated above Gajewski et al. teach the wild type ortholog UvsX sequence which shares 100% identity with instant SEQ ID NO: 13 (See alignment 2 above).
Regarding claim 18, Chen et al. teach a primer-probe set for RAA-mediated ASFV amplification targeting the p72 gene and a FAM® fluorescent probe (¶ [0076]). Specifically, Chen et al. teach a forward primer SEQ ID NO:1 (GCCGAAGGGAATGGATACTGAGGGAATAGCAA) and a reverse primer SEQ ID NO:2 (TCCCGAGAACTCTCACAATATCCAAACAGCAG) (¶ [0076]). Chen et al.’s primer sequences were verified under PCR fluorescence reaction conditions, demonstrating that they could be detected normally and that the primers can be used in an RAA method (¶ [0077]). The resulting amplicon lies between nucleotides 1155 and 1374 of the ASFV p72 gene. As evidenced by the NCBI primer sequence design tool (publicly available online since 2012 at: https://www.ncbi.nlm.nih.gov/tools/primer-blast/), there is a great variety of primer sets that can be designed to amplify with reasonable expectation of success a ASFV p72 gene. In fact, the NCBI primer sequence design tool can be used to generate both primer sets, the one taught by Chen et al. and the one instantly claimed (See NCBI primer design results 1 and 7. See PTO-892: Notice of References Cited). Accordingly, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have generated a primer set comprising the sequences instantly claimed in SEQ ID NOs: 1 and 2 using the NCBI primer sequence design tool (or another primer design tool) given that the ASFV p72 sequence was known in the art and primer design tools have been readily available for example since 2012.
As to the probe sequence in instant SEQ ID NO: 3, Chen et al. teach that the probe sequence can be used to monitor the RAA amplification process given that the probe sequence must be located within the region between the forward and reverse primers (¶¶ [0003], [0038]). Accordingly, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have generated with reasonable expectation of success a probe sequence comprising the sequence in instant SEQ ID NO: 3 given that the primer sequences in instant in SEQ ID NOs: 1 and 2 can be generated with a primer design tool and a probe sequence was known to lie within the region between the forward and reverse primers. Furthermore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have included a FAM® fluorescent dye with the prove given that Chen et al. teach a probe comprising a FAM® fluorescent dye specifically for RAA detection (¶ [0076]).
Accordingly, claim 13, 14 and 16-18 were prima facie obvious to one of ordinary skill in the art before the effective filing date, especially in the absence of evidence to the contrary.
Claims 15, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al, Rajan et al. and Gajewski et al., as applied to claims 13, 14, and 16-18 above, further in view of patent application WO 2008/035205 A2 to Piepenburg et al. Published 03/27/2008. See PTO-892: Notice of References Cited.
See claims 15, and 19 as submitted on 06/28/2022.
Regarding claims 15, and 19, Chen et al. teach a RAA method wherein the dry powder reagent concentrations for an RAA reaction are as follows:
120 ng/μL of a RecA recombinase protein (SC-recA/BS-recA), (¶ [0082])
30 ng/μL of a DNA polymerase (E. coli DNA polymerase I, or DNA polymerase P, as recited in claims 15, 19) (¶¶ [0048], [0082])
90 ng/μL of a single-stranded DNA-binding protein (SSB) (¶ [0082])
100 ng/uL of an Exonuclease protein (¶ [0082])
While Chen et al. teach that a uvsY protein can be added to the RAA reaction, neither Chen et al. nor Rajan et al. nor Gajewski et al. teach the concentration present in an RAA reaction.
However, Piepenburg et al. teach an RAA method for nucleic acid detection (Abstract) wherein 30 ng/μl of uvsY protein are added to the reaction for effective amplification of duplex DNA sequences up to about 1 kilobase in length (Abstract, pages 1,6, 57).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have included a uvsY protein as taught by Piepenburg et al. into the RRA method of Chen et al, Rajan et al. and Gajewski et al. for the benefit of achieving effective amplification of duplex DNA sequences up to about 1 kilobase in length. Further it is noted that the concentrations recited in claims 15 and 19 are considered to be those determined by routine optimization according to one of skill in the art in view of the teachings of Chen et al. and Piepenburg et al.
One of ordinary skill in the art would have had reasonable expectation of success in incorporating these components into the RAA method of claim 13 given that RAA methods are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
Accordingly, claims 15 and 19 were prima facie obvious to one of ordinary skill in the art before the effective filing date, especially in the absence of evidence to the contrary.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARLENE V BUCKMASTER whose telephone number is (703)756-5371. The examiner can normally be reached M-R 8:00 AM - 5:00 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached on (571)270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MARLENE V BUCKMASTER/Examiner, Art Unit 1671
/THOMAS J. VISONE/Supervisory Patent Examiner, Art Unit 1671