DETAILED ACTION
The present application is being examined under the pre-AIA first to invent provisions.
Claims 1, 2, 5, 8 and 16-25 are pending.
This application is a continuation of U.S. Serial No. 17/497,045 filed 10/8/2021, now abandoned, which claims priority as a continuation of U.S. Serial No.16/398,691 filed 4/30/2019, now abandoned, which claims priority as a continuation of U.S. Serial No. 14/375,351 now U.S. patent 10,301,647, which is a 371 filing of PCT/IB2013/000198 filed 1/23/2013 which claims the benefit to EP 12000703.4 filed 1/27/2012.
The certified copy of EP 12000703.4 has been received and is in English.
Specification
The disclosure is objected to because of the following informalities: the brief description of the drawings should be inserted in line 26 on page 8 instead of on page 11. 37 CFR 1.77.
(b) The specification should include the following sections in order:
(1) Title of the invention, which may be accompanied by an introductory portion stating the name, citizenship, and residence of the applicant (unless included in the application data sheet).
(2) Cross-reference to related applications.
(3) Statement regarding federally sponsored research or development.
(4) The names of the parties to a joint research agreement.
(5) Reference to a "Sequence Listing," a table, or a computer program listing appendix submitted on a compact disc and an incorporation-by-reference of the material on the compact disc (see § 1.52(e)(5)). The total number of compact discs including duplicates and the files on each compact disc shall be specified.
(6) Statement regarding prior disclosures by the inventor or a joint inventor.
(7) Background of the invention.
(8) Brief summary of the invention.
(9) Brief description of the several views of the drawing.
(10) Detailed description of the invention.
(11) A claim or claims.
(12) Abstract of the disclosure.
(13) "Sequence Listing," if on paper (see §§ 1.821 through 1.825).
Appropriate correction is required.
Claim Objections
Claims 1, 11, 17 and 18 are objected to because of the following informalities: claim 1 is objected to for a number of grammatical informalities. A number of limitations are missing articles. In line 5, both human and mammalian requires the article “a”. Thereafter, in line 8, “mammalian” should be preceded with an article “the”. This is true of claim 10, 11, 17 and 18. Prior to human and mammalian. Similarly, in claim 21, mammalian requires the article “a” in lines 2 and 3. All independent limitations require their own articles to distinguish from compound limitations.
In claim 1, line 7, the claim has a grammatical inconsistency by referencing “a” “sequences”. Thereafter, reference to the NF-KN promoter
In claim 2, it appears that articles prior to each promoter is grammatically required.
As well, it is noted that in line 8, nucleic acid is for consistency “nucleic acid sequence”.
In line 11, IL-1Ra is spelled out fully. However, the abbreviation has been previously represented and thereafter, the abbreviation should be used.
In claims 17 and 18, the article “the” is necessary prior to human IL-1Ra for
Appropriate correction is required.
Claim Rejections - 35 USC § 112, first paragraph
The following is a quotation of the first paragraph of 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 18 is rejected under 35 U.S.C. 112, first paragraph, because claim 18 refers to biological deposits and to satisfy the “how to make” requirement must specify the details of the cell line such that one of skill in the art can produce the recited cells.
More particularly, claim 18 is drawn to or encompasses use of a specific sequence having Accession no: NM_173842. As such, this application discloses a molecule that is encompassed by the definitions for biological material set forth in 37 C.F.R. 1.801. Because it is apparent that this biological material is essential for practicing the claimed invention, it must be obtainable by a reproducible method set forth in the specification or otherwise be known and readily available to the public as detailed in 37 C.F.R. 1.801 through 1.809.
In order for a deposit to meet all criteria set forth in 37 C.F.R. 1.801 through 1.809, Applicant or Assignee must provide assurance of compliance with provisions of 37 C.F.R. 1.801-1.809 in the form of a declaration or Applicant’s representative must provide a statement. The content of such a declaration or statement is suggested by the encoded attachment. Because such deposit will not have been made prior to the effective filing date of the instant application, Applicant is required to submit a verified statement from a person in a position to corroborate the statement that the biological material which had been deposited is the biological material specifically identified in the applicants as filed (37 C.F.R. 1.804). Such a statement need not be verified if the person is an agent or attorney registered to practice before the Office. Applicant is also reminded that the specification must contain reference to the deposit, including deposit (accession) number, date of deposit, name and address of the depository, and the complete taxonomic description.
Claim Rejections - 35 USC § 112, first paragraph
The following is a quotation of the first paragraph of 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 21-25 are rejected under 35 U.S.C. 112, first paragraph, because the specification, while being enabling for treating osteoarthritis in a human or a mammalian joint by intraarticular administration of a helper-dependent adenoviral vector comprising a nucleic acid sequence encoding for a human or a mammalian interleukin-1 receptor antagonist (IL- 1Ra), a left and a right inverted terminal repeats (L ITR and R ITR), an adenoviral packaging signal and a non-viral, non-coding stuffer nucleic acid sequences, wherein the expression of the nucleic acid encoding for the IL-1Ra gene is under control of the NF-kB promoter, which is located upstream of the reading frame of the nucleic acid sequence encoding for the IL-1Ra thus leading to expression of the IL-1Ra in the synovial cells of the joint to inhibit IL-1 and trat OA, does not reasonably provide enablement for any other embodiment. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the patent coupled with information known in the art without undue experimentation (United States v. Telectronics, Inc., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is required is not based on a single factor but is rather a conclusion reached by weighing many factors (See Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter, 1986) and In re Wands, 8USPQ2d 1400 (Fed. Cir. 1988); these factors include the following:
1) Nature of invention. The instant claims are drawn to gene therapy by introducing IL-1Ra into a synovium of a subject.
2) Scope of the invention. The scope of the invention is extremely broad in that the subject is any even one at risk of osteoarthritis. Furthermore, the promoter is defined in terms of one that mediates expression as a one-component inflammation inducible promoter activated by an immune stimulatory substance. However, as set forth below, the functionality of the vector in the method is shown only with NF-kB.
3) Number of working examples and guidance. The specification teaches a single design.
PNG
media_image1.png
233
626
media_image1.png
Greyscale
Intraarticular injection in mice led to expression in the synovium (Figure 3). As to prevention, Figure 5 shows that mice injected with HDAd-IL-1Ra were then induced by cruciate ligament transduction. The mice had lower osteoarthritic scores. Figure 6 showed treatment after OA wherein they exhibited higher cartilage area.
4) State of the art. Osteoarthritis is a disease of the articular cartilage wherein the role of IL-1 and TNF-alpha was known (see abstract, Calich (Clin Rheumatol, 2010, pages 451-455)). Inhibiting IL-1 was shown to reduce the severity of OA by administering IL-1Ra protein and genes as well as with diacerein and anakinra (recombinant IL-1RAa). The short half-life of the recombinant protein was theorized to diminish successful results (see page 452, col 2). The results have theorized that gene transfer maybe the most promising therapy (page 454, col 1).
5) Unpredictability of the art. The claims require predicting the subjects that would require treatment which would be highly unpredictable. In humans, the claimed diseases are usually established before therapy is offered. The specification does not adequately teach how to effectively predict for whom prevention would be required. One establishes a large genus of target subjects for whom the method is intended, however, establishing whether a person or persons actually requires the treatment is a highly unpredictable art. Screening procedures for indications of those requiring inhibition of the onset of disease are unknown and highly prejudicial leading to conditions in which those who require the treatment cannot be distinguished from those who do not. At the time of filing, there was no means of predicting a subject at risk of osteoarthritis. Much later than the filing, there was an effort to find predictive means of identifying such subjects (Halilaj et al, Osteoarthritis and Cartilage, 2018, pages 1643-1650, especially page 1644).
The development of robust preventative measures and disease-modifying treatments is partly limited by the current inability to accurately predict OA progression. Although OA is classically described as slowly progressing, recent evidence indicates that in addition to its diverse and multifactorial etiology, the disease is also heterogeneous in how it progresses across the affected population.
The physiological art is recognized as unpredictable. (MPEP 2164.03.) In cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws. In cases involving unpredictable factors, such as most chemical reactions and physiological activity, the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved. In this case, applicants exacerbate the unpredictability of the art by reciting subjects to be targeted for whom the disease must be prevented.
Secondly, the claims are drawn to delivery of IL-1Ra using any immune stimulatory responsive promoter. Claim 2 provides a list of potential promoters. However, the only promoter shown to express Il-1Ra for improving OA in the knee in the models was NF-kB. The review of Defois (Journal of Cartilage & Joint Preservation, 2024, pages 1-10) states,
This review then highlights that the use of hybrid serotypes and/or chemical modifications of capsids are promising for improved tissue targeting. In addition, the choice of promoter and type of vectorized nucleic acid (single- or double-stranded DNA) appears to be critical for efficient transgene expression.
Hence, the choice of the promoter is not trivial. This review, many years post filing teaches only NF-kB for Il-1Ra (see table page 7 and page 10, last ¶).
Furthermore, the relationship of enablement with the requirement for written description is acknowledged by the MPEP. To this end, the court and the Board have repeatedly held (Amgen Inc. v. Chugai Pharmaceutical Co. Ltd.,18 USPQ2d 1016 (CA FC, 1991); Fiers v. Revel, 25 USPQ2d 1601 (CA FC 1993); Fiddes v. Baird, 30 USPQ2d 1481 (BPAI 1993) and Regents of the Univ. Calif. v. Eli Lilly& Co., 43 USPQ2d 1398 (CA FC, 1997)) that an adequate written description of a nucleic acid requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it, irrespective of the complexity or simplicity of the method; what is required is a description of the nucleic acid itself. It is not sufficient to define DNA solely by its principal biological property, because disclosure of no more than that, as in the instant case, is simply a wish to know the identity of any DNA with that biological property. Naming a type of material generically known to exist, in the absence of knowledge as to what that material consists of, is not a description of that material. When one is unable to envision the detailed constitution of a complex chemical compound having a particular function, such as a nucleic acid, so as to distinguish it from other materials, as well as a method for obtaining it, conception has not been achieved until reduction to practice has occurred, i.e., until after the nucleic acid has been isolated. Thus, claiming all DNA's that achieve a result without defining what means will do so is not in compliance with the description requirement. Rather, it is an attempt to preempt the future before it has arrived. Also, where a claim purports to cover all promoters that can mediate OA therapy and are activated by immune stimulatory substances and the specification discloses but a single DNA known to do so, the situation is analogous to a single means claim and does not meet the enablement requirement under para. 1 ' of§112
6) Undue experimentation. The claims have been evaluated in light of the art at the time of filing and found not to be commensurate in scope with the specification. MPEP 2164.05 teaches, “However, the examiner should carefully compare the steps, materials, and conditions used in the experiments of the declaration with those disclosed in the application to make sure that they are commensurate in scope; i.e., that the experiments used the guidance in the specification as filed and what was well known to one of skill in the art. Such a showing also must be commensurate with the scope of the claimed invention, i.e., must bear a reasonable correlation to the scope of the claimed invention. Consequently, the prior art (and post-filing art) when combined with the lack of any disclosed direct experimental test of Applicant's hypothesis, shows that one of skill in the art at the time the invention was made would have had no basis to reasonably predict or conclude the claimed sequences could be identified given the lack of details necessary to identify those meeting the necessary functions. Though not controlling, the lack of working examples, is, nevertheless, a factor to be considered in a case involving both physiological activity and an undeveloped art. When a patent applicant chooses to forego exemplification and bases utility on broad terminology and general allegations, he runs the risk that unless one with ordinary skill in the art would accept the allegations as obviously valid and correct, the PTO may, properly, ask for evidence to substantiate them. Ex parte Sudilovsky, 21 USPQ2d 1702, 1705 (BPAI 1991); In re Novak, 134 USPA 335 (CCPA 1962); In re Fouche, 169 USPQ 429 (CCPA 1971).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102 of this title, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
Claims 1, 2, 5, 8, 16, 17, 19, 21, 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 42, No. 10, 684-695,
October 2010) in view of Adriaansen et al (Ann Rheum Dis 2007, pages 1143-1150) and Ross et al (J Virol 2009, 83(17), 8409--8417) and Vetrini and Ng (Viruses, 2010, page 1886-1917).
The instant claims are drawn to a composition comprising a helper dependent adenoviral vector comprising a left and right ITR, a packaging signal, non-viral non-coding stuffer sequences and further comprises a nucleic acid encoding IL-1Ra under control of one component immune stimulatory substance i.e. NF-kB promoter.
Chen et al teach an adenovirus vector (see page p 691, col 1, ¶3). The vector encodes Il-1Ra operably linked to expression control sequences (see page 691, col 1, ¶3). The construct is used to treat OA.
As to promoter choices, the choice of NF-KB is an obvious as shown by the comparison and improved results with an NF-KB promoter over CMV by Adriaansen et al, page 1145, col 1 and 1149, col 1).
Other improvements in the art were use of helper-dependent adenovirus (HDAd) as a promising therapeutic gene delivery vehicle. These vectors are improved by non-viral non-coding stuffer sequences (see Ross et al, abstract and page 8409, col 1). HDAd vectors can enhance the duration of expression of a therapeutic gene; studies of mice and nonhuman primates have yielded several years of gene expression after a single administration. Furthermore, use of eukaryotic stuffer DNA led to an increase of transgene expression (see e.g. page 8409, col 1).
Similarly, Vetrini and Ng demonstrate that at the time of filing, a person of skill in the art would
have considered HDAd viruses to be the superior choice for vector development. This reference
teaches long term efficacious effects were noted in mice (see page 1892, 1 2) with reduced
toxicity (see page 1892, 3) which results were repeated in nonhuman primates (page 1893, 13). At the same time, disappointing results with AAV (see page 1896, 1 3) would have led a
practitioner to experiment with other viral vectors and this is the very suggestion presented by
Vetrini and Ng. Hence, a person of skill in the art would have considered use of HDAd for vector
design. The success of the vector could not be evaluated absent such a consideration.
It would have been obvious to one of ordinary skill in the art at the time the invention
was made to use the NF-KB promoter of Adriaansen et al in place of the CMV promoter given the benefits demonstrated by Adriaansen. As well, it would have been obvious to use an adenoviral helper vector with the constructs taught by Chen et al because Chen et al teach that it is within the ordinary skill of the art to express Il-1Ra from adenovirus and because Ross et al teach use of IL-1 induced promoters (immune stimulatory) promoters for treatment of osteoarthritis and Ross et al and Vetrini and Ng teach that it is within the ordinary skill of the art to use helper adenovirus with stuffer sequences. One would have been motivated to do so in order to receive the expected benefit of disease specific promoters and the ability to mediate high level transgene expression with negligible chronic toxicity (see abstract and page 1661, col 1-2). Thus, a person of ordinary skill in the art, absent evidence to the contrary, would have reasonably expected that the expanded method would allow improved treatment.
As recited in claim 2, 16 and 19, the promoter ius NF-KB as taught by Adriaansen et al.
Furthermore, Chen teaches the inclusion of a marker (see page 691, col 1) as recited in claim 5.
As recited in claim 8, the virus is part of a pharmaceutical composition and it is furthermore used to treat OA (see page 692, col 1-2).
Claims 18, 20, 23 and 25 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al (EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 42, No. 10, 684-695,
October 2010) in view of Adriaansen et al (Ann Rheum Dis 2007, pages 1143-1150) and Ross et al (J Virol 2009, 83(17), 8409--8417) and Vetrini and Ng (Viruses, 2010, page 1886-1917) as applied to claims 1, 2, 5, 8, 16, 17, 19, 21, 22 and 24 above, and further in view of Eisenberg et al (Nature, 1990, pages 341-346)
Missing from the above teachings is the exact sequence claimed in claim 18. However, the sequence was well known in the art as demonstrated by Eisenberg et al (see and provided below.
Query 1 ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 24 ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT 83
Query 61 TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 84 TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC 143
Query 121 TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTG 180
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct 144 TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCTGGATACTTG 203
Query 181 CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 204 CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT 263
Query 241 CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 264 CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG 323
Query 301 ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 324 ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC 383
Query 361 AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 384 AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC 443
Query 421 TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 444 TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT 503
Query 481 ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAG 531
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 504 ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAG 554
In KSR International Co. v. Teleflex lnc., 82 USPQ2d 1385 (U.S. 2007), the Supreme Court particularly emphasized "the need for caution in granting a patent based on a combination of elements found in the prior art," (Id. At 1395) and discussed circumstances in which a patent might be determined to be obvious. Importantly, the Supreme Court reaffirmed principles based on its precedent that obviousness in part is predicated on use of particular known techniques that are recognized as part of the ordinary capabilities of one skilled in the art. In the instant case, it is accepted that use of known sequences such as that of Ross et al is done applying a known technique to a known method to improve the vector with predictable results. As well, it is within the ordinary skill of the art to use available methodologies to isolate a variety of Il-1Ra sequences and one would have been motivated to do so in order as the ability to modify vectors by applying conventional methodologies. Based upon the teachings of the cited references, the high skill of one of ordinary skill in the art, and absent evidence to the contrary, there would have been a reasonable expectation of success to result in the claimed invention.
Double Patenting
A rejection based on double patenting of the "same invention" type finds its support in the language of 35 U.S.C. 101 which states that "whoever invents or discovers any new and useful process ... may obtain a patent therefor ..." (Emphasis added). Thus, the term "same invention," in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957); and In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970).
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. See In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970);and, In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the conflicting application or patent is shown to be commonly owned with this application. See 37 CFR 1.130(b).
Effective January 1, 1994, a registered attorney or agent of record may sign a terminal disclaimer. A terminal disclaimer signed by the assignee must fully comply with 37 CFR 3.73(b).
Claims 1, 2, 5, 8 and 16-25 are rejected under the judicially created doctrine of obviousness-type double patenting as being unpatentable over claims 1-6 of U.S. Patent 11,746,359.
An obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but an examined application claim is not patentably distinct from the reference claims because the examined claim is either anticipated by, or would have been obvious over, the reference claims.
Although the conflicting claims are not identical, they are not patentably distinct from each other because the cited claims of the instant invention are generic to all that is recited in claims 1-6 of U.S. Patent 11,746,359. That is, the cited claims of U.S. Patent 10,301,647 anticipate and fall entirely within the scope of the rejected claims of the instant application. Specifically, U.S. Patent 11,746,359 is drawn to a composition comprising the HDAd recited in the instant claims with additional sequences. The sequences claimed in claims 4-6 (see SEQ ID NO:7) match the Accession no:NM_173842.
Query 1 ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT 60
Query 61 TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC 120
Query 121 TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTG 180
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct 121 TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCTGGATACTTG 180
Query 181 CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT 240
Query 241 CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG 300
Query 301 ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC 360
Query 361 AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC 420
Query 421 TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT 480
Query 481 ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAG--- 531
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG 534
As to the methods of using, the claims are not filed as divisionals and the courts have established that “[t]here is nothing that prevents us from looking to the specification [of the ’165 patent] to determine the proper scope of the claims.” Wherein the relevant claims of the two applications are not patentably distinct, when the claims at issue merely recited methods of administering therapeutically-effective amounts of the compositions claimed or means of making and no safe harbor exists.
Additionally, if a patent resulting from the instant claims was issued and transferred to an assignee different from the assignee holding the U.S. Patent 11,746,359, then two different assignees would hold a patent to the claimed invention of U.S. Patent 11,746,359, and thus improperly there would be possible harassment by multiple assignees.
Claims 1, 2, 5, 8, 16. 17 and 19-25 are rejected under the judicially created doctrine of obviousness-type double patenting as being unpatentable over claims 1-7 of U.S. Patent 10,301,647.
An obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but an examined application claim is not patentably distinct from the reference claims because the examined claim is either anticipated by, or would have been obvious over, the reference claims.
Although the conflicting claims are not identical, they are not patentably distinct from each other because the cited claims of the instant invention are generic to all that is recited in claims 1-7 of U.S. Patent 10,301,647. That is, the cited claims of U.S. Patent 10,301,647 anticipate and fall entirely within the scope of the rejected claims of the instant application. Specifically, U.S. Patent 10,301,647 is drawn to a composition comprising the HDAd recited in the instant claims with additional sequences. The sequences claimed in U.S. Patent 10,301,6478 Aare generically encompassed by the instant claims. As to the methods of using, the claims are not filed as divisionals and the courts have established that “[t]here is nothing that prevents us from looking to the specification [of the ’165 patent] to determine the proper scope of the claims.” Wherein the relevant claims of the two applications are not patentably distinct, when the claims at issue merely recited methods of administering therapeutically-effective amounts of the compositions claimed or means of making and no safe harbor exists.
Additionally, if a patent resulting from the instant claims was issued and transferred to an assignee different from the assignee holding the U.S. Patent 10,301,647, then two different assignees would hold a patent to the claimed invention of U.S. Patent 10,301,647, and thus improperly there would be possible harassment by multiple assignees.
Claims 1, 2, 5, 8 and 16-25 are provisionally rejected under the judicially created doctrine of obviousness-type double patenting as being unpatentable over claims 1-24 and 26 of U.S. serial number 18/352,471.
An obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but an examined application claim is not patentably distinct from the reference claims because the examined claim is either anticipated by, or would have been obvious over, the reference claims. Although the conflicting claims are not identical, they are not patentably distinct from each other because the cited claims of the instant invention are generic to all that is recited in claims 1-24 and 26 of U.S. serial number 18/352,471. That is, the cited claims of U.S. serial number 18/352,471 anticipate and fall entirely within the scope of the rejected claims of the instant application. Specifically, U.S. serial number 18/352,471 is drawn to a composition comprising the HDAd recited in the instant claims with additional sequences. The sequences claimed in claims 4-6 (see SEQ ID NO:7) match the Accession no:NM_173842.
Query 1 ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCACTCTCCTCCTCTTCCTGTTCCAT 60
Query 61 TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 TCAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATC 120
Query 121 TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTG 180
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct 121 TGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCTGGATACTTG 180
Query 181 CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 CAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCT 240
Query 241 CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 CTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAG 300
Query 301 ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 ACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGAC 360
Query 361 AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCC 420
Query 421 TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 TGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAAT 480
Query 481 ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAG--- 531
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 ATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG 534
The method of treatment claims in claim 26 overlaps that in claims 21-25 of the instant claims. Additionally, if a patent resulting from the instant claims was issued and transferred to an assignee different from the assignee holding the U.S. serial number 18/352,471, then two different assignees would hold a patent to the claimed invention of U.S. serial number 18/352,471, and thus improperly there would be possible harassment by multiple assignees.
This is a provisional obviousness-type double patenting rejection because the conflicting claims have not in fact been patented.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARIA MARVICH whose telephone number is (571)272-0774. The examiner can normally be reached on 8 am - 5 pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria Leavitt can be reached on 571-272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MARIA MARVICH/
Primary Examiner, Art Unit 1633
Prosecution Insights