DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Status of the Application
Claim(s) 1-6 are pending and under examination
The following Office Action is in response to Applicant's communication dated 08/15/2022.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 1-6 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recited “a nucleic acid sequence free of repetitive elements set forth in Table A, B, C, or D”. The placement of the phrase “set forth in Table A, B, C, or D” leaves unclear whether this phrase modifies “a nucleic acid” or “repetitive elements”. There are two interpretations for such phrasing:
Tables identify the reference sequences which the tested nucleic acids must match.
Tables identify the repetitive elements which tested nucleic acids must be free of.
The relationship between the table reference and the preceding limitations is unclear. Hence the claim is indefinite and the metes and bounds of the claim are unascertainable.
For purposes of examination only, and to facilitate a complete analysis of the claim, the Examiner interprets the “set forth in Table A, B, C, or D” as the tables identify the sequences the tested nucleic acids must be compared and match with (interpretation 1). This interpretation is supported by Applicant’s specification ¶0013. This interpretation is adopted solely for examination and does not resolve the lack of clarity in the claim language.
Additionally, claim 1 currently makes reference to Table A, B, C, or D and claim 3 makes reference to Table C or D in the specification. However, as per MPEP § 2173.05(s), “[w]here possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table ‘is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.’ Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).” In the present case, Table A contains SEQ ID NOS:1-1072; Table B contains SEQ ID NOS:1073-1916; Table C contains SEQ ID NOS:1917-1968; Table D contains SEQ ID NOS:1969-1972, thus, one possibility to overcome the rejection would be to amend the claim to replace “Table A” with “SEQ ID NO: 1-1072”; “Table B” with “SEQ ID NOs: 1073–1916”; “Table C” with “SEQ ID NOs: 1917–1968”; “Table D” with “SEQ ID NOs: 1969–1972”. Other solutions are also possible.
Claim(s) 2-6 depend on claim 1 and is/are therefore similarly rejected.
Claims 5 contains trademark/trade name “Illumina” and “SOLiD”. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade names are used to identify/describe commercially available photoresists and, accordingly, the identification/description is indefinite.
Given that a trademark or trade name is used to identify a source of goods, and not the goods themselves, it is suggested that Applicant amend the claims to properly define sequencing platform (e.g. using generic descriptions).
Claim Rejections - 35 USC § 101
Claims 1-6 are rejected under 35 U.S.C. 101 because the claimed invention(s) is/are directed to one or more judicial exceptions (i.e., product of nature, a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Claims 1 and 2 is directed to the abstract idea of “identifying in the sample the presence of a nucleic acid having at least 20 contiguous nucleotides of a nucleic acid sequence free of repetitive elements set forth in Table A, B, C, or D”, which is reasonably recites so-called “Mental Process” as per MPEP § 2106.04(a)(2)(III). For example, a person can inspect an obtained nucleotide sequence and a selected reference sequence to identify a matching contiguous segment. This evaluation can be done mentally with written sequences and fall within the mental processing grouping. Therefore, the claims recite one or more judicial exceptions as per Prong One of the revised Step 2A analysis from the 2019 Revised Patent Subject Matter Eligibility Guidance issued Jan. 7, 2019 in the Federal Register Vol. 84, No. 4. The same Guidance requires analysis of Prong Two, which is whether the claim recites additional elements that integrate the exception(s) into a practical application of that exception(s).
Note that MPEP 2106.04(II)(B) states:
In other claims, multiple abstract ideas, which may fall in the same or different groupings, or multiple laws of nature may be recited. In these cases, examiners should not parse the claim. For example, in a claim that includes a series of steps that recite mental steps as well as a mathematical calculation, an examiner should identify the claim as reciting both a mental process and a mathematical concept for Step 2A Prong One to make the analysis clear on the record. However, if possible, the examiner should consider the limitations together as a single abstract idea for Step 2A Prong Two and Step 2B (if necessary) rather than as a plurality of separate abstract ideas to be analyzed individually. (emphasis added)
In Step 2B, claim 1 must further be analyzed to identify additional elements to determine whether the claim, as a whole, amounts to significantly more than the judicial exception(s). For claim 1 the additional elements consist of:
obtained from the blood, serum or plasma sample
sequencing cfDNA
These steps all constitute routine, convention, and well-understood activities known in the industry at the time of the invention, specified as a high level of generality, and therefore are not enough to qualify as “significantly more” when recited with the judicial exception(s) of the claim. This is equally true both when considering the steps individually and as an ordered combination. The additional limitations can also be considered to be insignificant extra-solution activity (specifically data gathering steps), which, as per MPEP § 2106.05 (d), (g), as explained by the Supreme Court, the addition of insignificant extra-solution activity does not amount to an inventive concept, particularly when the activity is well-understood or conventional.
Claim 3 limits the reference sequences to tables C or D, narrowing information evaluated without adding a practical application or significantly more.
Claim 4 merely further limits nucleic acid sample to come from patient who is suspected of having colorectal cancer. This limitation does not change the sequencing or evaluation steps or require a particular treatments.
Claim 5 merely further limits sequencing technique as Illumina or SOLiD next generation sequencing platform, which are routine, conventional, and well-understood . This limitation does not add significantly more to the judicial exception, and cannot transform the claims into patent eligible subject matter.
Claims 6 adds determination of normalized copy number. This limitation encompasses calculating a relative count using a reference quantity, it further recites an abstract mathematical calculation as per MPEP § 2106.04(a)(2)(I). Therefore, the claims recite one or more judicial exceptions as per Prong One of the revised Step 2A analysis from the 2019 Revised Patent Subject Matter Eligibility Guidance issued Jan. 7, 2019 in the Federal Register Vol. 84, No. 4. The same Guidance requires analysis of Prong Two, which is whether the claim recites additional elements that integrate the exception(s) into a practical application of that exception(s). However, the claim does not have additional elements to be analyzed to identify additional elements to determine whether the claim, as a whole, amounts to significantly more than the judicial exception(s). Additionally, claim 6 does not require a particular normalization technique that improves sequencing or another technological process. Hence, the dependent limitation do not integrate an abstract idea to a practical application or provide significantly more.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(b) the invention was patented or described in a printed publication in this or a foreign country or in public use or on sale in this country, more than one year prior to the date of application for patent in the United States.
Claim(s) 1-3 and 5-6 rejected under pre-AIA 35 U.S.C. 102(b) as being anticipated by Lo et al. (US20090029377A1, Published: January 29th 2009).
Regarding claims 1-3, Lo discloses method of detecting a circulating free DNA (cfDNA) (e.g. plasma DNA was used for DNA library preparation [¶0052, 0065, 0072, 0093].), comprising:
sequencing cfDNA (e.g. Nucleic acid molecules of the biological sample are sequenced [¶0050, 0056, 0093])
identifying in the sample the presence of a nucleic acid having at least 20 contiguous nucleotides of a nucleic acid sequence (free of repetitive elements) set forth in Table A, B, C, or D, thereby detecting the cfDNA from the at least one chromosomal region. (e.g. Sequenced reads were compiled, then aligned to the repeat-masked reference human genomic sequence, NCBI 36 assembly (GenBank accession numbers: NC—000001 to NC—000024), using the Eland application [¶0093]. Lo further discloses abnormalities are determined by counting how many tagged fragments map to a specific chromosome or region, wherein the selectively counted fragments fall under specific size thresholds (like <300 bp, <200 bp, or <100 bp) [¶0071] or 36 bp specifically [¶0111].)
Supporting sequence evident: NCBI Reference Sequence NC—000001.1, dated August 29th 2002, in NCBI’s sequence revision history, discloses the following sequence at positions 23,722,510 to 23,722,669 [Evidence of sequence submission date and alignment is attached as NPL]:
TCTATCTAAATAAGATCTTTTGATGTGGGTCATTCATGAAACTAAAGCAAACAGATGAAGCCTACTAAGATCTTGAAGGTTTGGATTGTCAAAGAGCCTGCCCCATTCAGCCGTGTCATTCAGCACAGCCCGTGACTGTTCGGCCCCAAGGCAGTTGATG
This 160-nucleotide segment is identical to “HS1 24210790-2421094” sequence in Applicant’s specification (filed 08/15/2022) Table C [page 241 lines 26-29]. Hence, the cited database record shows this table C segment was present in the historical human reference sequence.
Regarding claim 5, Lo discloses performing sequencing reactions to sequence cell-free DNA isolated from the sample using an Illumina or SOLiD next generation sequencing platform. [¶0056, 0070, 0073, 0086, 0087, 0092, 0093]
Regarding claim 6, Lo discloses normalized copy number of the nucleic acid. (e.g. obtain a normalized frequency within a reference range by taking into account of the relative size of the analyzed fragments [¶0069])
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 4 is/are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over
Lo et al. (US20090029377A1, Published: January 29th 2009) in view of Leary et al. (Sci. Transl. Med.2,20ra14-20ra14(2010); published February 2010).
Regarding claim 4, Lo does sequencing method can be used to detect specific cancer, however, Lo does not disclose samples that came from patient, who is suspected of having colorectal cancer.
Leary discloses analyzing circulating DNA obtained from plasma of colon cancer patient Hx402 and Hx403 [table 1, method and material section]. Leary further teaches chromosomal instability, including copy number alterations and rearrangements, and shown that tumor associated rearrangements can be detected in these patient plasma samples.
As of the application’ s effective filing date, it would have been prima facie obvious to a person of ordinary skill in the art to apply Lo’s plasma DNA sequencing and alignment method to samples from patients who is suspected of having colorectal cancer because Leary teaches plasma contains detectable DNA reflecting colorectal-tumor genomic alterations, while Lo supplies the sequencing base method to generate align sequence reads from such plasma DNA and its chromosomal origins. A skilled artisan would have been motivated to use Lo’s method as another diagnostic tool for detecting colorectal cancer since the method is reportedly noninvasive, high sensitivity, and specificity to minimize false negatives and false positives [Lo ¶0013].
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
U.S. 11,414,706 B2
Claim(s) 1, 2, and 6 rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 1 and 3 of U.S. Patent No. 11414706 (the '706 patent). Although the claims at issue are not identical, they are not patentably distinct from each other because the rejected claims of the present invention would be anticipated and/or rendered obvious by the subject matter in the claims of the reference patent.
Regarding present claim(s) 1 and 2, the claim of the ‘706 patent discloses method of detecting a circulating free DNA (cfDNA) from at least one chromosomal region in cfDNA obtained from a blood, serum or plasma sample from a human patient, comprising: sequencing cfDNA obtained from the blood, serum or plasma sample, and identifying in the sample the presence of nucleic acid (s) having at least 20 contiguous nucleotides of a nucleic acid sequence free of repetitive elements set forth in Table A, B, C, or D, thereby detecting the cfDNA from the at least one chromosomal region. (e.g. as per claim(s) 1 and 3 of the ‘706 patent)
Regarding present claim(s) 6, the claim of the ‘706 patent discloses determining the normalized copy number of the nucleic acid. (e.g. as per claim(s) 1 of the ‘706 patent)
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Khai Quynh Tien Pham whose telephone number is (571)272-6998. The examiner can normally be reached M-T, 9-4 ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached at (571) 272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KHAI QUYNH TIEN PHAM/ Examiner, Art Unit 1684
/JEREMY C FLINDERS/ Primary Examiner, Art Unit 1684
