Prosecution Insights
Last updated: April 19, 2026
Application No. 17/904,568

METHODS FOR DETECTING NTRK GENE FUSION USING RNA IN SITU HYBRIDIZATION

Non-Final OA §103
Filed
Aug 18, 2022
Examiner
SWITZER, JULIET CAROLINE
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The General Hospital Corporation
OA Round
3 (Non-Final)
42%
Grant Probability
Moderate
3-4
OA Rounds
3y 10m
To Grant
95%
With Interview

Examiner Intelligence

Grants 42% of resolved cases
42%
Career Allow Rate
207 granted / 496 resolved
-18.3% vs TC avg
Strong +53% interview lift
Without
With
+53.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
48 currently pending
Career history
544
Total Applications
across all art units

Statute-Specific Performance

§101
18.7%
-21.3% vs TC avg
§103
23.4%
-16.6% vs TC avg
§102
17.9%
-22.1% vs TC avg
§112
29.1%
-10.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 496 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 1/2/26 has been entered. REQUIREMENT FOR UNITY OF INVENTION During a telephone conversation with Peter Schlueter on 5/12/2025 a provisional election was made without traverse to prosecute the invention of group I, claims 1-14, 35-36, 38-40, 42, 66-70. Affirmation of this election must be made by applicant in replying to this Office action. Claims 75-91, 93-95 are withdrawn from further consideration by the examiner, 37 CFR 1.142(b), as being drawn to a non-elected invention. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 1, 9, 10, 11, 12, 14, 35, 36, 38, 39, 40, 66, 69, and 96 is/are rejected under 35 U.S.C. 103 as being unpatentable over Solomon et al. (Annals of Oncology 30 (Supplement 8): viii16–viii22, 2019) in view of Markey et al., Chen et al. (Science348,aaa6090(2015).DOI:10.1126/science.aaa6090) and Hechtman et al. (Am J Surg Pathol 2017;41:1547–1551). Solomon teaches that a multitude of 5’ fusion partners have been described for NTRK1, NTRK2, and NTRK3, and that these are characteristic of a few types of rare cancer and are also seen on common cancers (p. 1). The reference further teaches that in-frame fusion to the kinase domain results in constitutive activation of the receptors (p. 1). The reference teaches that there are a multiple of methods for detecting NTRK fusions. The reference teaches FISH detection of DNA structural variants but while a positive result with a break-apart probe shows the presence of a structural variant involving the probed gene, whether the abnormality results in a functional transcribed fusion cannot be determined (p. 2). Furthermore, Solomon teaches the screening of patients having a variety of cancers, including colon cancer (p. 2), and also the treatment of cancer having the fusion with a drug that targets NTRK, including larotrectinib (p. 2). Solomon teaches NTRK fusions include LMNA-NTRK1 and ETV6-NTRK3 (p. 2). Solomon teaches FISH can detect fusions in solid tumors (p. 2). Solomon does not teach RNA FISH detection of the NTRK1, NTRK2 and NTRK3 genes, nor does the reference teach a pool of probes for detecting fusions in one or more of these genes. Markey teaches a method for in situ detection of transcripts encoded by gene fusions in which approximately 50 short fluorescent probes bind to adjacent sites on the same mRNA molecule rendering each molecule visible (abstract, throughout). The method is demonstrated with two different fusion transcripts, and the reference teaches the method will pave the way for accurate in situ typing of many cancers that are associated with or caused by fusion transcripts (abstract, throughout). With regard to claim 96, Markey teaches that the probes used were specific to single exons of the target genes (p. 3, left column). Chen additionally teaches a method for the highly multiplexed detection of RNA in cells. The reference demonstrated the imaging of 100 to 1000 distinct RNA species in cells (abstract, throughout)). Hechtman teaches that Pan-Trk Immunochemistry is an efficient and reliable screen for detection of NTRK fusions (title, throughout). The reference demonstrates that detecting NTRK expression alone in tumor tissues is indicative of the presence of NTRK fusions. The reference teaches that the technique has 100% specificity for NTRK fusions. The reference teaches that the high specificity is due to the very restricted expression of native NTRK proteins in adult tissues (p. 1549). It would have been obvious to one having ordinary skill in the art to have modified provided a method for detecting NTRK1, NTRK2, and NTRK3 gene fusions in a single assay by in situ detection of RNA. One would have been motivated to use in situ detection of RNA because Solomon teaches that DNA in situ hybridization leaves open the question of whether the fusion is transcribed and because Markey demonstrates the successful detection of gene fusion RNA in cells. Furthermore, one would have been motivated to provide a multiplex assay for the detection of fusions in all three NTRK genes by providing a pool of probes that hybridize to at least the kinase domains of each gene, since Chen demonstrate the multiplex in situ RNA detection of many transcripts simultaneously using pooled probes that hybridize to kinase domains of the genes since Solomon teaches that the fusion genes include the kinase domains. One would have been motivated to employ the method taught by Chen because the reference teaches “Here, we report multiplexed error-robust FISH (MERFISH), a highly multiplexed smFISH imaging method that substantially increases the number of RNA species that can be simultaneously imaged in single cells by using combinatorial labeling and sequential imaging with error-robust encoding schemes.” Finally, one would have been motivated to detect only the mRNA of the NTRK1-3 genes rather than relying on detection of an additional fusion partner because Hechtman teaches that detecting expression of NTRK alone is sufficient to detect the NTRK fusions since native NTRK are so specifically expressed. By relying only on NTRK mRNA detection there would have been a benefit of requiring less reagent to detect the target fusions. Regarding claim 96, it would have further been obvious to have provided probes to hybridize to only an exon or exons encoding the NTRK kinase domains. Solomon specifically teaches that it is in-frame fusion to the kinase domain that results in the constitutive activation of the fusion partners, and Markey exemplifies that the probes were designed to hybridize to limited portions of the target genes. It would have been therefore obvious, following this to have provided probes that hybridize to only one exon in the NTRK gene(s), and that exon being within the kinase domain. Following this, the method would not comprise use of a probe comprising a nucleic acid sequence complementary to a region that does not encode the kinase domain of the target NTRK1, NTRK2 or NTRK3 genes. Claim(s) 3, 5, 7, 13, 67, 68, and 70 and is/are rejected under 35 U.S.C. 103 as being unpatentable over Solomon in view of Markey et al., Chen et al. and Hechtman et alas applied to claims 1, 9, 10, 11, 12, 14, 35, 36, 38, 39, 40, 66, 69, and 96 above, and further in view of WO2015108328, WO2015017533, and Takeuchi et al. (US20160305943). The teachings of Solomon, Markey and Chen as they combine to address claim 1 are given previously in this Office action and are fully incorporated here. These references do not provide the sequences of the kinase domain of the NTRK genes. The kinase domains, and methods for detecting gene fusions that hybridize to portions of instant SEQ ID NO: 3, 10, and 17, were taught in the prior at by WO2015108328, WO2015017533, and Takeuchi et al. (US20190305943). WO2015108328 teaches a fusion protein of LMNA or TPM3 and NTRK1 and a fusion polynucleotide encoding the same. The reference teaches methods for diagnosing colorectal cancer including measuring the transcription product (mRNA) of the fusion gene. (p. 3, description; claim 30). Example 17 and Figure 6 demonstrate that the NTRK1 fusion protein is well conserved in the kinase domain. The reference teaches that the NTRK1 portion of the fusion may be composed of SEQ ID NO: 12 (p. 6). Instant SEQ ID NO: 3 is identical to nucleotides 27-893 of the sequence taught in the reference. WO2015017533 teaches fusion proteins of TRIM24, AFAP1, and PAN3 with NTRK2 and a fusion polynucleotide encoding the same. The reference teaches that the NTRK2 fusion includes a functional kinase domain (p. 11). The reference teaches detection and diagnostic methods for detecting cancer, such as lung cancer, glioma or squamous cell carcinoma (p. 13). The reference teaches detecting the fusion nucleic acid molecule present in a cell (circulating cancer cell) a tumor or a tissue from a subject, and the reference teaches that mRNA can be detected (p. 13). WO2015017533 teaches that the fusion may be composed of SEQ ID NO: 1 (p. 6). Instant SEQ ID NO: 10 is identical to nucleotides 2230-3039 of the sequence taught in the reference, which inherently contains the NTRK2 kinase domain (p. 3). The reference teaches that the NTRK2 portion of the fusion begins at the fusion junction at nucleotide 2014 of the encoded sequence (p.3). Takeuchi teaches a fusion of ETV6 to NTRK3 obtained from a patient with colon cancer (para 13). The reference teaches a detection method for detecting an NTRK3 fusion positive cancer, particularly digestive system cancers, and whether the patient is a target for an NTRK3 inhibitor (para 105). The reference teaches an exemplary fusion gene in SEQ ID NO: 1 and teaches that the fusion point nucleotides 1009-1010 of the sequence. Alignment of instant SEQ ID NO: 17 (Qy) to SEQ ID NO: 1 (Db) of the reference is as follows: Query Match 89.1%; Score 767; Length 1902; Best Local Similarity 95.1%; Matches 819; Conservative 0; Mismatches 0; Indels 42; Gaps 1; Qy 1 ATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1036 ATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGC 1095 Qy 61 TACAACCTCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGGCCCTGAAGGATCCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1096 TACAACCTCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGGCCCTGAAGGATCCC 1155 Qy 121 ACCCTGGCTGCCCGGAAGGATTTCCAGAGGGAGGCCGAGCTGCTCACCAACCTGCAGCAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1156 ACCCTGGCTGCCCGGAAGGATTTCCAGAGGGAGGCCGAGCTGCTCACCAACCTGCAGCAT 1215 Qy 181 GAGCACATTGTCAAGTTCTATGGAGTGTGCGGCGATGGGGACCCCCTCATCATGGTCTTT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1216 GAGCACATTGTCAAGTTCTATGGAGTGTGCGGCGATGGGGACCCCCTCATCATGGTCTTT 1275 Qy 241 GAATACATGAAGCATGGAGACCTGAATAAGTTCCTCAGGGCCCATGGGCCAGATGCAATG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1276 GAATACATGAAGCATGGAGACCTGAATAAGTTCCTCAGGGCCCATGGGCCAGATGCAATG 1335 Qy 301 ATCCTTGTGGATGGACAGCCACGCCAGGCCAAGGGTGAGCTGGGGCTCTCCCAAATGCTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1336 ATCCTTGTGGATGGACAGCCACGCCAGGCCAAGGGTGAGCTGGGGCTCTCCCAAATGCTC 1395 Qy 361 CACATTGCCAGTCAGATCGCCTCGGGTATGGTGTACCTGGCCTCCCAGCACTTTGTGCAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1396 CACATTGCCAGTCAGATCGCCTCGGGTATGGTGTACCTGGCCTCCCAGCACTTTGTGCAC 1455 Qy 421 CGAGACCTGGCCACCAGGAACTGCCTGGTTGGAGCGAATCTGCTAGTGAAGATTGGGGAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1456 CGAGACCTGGCCACCAGGAACTGCCTGGTTGGAGCGAATCTGCTAGTGAAGATTGGGGAC 1515 Qy 481 TTCGGCATGTCCAGAGATGTCTACAGCACGGATTATTACAGGCTCTTTAATCCATCTGGA 540 ||||||||||||||||||||||||||||||||||||||||| Db 1516 TTCGGCATGTCCAGAGATGTCTACAGCACGGATTATTACAG------------------- 1556 Qy 541 AATGATTTTTGTATATGGTGTGAGGTGGGAGGACACACCATGCTCCCCATTCGCTGGATG 600 ||||||||||||||||||||||||||||||||||||| Db 1557 -----------------------GGTGGGAGGACACACCATGCTCCCCATTCGCTGGATG 1593 Qy 601 CCTCCTGAAAGCATCATGTACCGGAAGTTCACTACAGAGAGTGATGTATGGAGCTTCGGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1594 CCTCCTGAAAGCATCATGTACCGGAAGTTCACTACAGAGAGTGATGTATGGAGCTTCGGG 1653 Qy 661 GTGATCCTCTGGGAGATCTTCACCTATGGAAAGCAGCCATGGTTCCAACTCTCAAACACG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1654 GTGATCCTCTGGGAGATCTTCACCTATGGAAAGCAGCCATGGTTCCAACTCTCAAACACG 1713 Qy 721 GAGGTCATTGAGTGCATTACCCAAGGTCGTGTTTTGGAGCGGCCCCGAGTCTGCCCCAAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1714 GAGGTCATTGAGTGCATTACCCAAGGTCGTGTTTTGGAGCGGCCCCGAGTCTGCCCCAAA 1773 Qy 781 GAGGTGTACGATGTCATGCTGGGGTGCTGGCAGAGGGAACCACAGCAGCGGTTGAACATC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1774 GAGGTGTACGATGTCATGCTGGGGTGCTGGCAGAGGGAACCACAGCAGCGGTTGAACATC 1833 Qy 841 AAGGAGATCTACAAAATCCTC 861 ||||||||||||||||||||| Db 1834 AAGGAGATCTACAAAATCCTC 1854 The reference teaches detecting fusion gene expression, i.e. by detecting levels of RNA (para 166), and the reference specifically teaches detecting the fusion gene mRNA in para 216 and 258. The reference teaches detecting the fusion using a gene that hybridizes to the 3’ terminal region of the NTRK3 fusion gene, which is the region that shares homology with instant SEQ ID NO: 17, and which inherently encodes a kinase domain. It would have been obvious to have modified the method taught by Solomon, Markey, and Chen so as to have selected probes complementary to the kinase domain of the NTRK genes, which would have included sequence complementary to a region within the NTRK sequences taught by WO2015108328, WO2015017533, and Takeuchi et al. (US20190305943), in order to provide functional probes for the detection of NTRK fusions in samples from cancer patients of patients suspected of having cancer. These probes would have inherently been complementary to a region within SEQ ID NO: 3, 10 or 17. One would have been motivated to select from within these sequences by the teachings throughout the reference, including in Solomon that the gene fusions include kinase domains, and the teachings in WO2015108328, WO2015017533, and Takeuchi et al. (US20190305943) that these sequences are gene fusions or parts of gene fusions that include NTRK kinase domains. Furthermore, Solomon in view of Markey and Chen do not teach methods wherein the fusion is detected in a blood sample, a cytological sample, or a paraffin embedded sample. WO2015108328 teaches that the mRNA of the fusion can be detected in cells, tissue organs or body fluids such as blood and that the sample may be a paraffin embedded sample (p. 8). WO2015017533 teaches detecting the fusion nucleic acid molecule present in a cell (circulating cancer cell) a tumor or a tissue from a subject, and the reference teaches that mRNA can be detected (p. 13). Takeuchi teaches samples for the method of detection include blood, or cells or an excised specimen from the affected area of the subject (para 129). It would have been obvious to have modified the method taught by Solomon in view of Markey and Chen so as to have detected the fusion in any appropriate sample such as blood, cytology samples or paraffin embedded samples in order to obtain the predictable result of detecting oncogenic gene fusions. One would have been motivated to do so by the express direction of the references that these are appropriate sample types for detecting NTRK gene fusions in patient samples. Response to Remarks New grounds of rejection are set forth to address the amended claims. Applicant traversed the rejection over Solomon in view of Markey and Chen. The rejection has been modified to include Hechtman to address the newly added limitation. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Nakajima et al. ((2017) Histopathology 71, 143–149. DOI: 10.1111/his.13198; 7 pages) teach detecting ALK rearrangement in cancer cells using RNA in-situ hybridization. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliet Switzer whose telephone number is (571)272-0753. The examiner can normally be reached Monday to Thursday, 8:00 AM-3:30 PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Juliet Switzer Primary Examiner Art Unit 1682 /JULIET C SWITZER/Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Aug 18, 2022
Application Filed
May 17, 2025
Non-Final Rejection — §103
Aug 21, 2025
Response Filed
Sep 30, 2025
Final Rejection — §103
Jan 02, 2026
Request for Continued Examination
Jan 07, 2026
Response after Non-Final Action
Jan 23, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584181
Detection of Mycobacterium species
2y 5m to grant Granted Mar 24, 2026
Patent 12559789
A METHOD OF TARGETING PATIENT-SPECIFIC ONCOGENES IN EXTRACHROMOSOMAL DNA TO TREAT GLIOBLASTOMA
2y 5m to grant Granted Feb 24, 2026
Patent 12559804
LOOP-MEDIATED ISOTHERMAL AMPLIFICATION PRIMERS FOR VIBRIO PARAHAEMOLYTICUS DETECTION AND USES THEREOF
2y 5m to grant Granted Feb 24, 2026
Patent 12545954
MULTIPLEXED ASSAY FOR QUANTITATING AND ASSESSING INTEGRITY OF CELL-FREE DNA IN BIOLOGICAL FLUIDS FOR CANCER DIAGNOSIS, PROGNOSIS AND SURVEILLANCE
2y 5m to grant Granted Feb 10, 2026
Patent 12522873
NOVEL ALK AND NTRK1 FUSION MOLECULES AND USES THEREOF
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
42%
Grant Probability
95%
With Interview (+53.0%)
3y 10m
Median Time to Grant
High
PTA Risk
Based on 496 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month