Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1, 9, 10, 11, 12, 14, 35, 36, 38, 39, 40, 66, 69, and 96 is/are rejected under 35 U.S.C. 103 as being unpatentable over Solomon et al. (Annals of Oncology 30 (Supplement 8): viii16–viii22, 2019) in view of Markey et al., Chen et al. (Science348,aaa6090(2015).DOI:10.1126/science.aaa6090) and Hechtman et al. (Am J Surg Pathol 2017;41:1547–1551).
Solomon teaches that a multitude of 5’ fusion partners have been described for NTRK1, NTRK2, and NTRK3, and that these are characteristic of a few types of rare cancer and are also seen on common cancers (p. 1). The reference further teaches that in-frame fusion to the kinase domain results in constitutive activation of the receptors (p. 1). The reference teaches that there are a multiple of methods for detecting NTRK fusions. The reference teaches FISH detection of DNA structural variants but while a positive result with a break-apart probe shows the presence of a structural variant involving the probed gene, whether the abnormality results in a functional transcribed fusion cannot be determined (p. 2). Furthermore, Solomon teaches the screening of patients having a variety of cancers, including colon cancer (p. 2), and also the treatment of cancer having the fusion with a drug that targets NTRK, including larotrectinib (p. 2). Solomon teaches NTRK fusions include LMNA-NTRK1 and ETV6-NTRK3 (p. 2). Solomon teaches FISH can detect fusions in solid tumors (p. 2).
Solomon does not teach RNA FISH detection of the NTRK1, NTRK2 and NTRK3 genes, nor does the reference teach a pool of probes for detecting fusions in one or more of these genes.
Markey teaches a method for in situ detection of transcripts encoded by gene fusions in which approximately 50 short fluorescent probes bind to adjacent sites on the same mRNA molecule rendering each molecule visible (abstract, throughout). The method is demonstrated with two different fusion transcripts, and the reference teaches the method will pave the way for accurate in situ typing of many cancers that are associated with or caused by fusion transcripts (abstract, throughout).
With regard to claim 96, Markey teaches that the probes used were specific to single exons of the target genes (p. 3, left column).
Chen additionally teaches a method for the highly multiplexed detection of RNA in cells. The reference demonstrated the imaging of 100 to 1000 distinct RNA species in cells (abstract, throughout)).
Hechtman teaches that Pan-Trk Immunochemistry is an efficient and reliable screen for detection of NTRK fusions (title, throughout). The reference demonstrates that detecting NTRK expression alone in tumor tissues is indicative of the presence of NTRK fusions. The reference teaches that the technique has 100% specificity for NTRK fusions. The reference teaches that the high specificity is due to the very restricted expression of native NTRK proteins in adult tissues (p. 1549).
It would have been obvious to one having ordinary skill in the art to have modified provided a method for detecting NTRK1, NTRK2, and NTRK3 gene fusions in a single assay by in situ detection of RNA. One would have been motivated to use in situ detection of RNA because Solomon teaches that DNA in situ hybridization leaves open the question of whether the fusion is transcribed and because Markey demonstrates the successful detection of gene fusion RNA in cells. Furthermore, one would have been motivated to provide a multiplex assay for the detection of fusions in all three NTRK genes by providing a pool of probes that hybridize to at least the kinase domains of each gene, since Chen demonstrate the multiplex in situ RNA detection of many transcripts simultaneously using pooled probes that hybridize to kinase domains of the genes since Solomon teaches that the fusion genes include the kinase domains. One would have been motivated to employ the method taught by Chen because the reference teaches “Here, we report multiplexed error-robust FISH (MERFISH), a highly multiplexed smFISH imaging method that substantially increases the number of RNA species that can be simultaneously imaged in single cells by using combinatorial labeling and sequential imaging with error-robust encoding schemes.” Finally, one would have been motivated to detect only the mRNA of the NTRK1-3 genes rather than relying on detection of an additional fusion partner because Hechtman teaches that detecting expression of NTRK alone is sufficient to detect the NTRK fusions since native NTRK are so specifically expressed. By relying only on NTRK mRNA detection there would have been a benefit of requiring less reagent to detect the target fusions.
Regarding claim 96, it would have further been obvious to have provided probes to hybridize to only an exon or exons encoding the NTRK kinase domains. Solomon specifically teaches that it is in-frame fusion to the kinase domain that results in the constitutive activation of the fusion partners, and Markey exemplifies that the probes were designed to hybridize to limited portions of the target genes. It would have been therefore obvious, following this to have provided probes that hybridize to only one exon in the NTRK gene(s), and that exon being within the kinase domain. Following this, the method would not comprise use of a probe comprising a nucleic acid sequence complementary to a region that does not encode the kinase domain of the target NTRK1, NTRK2 or NTRK3 genes.
Claim(s) 3, 5, 7, 13, 67, 68, and 70 and is/are rejected under 35 U.S.C. 103 as being unpatentable over Solomon in view of Markey et al., Chen et al. and Hechtman et alas applied to claims 1, 9, 10, 11, 12, 14, 35, 36, 38, 39, 40, 66, 69, and 96 above, and further in view of WO2015108328, WO2015017533, and Takeuchi et al. (US20160305943).
The teachings of Solomon, Markey and Chen as they combine to address claim 1 are given previously in this Office action and are fully incorporated here.
These references do not provide the sequences of the kinase domain of the NTRK genes.
The kinase domains, and methods for detecting gene fusions that hybridize to portions of instant SEQ ID NO: 3, 10, and 17, were taught in the prior at by WO2015108328, WO2015017533, and Takeuchi et al. (US20190305943).
WO2015108328 teaches a fusion protein of LMNA or TPM3 and NTRK1 and a fusion polynucleotide encoding the same. The reference teaches methods for diagnosing colorectal cancer including measuring the transcription product (mRNA) of the fusion gene. (p. 3, description; claim 30). Example 17 and Figure 6 demonstrate that the NTRK1 fusion protein is well conserved in the kinase domain. The reference teaches that the NTRK1 portion of the fusion may be composed of SEQ ID NO: 12 (p. 6). Instant SEQ ID NO: 3 is identical to nucleotides 27-893 of the sequence taught in the reference.
WO2015017533 teaches fusion proteins of TRIM24, AFAP1, and PAN3 with NTRK2 and a fusion polynucleotide encoding the same. The reference teaches that the NTRK2 fusion includes a functional kinase domain (p. 11). The reference teaches detection and diagnostic methods for detecting cancer, such as lung cancer, glioma or squamous cell carcinoma (p. 13). The reference teaches detecting the fusion nucleic acid molecule present in a cell (circulating cancer cell) a tumor or a tissue from a subject, and the reference teaches that mRNA can be detected (p. 13). WO2015017533 teaches that the fusion may be composed of SEQ ID NO: 1 (p. 6). Instant SEQ ID NO: 10 is identical to nucleotides 2230-3039 of the sequence taught in the reference, which inherently contains the NTRK2 kinase domain (p. 3). The reference teaches that the NTRK2 portion of the fusion begins at the fusion junction at nucleotide 2014 of the encoded sequence (p.3).
Takeuchi teaches a fusion of ETV6 to NTRK3 obtained from a patient with colon cancer (para 13). The reference teaches a detection method for detecting an NTRK3 fusion positive cancer, particularly digestive system cancers, and whether the patient is a target for an NTRK3 inhibitor (para 105). The reference teaches an exemplary fusion gene in SEQ ID NO: 1 and teaches that the fusion point nucleotides 1009-1010 of the sequence. Alignment of instant SEQ ID NO: 17 (Qy) to SEQ ID NO: 1 (Db) of the reference is as follows:
Query Match 89.1%; Score 767; Length 1902;
Best Local Similarity 95.1%;
Matches 819; Conservative 0; Mismatches 0; Indels 42; Gaps 1;
Qy 1 ATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1036 ATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGC 1095
Qy 61 TACAACCTCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGGCCCTGAAGGATCCC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1096 TACAACCTCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGGCCCTGAAGGATCCC 1155
Qy 121 ACCCTGGCTGCCCGGAAGGATTTCCAGAGGGAGGCCGAGCTGCTCACCAACCTGCAGCAT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1156 ACCCTGGCTGCCCGGAAGGATTTCCAGAGGGAGGCCGAGCTGCTCACCAACCTGCAGCAT 1215
Qy 181 GAGCACATTGTCAAGTTCTATGGAGTGTGCGGCGATGGGGACCCCCTCATCATGGTCTTT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1216 GAGCACATTGTCAAGTTCTATGGAGTGTGCGGCGATGGGGACCCCCTCATCATGGTCTTT 1275
Qy 241 GAATACATGAAGCATGGAGACCTGAATAAGTTCCTCAGGGCCCATGGGCCAGATGCAATG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1276 GAATACATGAAGCATGGAGACCTGAATAAGTTCCTCAGGGCCCATGGGCCAGATGCAATG 1335
Qy 301 ATCCTTGTGGATGGACAGCCACGCCAGGCCAAGGGTGAGCTGGGGCTCTCCCAAATGCTC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1336 ATCCTTGTGGATGGACAGCCACGCCAGGCCAAGGGTGAGCTGGGGCTCTCCCAAATGCTC 1395
Qy 361 CACATTGCCAGTCAGATCGCCTCGGGTATGGTGTACCTGGCCTCCCAGCACTTTGTGCAC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1396 CACATTGCCAGTCAGATCGCCTCGGGTATGGTGTACCTGGCCTCCCAGCACTTTGTGCAC 1455
Qy 421 CGAGACCTGGCCACCAGGAACTGCCTGGTTGGAGCGAATCTGCTAGTGAAGATTGGGGAC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1456 CGAGACCTGGCCACCAGGAACTGCCTGGTTGGAGCGAATCTGCTAGTGAAGATTGGGGAC 1515
Qy 481 TTCGGCATGTCCAGAGATGTCTACAGCACGGATTATTACAGGCTCTTTAATCCATCTGGA 540
|||||||||||||||||||||||||||||||||||||||||
Db 1516 TTCGGCATGTCCAGAGATGTCTACAGCACGGATTATTACAG------------------- 1556
Qy 541 AATGATTTTTGTATATGGTGTGAGGTGGGAGGACACACCATGCTCCCCATTCGCTGGATG 600
|||||||||||||||||||||||||||||||||||||
Db 1557 -----------------------GGTGGGAGGACACACCATGCTCCCCATTCGCTGGATG 1593
Qy 601 CCTCCTGAAAGCATCATGTACCGGAAGTTCACTACAGAGAGTGATGTATGGAGCTTCGGG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1594 CCTCCTGAAAGCATCATGTACCGGAAGTTCACTACAGAGAGTGATGTATGGAGCTTCGGG 1653
Qy 661 GTGATCCTCTGGGAGATCTTCACCTATGGAAAGCAGCCATGGTTCCAACTCTCAAACACG 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1654 GTGATCCTCTGGGAGATCTTCACCTATGGAAAGCAGCCATGGTTCCAACTCTCAAACACG 1713
Qy 721 GAGGTCATTGAGTGCATTACCCAAGGTCGTGTTTTGGAGCGGCCCCGAGTCTGCCCCAAA 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1714 GAGGTCATTGAGTGCATTACCCAAGGTCGTGTTTTGGAGCGGCCCCGAGTCTGCCCCAAA 1773
Qy 781 GAGGTGTACGATGTCATGCTGGGGTGCTGGCAGAGGGAACCACAGCAGCGGTTGAACATC 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1774 GAGGTGTACGATGTCATGCTGGGGTGCTGGCAGAGGGAACCACAGCAGCGGTTGAACATC 1833
Qy 841 AAGGAGATCTACAAAATCCTC 861
|||||||||||||||||||||
Db 1834 AAGGAGATCTACAAAATCCTC 1854
The reference teaches detecting fusion gene expression, i.e. by detecting levels of RNA (para 166), and the reference specifically teaches detecting the fusion gene mRNA in para 216 and 258. The reference teaches detecting the fusion using a gene that hybridizes to the 3’ terminal region of the NTRK3 fusion gene, which is the region that shares homology with instant SEQ ID NO: 17, and which inherently encodes a kinase domain.
It would have been obvious to have modified the method taught by Solomon, Markey, and Chen so as to have selected probes complementary to the kinase domain of the NTRK genes, which would have included sequence complementary to a region within the NTRK sequences taught by WO2015108328, WO2015017533, and Takeuchi et al. (US20190305943), in order to provide functional probes for the detection of NTRK fusions in samples from cancer patients of patients suspected of having cancer. These probes would have inherently been complementary to a region within SEQ ID NO: 3, 10 or 17. One would have been motivated to select from within these sequences by the teachings throughout the reference, including in Solomon that the gene fusions include kinase domains, and the teachings in WO2015108328, WO2015017533, and Takeuchi et al. (US20190305943) that these sequences are gene fusions or parts of gene fusions that include NTRK kinase domains.
Furthermore, Solomon in view of Markey and Chen do not teach methods wherein the fusion is detected in a blood sample, a cytological sample, or a paraffin embedded sample.
WO2015108328 teaches that the mRNA of the fusion can be detected in cells, tissue organs or body fluids such as blood and that the sample may be a paraffin embedded sample (p. 8).
WO2015017533 teaches detecting the fusion nucleic acid molecule present in a cell (circulating cancer cell) a tumor or a tissue from a subject, and the reference teaches that mRNA can be detected (p. 13).
Takeuchi teaches samples for the method of detection include blood, or cells or an excised specimen from the affected area of the subject (para 129).
It would have been obvious to have modified the method taught by Solomon in view of Markey and Chen so as to have detected the fusion in any appropriate sample such as blood, cytology samples or paraffin embedded samples in order to obtain the predictable result of detecting oncogenic gene fusions. One would have been motivated to do so by the express direction of the references that these are appropriate sample types for detecting NTRK gene fusions in patient samples.
Response to Remarks
The rejections were traversed.
Applicant argues that Solomon provides no rational for using RNA-FISH. This is a piecemeal argument that does not consider the totality of the references. Solomon et al. (2019) teaches that “detection of RNA-level fusions provides direct evidence that they are functionally transcribed” (See page 4, left column). Solomon does, thus, provide a reason to pursue transcript level detection of NTRK fusions.
Applicant argues that Markey’s method is “structurally incompatible” with the claimed method and “teaches away” from it. However, this also a piecemeal analysis. Markey is cited because it exemplifies the use of RNA-FISH for the detection of gene fusions related to cancer diagnosis. The fact that Markey uses a two-part system (i.e. both genes in the fusion) does not teach away from the claimed invention as it does not address the possibility of the claimed invention let alone disparage it. Hechtman clearly provides guidance as to why NTRK fusions can be detected in samples by ONLY detecting expression of the NTRK partner, as discussed in the rejection.
Applicant argues that the combination of Markey and Hechtman is logically inconsistent and does not supply the missing motivation. However, there existed a clear motivation in the art to detect NTRK fusions (see Soloman and Hechtman) and there was a clear teaching in Hechtman that detection of NTRK expression in cancer cells was sufficient, alone, without detecting a fusion partner, to detect the presence of the fusion. Although Hechtman does not make an observation about mRNA expression, protein expression follows mRNA expression, and the two are often correlated in biological systems. A person of ordinary skill has good reason to pursue the known options within his or her technical grasp.
Applicant finally offers that combining Markey and Hechtman would change Markey’s methods. The rejection is based on a combination of references, and Hechtman clearly suggests that detecting NTRK fusions does not require a two partner assay. Using less reagents (i.e. fewer probes) would have had advantages, and also the ability to detect NTRK fusion no matter the partner would be an advantage in view of so many possible partners.
Applicant makes further piecemeal argument against Chen, and this is not persuasive because it does not consider the totality of the rejection.
Regarding claim 96, applicant argues that Markey uses some single exon probes and some longer probes. However, this is not persuasive. Soloman is very clear that “These oncogenic fusions occur when the kinase domain of NTRKI, NTRK2 or NTRK3 fuse with any of a number of N-terminal partners. NTRK fusions are characteristic of a few rare types of cancer” (Abstract), and following this targeting the NTRK kinase domain would have been obvious.
Applicant argues that the claimed invention satisfies a long-felt need documented in the prior art. While Solomon identifies deficiencies with prior art methods, each of these deficiencies could have been addressed by different methods which were known in the prior art, so the needs were not unsatisfied. There was no evidence that there was a long felt need for a method that could do all things “simultaneously.”
Applicant argues that the RNA ISH method detected all eight NTRK fusion-positive tumor samples with 100% sensitivity. However, the claims are not commensurate is scope with the showing; as they are generic to any possible NTRK probes, while a specific probe set was used in the examples. Furthermore, as the same samples, for example of the same age and from the same tumors were not compared, the comparison cannot be taken to show the superior results of the instant invention.
Applicant argues that the combination requires multiple non-obvious design choices that are not collectively motivated. The reason to make each modification is given in the rejection.
The response further points out that the examiner has not addresses probes to all of the SEQ ID NO: in the claims. Where the SEQ ID NO: are presented in the alternative, there is no requirement to address all of the alternatives. Applicant further argues that the examiner did not address commercial products associated with SEQ ID NO. These are all features that are not required by the instant claims. The commercial products are identified only by their product names, and no written description is given as to the structure of the sequences nor exactly what the target is. Applicant’s remarks provide data that is not in the specification (for example SEQ ID NO: target of the specific commercial products) and this is considered attorney argument which cannot take the place of evidence on the record.
Regarding the argument about Takeuchi, one skilled in the art would have been able to identify the kinase domain of the encoded protein and make probes to it. There is no requirement in the claim to present a molecule with 100% identity to SEQ ID NO: 17. Furthermore, a probe with only one mismatch would still be expected to hybridize to a target.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Nakajima et al. ((2017) Histopathology 71, 143–149. DOI: 10.1111/his.13198; 7 pages) teach detecting ALK rearrangement in cancer cells using RNA in-situ hybridization.
Vaishnavi A, Le AT, Doebele RC. TRKing down an old oncogene in a new era of targeted therapy. Cancer Discov 2015; 5(1): 25-34.
Vaishnavi et al. teaches “It is expected that most TRK fusions would use many or all of the same downstream signaling cascades as the full-length receptors, given the preservation of the kinase domain and the critical tyrosine docking sites” (See right column, page 26). The kinase domain (KD) ranges from amino acid 510 to amino acid 781 (See Fig. 2 of Vaishnavi et al., 2015), which is 372 amino acid residues corresponding to 1016 nucleotides of mRNA coding sequences. There are five critical tyrosine (Y) residues (Y496, Y676, Y680, Y681 and Y791) (See bridging paragraph, page 26).
PNG
media_image1.png
404
786
media_image1.png
Greyscale
PNG
media_image2.png
498
944
media_image2.png
Greyscale
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliet Switzer whose telephone number is (571)272-0753. The examiner can normally be reached Monday to Thursday, 8:00 AM-3:30 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Juliet Switzer
Primary Examiner
Art Unit 1682
/JULIET C SWITZER/Primary Examiner, Art Unit 1682
Prosecution Insights