Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on June 29, 2026 has been entered.
Detailed Action
This action is in response to the papers filed June 29, 2026.
Amendments
Applicant's amendments, filed June 29, 2026, are acknowledged. Applicant has cancelled Claims 1-82, 84-90, and 102, and amended Claims 83 and 100-101.
Claims 83, 91-101, and 103 are pending an under examination.
Priority
This application is a 371 of PCT/US2021/021246 filed on March 5, 2021. Applicant’s claim for the benefit of a prior-filed application provisional applications:
63/125,545 filed on December 15, 2020;
62/986,216 filed on March 6, 2020; and
62/985,392 filed on March 5, 2020
under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on June 29, 2026 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Claim Rejections - 35 USC § 112
1. The prior rejections of Claim 101 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, are withdrawn in light of Applicant’s amendment to the claim, which the Examiner finds persuasive.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
2. The prior rejection of Claims 83, 85-87, 91-93, and 96-100 under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record) and Joung et al (U.S. 2014/0295556) is withdrawn in light of Applicant’s amendment to the independent claim to recite SEQ ID NO:2 and SEQ ID NO:3, limitations not taught/disclosed by Ophinni et al, Cribbs et al, and Joung et al.
3. The prior rejection of Claims 91-95 and 97-99 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record), Cribbs et al (available online November 12, 2013; of record), and Joung et al (U.S. 2014/0295556), as applied to Claims 83, 85-87, 91-93, and 96-100 above, and in further view of Kabadi et al (available online October 29, 2014; of record) is withdrawn for reasons discussed above.
4. Claims 83, 91-93, and 96-100 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record), Watanabe et al (WO 95/31434; of record), Goudsmit et al (WO 2002/20571; of record), and Chang (WO 2012/159120; of record), and Joung et al (U.S. 2014/0295556).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 83, Ophinni et al is considered relevant prior art for having taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
Ophinni et al taught an in vitro method of treating an HIV-1 infection, the method comprising the step of introducing into target host cells the CRISPR/Cas9 system to edit the HIV-1 tat gene. Ophinni et al taught that multiplexing all six gRNAs further increased editing efficiency of the latent HIV-1 genome in infected host T cells (e.g. Abstract).
Ophinni et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophinni et al, and there is no objective evidence of criticality for instant SEQ ID NO:2 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:2 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NO:2.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Ophinni et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophinni et al, and there is no objective evidence of criticality for instant SEQ ID NO:3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:3 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA that is 60% identical to the crRNA sequence of instant SEQ ID NO:3.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Watanabe et al is considered relevant prior art for having disclosed oligonucleotides that promote the degradation of a target sequence, e.g. antisense oligonucleotides (e.g. pg 1, line26), wherein the oligonucleotide targets the HIV-1 proviral genome (e.g. pg 8, lines 13-14), wherein the oligonucleotide, e.g. SEQ ID NO:36, has a 95% match with instant SEQ ID NO:3, as shown below:
GAAGGAAUCGAAGAAGAAGG
|||||||: |||||||||||
GAAGGAATAGAAGAAGAAGG
Goudsmit et al is considered relevant prior art for having disclosed an oligonucleotide primer to amplify HIV-1 sequences, VPU-1, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Chang is considered relevant prior art for having disclosed an antisense or miRNA oligonucleotide to inhibit HIV-1 replication (e.g. pg 22) SEQ ID NO:5, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Joung et al is considered relevant prior art for having disclosed that the CRISPR/Cas9 system, per natural law of cell biology and enzymology, can generate structurally different deletions as large as 200 nucleotides in length around the sgRNA target site, shown below.
PNG
media_image2.png
314
634
media_image2.png
Greyscale
Instant crRNA SEQ ID NOs: 2 and 3 is/are substantially the same as the crRNAs of Ophinni et al, and there is no objective evidence of criticality for instant SEQ ID NOs: 2 and 3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NOs: 2 and 3 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NOs: 2 and 3, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Ophinni et al do not teach ipsis verbis that the lentiviral vectors encoding the CRISPR/Cas9 system were formulated with a pharmaceutically acceptable excipient.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 100, Cribbs et al is considered relevant prior art for having taught a lentiviral vector system comprising a pharmaceutically acceptable excipient, e.g. PBS (e.g pg 3, col. 2, Methods, lentivirus production) and an in vitro method of transducing human T cells with said lentivirus system.
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and viral vectors. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2, with a second crRNA nucleotide sequence having a 100% match to instant SEQ ID NO:2, and to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3, with a second crRNA nucleotide sequence having at least a 95% match (1 nt difference) to instant SEQ ID NO:3, in a CRISPR/Cas system to edit an HIV-1 genome with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2, with a second crRNA nucleotide sequence having a 100% match to instant SEQ ID NO:2, and to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3, with a second crRNA nucleotide sequence having at least a 95% match (1 nt difference) to instant SEQ ID NO:3, in a CRISPR/Cas system to edit an HIV-1 genome because those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NO’s: 2 and 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NO’s: 2 and 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NOs: 2 and 3 is/are substantially the same as the crRNAs of Ophinni et al and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat or rev gene site as instant SEQ ID NOs: 2 and 3, respectively, and there is no objective evidence of criticality for instant SEQ ID NOs: 2 and 3 for the ability to edit the HIV-1 tat or rev gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat or rev gene edits achieved by instant SEQ ID NOs: 2 and 3 would be molecularly indistinguishable from the tat or rev gene edits of Ophinni et al’s crRNA and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat or rev gene site as instant SEQ ID NOs: 2 and 3, respectively, that substantially overlaps with the crRNA sequence of instant SEQ ID NOs: 2 and 3, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentivirus formulary with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, because Cribbs et al taught that formulating the lentivirus in PBS is part of a simplified means of producing and transducing the lentiviral vectors to the artisan’s target host cells, as successfully demonstrated with human T cells.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 91-93, Ophinni et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. pg 9, Methods).
With respect to Claim 96, Ophinni et al taught wherein the first and second gRNA nucleic acids are part of different vectors (e.g. pg 5, para 1).
With respect to Claim 97, Ophinni et al taught wherein the vector(s) is/are lentiviral vectors (e.g. pg 5, para 1).
With respect to Claims 98-99, Ophinni et al taught wherein the first and second gRNAs were cloned into the lentiCRISPRv2 expression vector (e.g. Abstract), whereby Addgene evidences that the lentiCRISPRv2 expression vector comprises a eukaryotic promoter operably linked to a tracr RNA sequence.
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues secondary considerations that the combined use of TatD (SEQ ID NO: 2) and TatE (SEQ ID NO: 3) in a CRISPR therapy "reduces HIV-1 replication by an average of 82% in 7 strains," is "predicted to work against at least 62% of all HIV-1 strains [with] no mismatch tolerance," "blocks latency reversal by 94%," and provides "no off-target editing" (page 23).
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, instant claims are directed to a Product, not a method of use.
As a second matter, asserted secondary considerations were achieved using a lentiviral CRISPR/Cas system comprising a Cas9 enzyme and sgRNAs comprising a tracrRNA. Those of ordinary skill in the art would immediately recognize that independent Claim 83 is vastly broader in scope than asserted secondary considerations. Claim 83 is not commensurate in scope to asserted secondary considerations. See, instead, currently amended Claim 101.
Applicant argues that the TatB gRNA of Ophinni et al is shifted by 9 nucleotides as compared to instant SEQ ID NO:2.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, Ophinni et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Joung et al is considered relevant prior art for having disclosed that the CRISPR/Cas9 system, per natural law of cell biology and enzymology, can generate structurally different deletions as large as 200 nucleotides in length around the sgRNA target site.
Instant crRNA SEQ ID NO: 2 is substantially the same as the crRNA of Ophinni et al, and there is no objective evidence of criticality for instant SEQ ID NO: 2 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO: 2 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NO: 2.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
As a second matter, in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Ophinni et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Goudsmit et al is considered relevant prior art for having disclosed an oligonucleotide primer to amplify HIV-1 sequences, VPU-1, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Chang is considered relevant prior art for having disclosed an antisense or miRNA oligonucleotide to inhibit HIV-1 replication (e.g. pg 22) SEQ ID NO:5, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2, with a second crRNA nucleotide sequence having a 100% match to instant SEQ ID NO:2, in a CRISPR/Cas system to edit an HIV-1 genome with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NO: 2, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NO: 2 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NO: 2 is substantially the same as the crRNAs of Ophinni et al and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat gene site as instant SEQ ID NO: 2, and there is no objective evidence of criticality for instant SEQ ID NO: 2 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO: 2 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat gene site as instant SEQ ID NO: 2, that substantially overlaps with the crRNA sequence of instant SEQ ID NO: 2.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Applicant argues that Mali et al (2013; of record in IDS) teaches that the sgRNA/Cas9 complexes can potentially tolerate 1-3 target mismatches, and that the introduction of 2 base mismatches significantly impairs activity of the CRISPR system. The TatE gRNA of Ophinni et al has seven mismatches as compared to instant SEQ ID NO:3, and thus would not cleave at the same location as SEQ ID NO:3.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, Ophinni et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
Joung et al is considered relevant prior art for having disclosed that the CRISPR/Cas9 system, per natural law of cell biology and enzymology, can generate structurally different deletions as large as 200 nucleotides in length around the sgRNA target site.
Instant crRNA SEQ ID NO: 3 is substantially the same as the crRNA of Ophinni et al, and there is no objective evidence of criticality for instant SEQ ID NO: 3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO: 3 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NO: 3.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
As a second matter, in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Ophinni et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
Watanabe et al is considered relevant prior art for having disclosed oligonucleotides that promote the degradation of a target sequence, e.g. antisense oligonucleotides (e.g. pg 1, line26), wherein the oligonucleotide targets the HIV-1 proviral genome (e.g. pg 8, lines 13-14), wherein the oligonucleotide, e.g. SEQ ID NO:36, has a 95% match (1 mismatch) with instant SEQ ID NO:3, as shown below:
GAAGGAAUCGAAGAAGAAGG
|||||||: |||||||||||
GAAGGAATAGAAGAAGAAGG
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first crRNA nucleotide sequence (that is substantially identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3, with a second crRNA nucleotide sequence having a 100% match to instant SEQ ID NO:3, in a CRISPR/Cas system to edit an HIV-1 genome with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NO: 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NO: 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NO: 3 is substantially the same as the crRNAs of Ophinni et al and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al that target the same HIV-1 tat gene site as instant SEQ ID NO: 3, and there is no objective evidence of criticality for instant SEQ ID NO: 3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO: 3 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al that target the same HIV-1 tat gene site as instant SEQ ID NO: 3, that substantially overlaps with the crRNA sequence of instant SEQ ID NO: 3.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Applicant argues that the combination of SEQ ID NO:2 and SEQ ID NO:3 allows for the disruption or cleavage of 3 genes and 5 different exons with just 2 crRNAs.
Applicant’s argument(s) has been fully considered, but is not persuasive.
In response to applicant's argument that the combination allows for disruption or cleavage of 3 genes and 5 different exons with just 2 crRNAs, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim.
Furthermore, Ophinni et al taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
The paired CRISPR/Cas9 system of Ophinni et al appears to achieve the same results.
Applicant argues that the RevA of Ophinni et al would be incapable of cleaving the SEQ ID NO:3 locus due to the seven basepair mismatches.
Applicant’s argument(s) has been fully considered, but is not persuasive. Arguments of counsel cannot take the place of factually supported objective evidence in the record. See In re Schulze, 346 F.2d 500, 602, 145 USPQ 716, 718 (CCPA 1965), In re Huang, 100 F.3d 135, 139-40, 40 USPQ2d 1685, 1689 (Fed. Cir. 1996); In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984).
Applicant fails to provide objective evidence in the form of data to this assertion.
Ophinni et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
Ophinni et al clearly demonstrated the ability of the RevA gRNA has a crRNA nucleotide sequence to cleave the corresponding HIV-1 target DNA sequence (e.g. Figures 2-3).
Applicant argues that the combination of SEQ ID NO:2 and SEQ ID NO:3 provided superior inhibition of HIV replication as compared to other crRNA combinations, reducing viral replication “on average by 82%” across a panel of HIV strains.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, asserted secondary considerations were achieved using a lentiviral CRISPR/Cas system expression vector comprising a Cas9 enzyme and sgRNAs comprising the crRNA and a tracrRNA.
The CRISPR/Cas system expression vectors of Claims 83-101 are recited at a high level of generality, for which there is no evidence of “superior inhibition of HIV replication as compared to other crRNA combinations, reducing viral replication “on average by 82%” across a panel of HIV strains” via in vitro tissue culture experiments, let alone in vivo data, using, e.g. transfection with plasmid vectors or CRISPR/Cas ribonucleoprotein particles, each at unknown and not disclosed working concentrations, respectively. Rather, Applicant’s secondary considerations were achieved using a lentiviral CRISPR/Cas system expression vector.
The CRISPR/Cas system of Claims 83-97 and 100 fail to recite the required presence of the tracrRNA. As discussed in the prior Office Action, those of ordinary skill in the art have long-recognized that the CRISPR/Cas9 gene editing system does not work in the absence of a tracrRNA sequence. The specification fails to disclose a CRISPR/Cas9 gene editing system that works in the absence of a tracrRNA sequence. Absent objective evidence to the contrary, it would be remedial for Applicant to claim the invention correctly per the global scientific community, whereby:
the first crRNA-encoding nucleic acid further comprises a tracrRNA sequence; and
ii) the second crRNA-encoding nucleic acid further comprises a tracrRNA sequence.
Applicant’s secondary considerations were achieved using sgRNAs comprising the crRNA and a tracrRNA.
The Cas enzyme of the CRISPR/Cas system, and its corresponding required PAM sequence, of Claims 83-100 are each recited at a high level of generality, respectively.
The Examiner provides the following references to rebut applicant’s arguments
regarding the state of the prior art regarding the CRISPR/Cas system. Note: the reference is not considered a part of the 103 rejection but is solely provided to rebut applicant’s argument(s).
Anders et al (Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease, Nature 513: 569-573, 2014) is considered relevant prior art for having taught that “RNA-guided DNA recognition and cleavage strictly require the presence of a protospacer adjacent motif (PAM) in the target DNA” (Abstract). “PAM recognition is a critical aspect of Cas9-mediated DNA targeting, being a prerequisite for ATP-independent strand separation and guide-RNA-target-DNA heteroduplex formation” (pg 569, col. 2). “The entire PAM-containing region of the target DNA (target-strand nucleotides -1 to -8 and non-target-strand nucleotides +1* to +8* [relative to crRNA target DNA]) is base-paired” (pg 570, col. 1; Figure 1a).
PNG
media_image3.png
250
394
media_image3.png
Greyscale
“In this study we highlight the central importance of PAM recognition in Cas9 function, both as a critical determinant of initial target DNA binding and as a licensing element in subsequent strand separation and guide-RNA–target-DNA hybridization” (pg 572, col. 2, Conclusion).
The nonobviousness of a broader claimed range can be supported by evidence based on unexpected results from testing a narrower range if one of ordinary skill in the art would be able to determine a trend in the exemplified data which would allow the artisan to reasonably extend the probative value thereof. In re Kollman, 595 F.2d 48, 201 USPQ 193 (CCPA 1979) In re Lindner, 457 F.2d 506, 509, 173 USPQ 356, 359 (CCPA 1972) (Evidence of nonobviousness consisted of comparing a single composition within the broad scope of the claims with the prior art. The court did not find the evidence sufficient to rebut the prima facie case of obviousness because there was "no adequate basis for reasonably concluding that the great number and variety of compositions included in the claims would behave in the same manner as the tested composition.") See MPEP 716.02(d)
In the instant case, those of ordinary skill in the art recognized that each Cas enzyme of the CRISPR/Cas system recited at a high level of generality in instant independent Claim 83 has its own PAM recognition nucleotide sequence. Thus, it is axiomatic that different PAM sequences would negative the binding of SEQ ID NO:2 and/or SEQ ID NO:3 crRNAs to the target sequence because these other, structurally unrecited and not disclosed, PAM sequences are simply not present in the HIV-1 target DNA adjacent to the SEQ ID NO:2 and/or SEQ ID NO:3 crRNA HIV-1 target sequence(s).
Those of ordinary skill in the art would not be able to determine a trend in the exemplified data (Cas9 enzyme with it’s corresponding canonical Cas9 PAM motif, and in the presence of a tracrRNA) which would allow the artisan to reasonably extend the probative value thereof, nor have adequate basis for reasonably concluding that the great number and variety of compositions included in the claims (Cas enzymes recited at a high level of generality, and their corresponding, unrecited, non-disclosed, PAM motif nucleotide sequences, and in the absence of tracrRNA) would behave in the same manner as the tested composition because of the multitude of physical and chemical variables that each affect the resulting structural and functional properties of the CRISPR/Cas system comprising the SEQ ID NO:2 and SEQ ID NO:3 crRNAs.
Applicant provides no objective evidence that the asserted secondary considerations of superiority and efficiency for the combination of SEQ ID NO:2 and SEQ ID NO:3 achieved using the art-recognized CRISPR/Cas9 system comprising a sgRNA comprising the crRNA, tracrRNA, and corresponding Cas9 canonical PAM motif are necessarily and predictably achieved using the broadly claimed genus of Cas enzymes recited at a high level of generality and their corresponding PAM motif sequences recited at a high level of generality, and in the absence of a tracrRNA.
Those of ordinary skill in the art would immediately recognize that independent Claim 83 is vastly broader in scope than asserted secondary considerations.
Claim 83 is not commensurate in scope to asserted secondary considerations. See, instead, currently amended Claim 101.
As a second matter, instant Claim 83 recites a “CRISPR/Cas system comprising at least two crRNA sequences….”. However, the term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). The claim does not prohibit or otherwise exclude the presence of additional crRNAs directed to different target sequences. To put it another way, the claims are not limited to just SEQ ID NO:2 in combination with SEQ ID NO:3. See, for example, originally presented Claim 84.
Ophinni et al successfully demonstrated a multiplex CRISPR/Cas9 system comprising at least 3 or 6 different crRNAs (e.g. --Figure 5, legend, “CRISPR-transduced with… tat/rev-targeting gRNAs, either… multiple of three…or six”).
As a third matter, Ophinni et al successfully demonstrated that the combination of multiple sgRNAs comprising crRNAs directed to Tet and Rev sequences yielded superior results as compared to individual sgRNAs (e.g. Figure 5).
Applicant argues that the combination of SEQ ID NO:2 and SEQ ID NO:3 have very little possibility for off-target cleavage, whereby the observed off-target sites were intronic or non-coding regions.
Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's argument that off-target sites were intronic or non-coding regions, the fact that the inventor has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985).
Ophinni et al taught that HIV-1 directed crRNAs “showed no…detectable off-target activity in the human genome” (e.g. Figure 4, legend).
Furthermore, Ophinni et al taught that the CRISPR recognition mechanism may tolerate certain mismatches to a varying degree and produce off-target mutagenesis, and the selection of a highly specific gRNA design is important for minimizing this effect (e.g. pg 8, para 2).
Thus, selecting gRNAs comprising a crRNA sequence with very little off-target activity is considered routine in the art for the ordinary artisan.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Applicant argues that the combination of SEQ ID NO:2 and SEQ ID NO:3 was sufficient to prevent the evolution of HIV escape mutants (pg 29; Figure 10).
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, asserted secondary considerations were achieved using a lentiviral CRISPR/Cas system comprising a Cas9 enzyme and sgRNAs comprising a tracrRNA. Those of ordinary skill in the art would immediately recognize that independent Claim 83 is vastly broader in scope than asserted secondary considerations. Claim 83 is not commensurate in scope to asserted secondary considerations. See, instead, currently amended Claim 101.
As a second matter, instant Claim 83 recites a “CRISPR/Cas system comprising at least two crRNA sequences….”. However, the term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). The claim does not prohibit or otherwise exclude the presence of additional crRNAs directed to different target sequences. To put it another way, the claims are not limited to just SEQ ID NO:2 in combination with SEQ ID NO:3.
Ophinni et al successfully demonstrated a multiplex CRISPR/Cas9 system comprising at least 3 or 6 different crRNAs (e.g. --Figure 5, legend, “CRISPR-transduced with… tat/rev-targeting gRNAs, either… multiple of three…or six”).
As a third matter, Ophinni et al successfully demonstrated that the combination of multiple sgRNAs comprising crRNAs directed to Tet and Rev sequences yielded superior results as compared to individual sgRNAs (e.g. Figure 5).
Furthermore, Ophinni et al taught that “more recent studies discovered that the combination of two gRNAs circumvented this issue because repeated Cas9 cleavage may have led to the saturation of target mutations and prevented viral escape. Dual gRNA combinations, particularly those targeting conserved and essential viral gene sequences, are able to mutate a large fraction of the provirus and inactivate it, creating major bottlenecks in viral evolution by severely limiting replication-competent virus variants. We combined even more gRNAs; six tat and rev gRNA combinations showed the similar or even stronger inhibition of replication than single gRNA.” (e.g. pg 8, para 3). Thus, the asserted secondary consideration is not considered to be a surprising or unexpected result.
Applicant argues that the teachings of Joung et al are irrelevant to the instant claims because Joung et al is directed to a single gRNA comprising a crRNA that targets a different gene than the instantly claimed combination of crRNAs targeting an HIV-1 genome.
Applicant’s argument(s) has been fully considered, but is not persuasive. Joung et al is considered relevant prior art for having disclosed that the CRISPR/Cas9 system, per natural law of cell biology and enzymology, can generate structurally different deletions as large as 200 nucleotides in length around the sgRNA target site.
Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NOs: 2 and/or 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NOs: 2 and/or 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NOs: 2 and/or 3 is/are substantially the same as the crRNAs of Ophinni et al and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al that target the same HIV-1 tat or rev gene site as instant SEQ ID NOs: 2 and/or 3, and there is no objective evidence of criticality for instant SEQ ID NOs: 2 and/or 3 for the ability to edit the HIV-1 tat or rev gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat or rev gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NOs: 2 and/or 3 would be molecularly indistinguishable from the tat gene edits of Ophinni et al’s crRNA and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat or rev gene site as instant SEQ ID NOs: 2 and/or 3, that substantially overlaps with the crRNA sequence of instant SEQ ID NOs: 2 and/or 3.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Applicant argues that Cribbs et al do not overcome the deficiencies of Ophinni et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Ophinni et al are discussed above and incorporated herein. Applicant does not contest the teachings of Cribbs et al as applied to the obviousness to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentivirus formulary with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, because Cribbs et al taught that formulating the lentivirus in PBS is part of a simplified means of producing and transducing the lentiviral vectors to the artisan’s target host cells, as successfully demonstrated with human T cells.
Applicant argues that Watanabe et al is directed to oligonucleotides that target the HIV proviral genome, irrelevant to a CRISPR/Cas system.
Applicant’s argument(s) has been fully considered, but is not persuasive.
The Examiner must determine what is "analogous prior art" for the purpose of analyzing the obviousness of the subject matter at issue. **>"Under the correct analysis, any need or problem known in the field of endeavor at the time of the invention and addressed by the patent [or application at issue] can provide a reason for combining the elements in the manner claimed. " KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). Thus a reference in a field different from that of applicant's endeavor may be reasonably pertinent if it is one which, because of the matter with which it deals, logically would have commended itself to an inventor's attention in considering his or her invention as a whole.<
Ophinni et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
Watanabe et al is considered relevant prior art for having disclosed oligonucleotides that promote the degradation of a target sequence, e.g. antisense oligonucleotides (e.g. pg 1, line26), wherein the oligonucleotide targets the HIV-1 proviral genome (e.g. pg 8, lines 13-14), wherein the oligonucleotide, e.g. SEQ ID NO:36, has a 95% match (1 mismatch) with instant SEQ ID NO:3, as shown below:
GAAGGAAUCGAAGAAGAAGG
|||||||: |||||||||||
GAAGGAATAGAAGAAGAAGG
Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NOs: 2 and/or 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NOs: 2 and/or 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Applicant argues that Goudsmit et al is directed to primers to amplify an HIV-1 vpu gene, and is silent to a crRNA.
Applicant’s argument(s) has been fully considered, but is not persuasive.
The Examiner must determine what is "analogous prior art" for the purpose of analyzing the obviousness of the subject matter at issue. **>"Under the correct analysis, any need or problem known in the field of endeavor at the time of the invention and addressed by the patent [or application at issue] can provide a reason for combining the elements in the manner claimed. " KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). Thus a reference in a field different from that of applicant's endeavor may be reasonably pertinent if it is one which, because of the matter with which it deals, logically would have commended itself to an inventor's attention in considering his or her invention as a whole.<
Ophinni et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Goudsmit et al is considered relevant prior art for having disclosed an oligonucleotide primer to amplify HIV-1 sequences, VPU-1, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NOs: 2 and/or 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NOs: 2 and/or 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Applicant argues that Chang is directed to a miRNA that targets HIV-1 vpu gene.
Applicant’s argument(s) has been fully considered, but is not persuasive.
The Examiner must determine what is "analogous prior art" for the purpose of analyzing the obviousness of the subject matter at issue. **>"Under the correct analysis, any need or problem known in the field of endeavor at the time of the invention and addressed by the patent [or application at issue] can provide a reason for combining the elements in the manner claimed. " KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). Thus a reference in a field different from that of applicant's endeavor may be reasonably pertinent if it is one which, because of the matter with which it deals, logically would have commended itself to an inventor's attention in considering his or her invention as a whole.<
Ophinni et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Chang is considered relevant prior art for having disclosed an antisense or miRNA oligonucleotide to inhibit HIV-1 replication (e.g. pg 22) SEQ ID NO:5, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NOs: 2 and/or 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NOs: 2 and/or 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
5. Claims 91-95 and 97-99 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record), Watanabe et al (WO 95/31434; of record), Goudsmit et al (WO 2002/20571; of record), and Chang (WO 2012/159120; of record), and Joung et al (U.S. 2014/0295556), as applied to Claims 83, 91-93, and 96-100 above, and in further view of Kabadi et al (available online October 29, 2014; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Ophinni et al nor Cribbs et al teach wherein the at least first and second gRNAs of the CRISPR/Cas system are encoded by the same vector.
However, prior to the effective filing date of the instantly claimed invention, Kabadi et al is considered relevant prior art for having taught a CRISPR/Cas9 lentiviral expression system, wherein the lentiviral vector encodes multiplex gRNAs, e.g. 4 different sgRNAs targeting the same gene of interest (e.g. pg 5, col. 1, “we assembled a single lentiviral vector expressing four independent IL1RN-targeting sgRNAs”).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentivirus formulary with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, because Cribbs et al taught that formulating the lentivirus in PBS is part of a simplified means of producing and transducing the lentiviral vectors to the artisan’s target host cells, as successfully demonstrated with human T cells.
Kabadi et al successfully demonstrated a reduction to practice using a CRISPR/Cas9 lentiviral expression system, wherein the lentiviral vector encodes multiplex gRNAs, e.g. 4 different sgRNAs targeting the same gene of interest (e.g. pg 5, col. 1, “we assembled a single lentiviral vector expressing four independent IL1RN-targeting sgRNAs”).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 91-93, Ophinni et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. pg 9, Methods).
Kabadi et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. Title; Figure 2).
With respect to Claims 95 and 97, Ophinni et al taught wherein the vector(s) is/are lentiviral vectors (e.g. pg 5, para 1).
Kabadi et al taught wherein the vector(s) is/are lentiviral vectors (e.g. Title; Figure 2).
With respect to Claims 98-99, Ophinni et al taught wherein the first and second gRNAs were cloned into the lentiCRISPRv2 expression vector (e.g. Abstract), whereby Addgene evidences that the lentiCRISPRv2 expression vector comprises a eukaryotic promoter operably linked to a tracr RNA sequence.
Kabadi et al taught wherein the first and second crRNAs were cloned into sgRNAs, recognized by the ordinary artisans to inherently and naturally comprise a tracrRNA sequence, and that the lentivirus expression vector comprises a eukaryotic promoter operably linked to a sgRNAs (e.g. Figure 2).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Kabadi et al do not cure the defect of Ophinni et al and Cribb et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Ophinni et al and Cribb et al are discussed above and incorporated herein. Applicant does not contest the teachings of Kabadi et al as applied to the obviousness to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
6. Claim 103 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record), Watanabe et al (WO 95/31434; of record), Goudsmit et al (WO 2002/20571; of record), and Chang (WO 2012/159120; of record), and Joung et al (U.S. 2014/0295556), as applied to Claims 83, 91-93, and 96-100 above, and in further view of
Chen (U.S. 2016/0017366; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claims 91-93, Ophinni et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. pg 9, Methods).
Joung et al disclosed wherein the system comprises a nucleic acid encoding Cas9 (e.g. Figure 1, “Cas9”; [0076], “Cas9”).
Neither Ophinni et al nor Joung et al teach/disclose wherein the Cas enzyme is Cas10d. However, prior to the effective filing date of the instantly claimed invention, Chen et al is considered relevant prior art for having disclose methods of editing the artisan’s gene of interest using the CRISPR/Cas system, wherein the Cas enzyme may be Cas9 or Cas10d (e.g. [0017]).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first Cas enzyme, e.g. Cas9, as taught by Ophinni et al and Joung et al, with a second Cas enzyme, to wit, Cas10d, as disclosed by Chen et al, in a CRISPR/Cas method of editing the artisan’s gene of interest, including an HIV-I target gene, i.e. HIV-I tat gene, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first Cas enzyme, e.g. Cas9, with a second Cas enzyme, to wit, Cas10d, in a CRISPR/Cas method of editing the artisan’s gene of interest, including an HIV-I target gene, i.e. HIV-I tat gene, because Chen et al disclosed a finite list of known Cas enzymes, including Cas9 and Cas10d, for use in a CRISPR/Cas method of editing the artisan’s gene of interest.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Chen et al do not cure the defect of Ophinni et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Ophinni et al are discussed above and incorporated herein. Applicant does not contest the teachings of Kabadi et al as applied to the obviousness to substitute a first Cas enzyme, e.g. Cas9, as taught by Ophinni et al and Joung et al, with a second Cas enzyme, to wit, Cas10d, as disclosed by Chen et al, in a CRISPR/Cas method of editing the artisan’s gene of interest, including an HIV-I target gene, i.e. HIV-I tat gene, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first Cas enzyme, e.g. Cas9, with a second Cas enzyme, to wit, Cas10d, in a CRISPR/Cas method of editing the artisan’s gene of interest, including an HIV-I target gene, i.e. HIV-I tat gene, because Chen et al disclosed a finite list of known Cas enzymes, including Cas9 and Cas10d, for use in a CRISPR/Cas method of editing the artisan’s gene of interest.
7. Claim 101 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record), Watanabe et al (WO 95/31434; of record), Goudsmit et al (WO 2002/20571; of record), and Chang (WO 2012/159120; of record), Joung et al (U.S. 2014/0295556), and Kabadi et al (available online October 29, 2014; of record), as applied to Claims 83 and 91-100 above, and in further view of. and in further view of Bella et al (available online June 18, 2018; of record) and Rodriguez et al (U.S. Patent 9,421,242; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Ophinni et al taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
Ophinni et al taught an in vitro method of treating an HIV-1 infection, the method comprising the step of introducing into target host cells the CRISPR/Cas9 system to edit the HIV-1 tat gene. Ophinni et al taught that multiplexing all six gRNAs further increased editing efficiency of the latent HIV-1 genome in infected host T cells (e.g. Abstract).
Kabadi et al taught a CRISPR/Cas9 lentiviral expression system, wherein the lentiviral vector encodes multiplex gRNAs, e.g. 4 different sgRNAs targeting the same gene of interest (e.g. pg 5, col. 1, “we assembled a single lentiviral vector expressing four independent IL1RN-targeting sgRNAs”).
Cribbs et al taught a lentiviral vector system comprising a pharmaceutically acceptable excipient, e.g. PBS (e.g pg 3, col. 2, Methods, lentivirus production) and an in vitro method of transducing human T cells with said lentivirus system.
Neither Ophinni et al, Cribbs et al, Joung et al, nor Kabadi et al teach/disclose wherein the CRISPR/Cas9 editing system is administered intravenously to a human subject.
However, prior to the effective filing date of the instantly claimed invention, Ophinni et al taught that the RNA-guided CRISPR/Cas9 targeting the HIV-1 regulatory genes tat and rev may serve as a favorable means to achieve functional cures (e.g. Abstract; pg 8, Conclusion, “CRISPR-bearing lentiviral vectors may be delivered into HIV-1-infected individuals to clear latent viral reservoirs”), for which the ordinary artisan would have reasonably inferred to imply administering the CRISPR/Cas9 editing system to a human subject.
Bella et al is considered relevant prior art for having successfully demonstrated an in vivo method of editing the HIV-I genome in a mouse subject, the method comprising the step of intravenously administering to said mouse a lentiviral vector encoding a CRISPR/Cas9 system that targets the HIV-I genome (e.g. Abstract; pg 276, col. 1, para 2, “intravenous administration of LV-CRISPR/Cas9”). Bella et al taught that the method provides proof-of-principle for the ability of lentivirus vectors to effectively deliver CRISPR to various cells and organs and excise HIV-I viral DNA from the cells of human patients, as evidenced by an at least 93% decrease in the viral recovery assay (e.g. pg 280, col. 2).
Rodriguez et al is considered relevant prior art for having claimed administering a lentiviral vector to a mouse or human subject (claim 1), wherein the lentiviral vector may be administered intravenously (e.g. claim 5).
Patented claims are considered enabled, absent objective evidence to the contrary.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the in vitro method of editing an HIV-I genome in human cells, as taught by Ophinni et al, to an in vivo method of editing an HIV-I genome in a human subject comprising the step of intravenously administering the lentiviral vector to the human subject with motivation and a reasonable expectation of success because:
i) Ophinni et al taught that the RNA-guided CRISPR/Cas9 targeting the HIV-1 regulatory genes tat and rev may serve as a favorable means to achieve functional cures (e.g. Abstract; pg 8, Conclusion, “CRISPR-bearing lentiviral vectors may be delivered into HIV-1-infected individuals to clear latent viral reservoirs”), for which the ordinary artisan would have reasonably inferred to imply administering the CRISPR/Cas9 editing system to a human subject;
ii) Bella et al successfully demonstrated an in vivo method of editing the HIV-I genome in a mouse subject, the method comprising the step of intravenously administering to said mouse a lentiviral vector encoding a CRISPR/Cas9 system that targets the HIV-I genome (e.g. pg 276, col. 1, para 2, “intravenous administration of LV-CRISPR/Cas9”), whereby the method provides proof-of-principle for the ability of lentivirus vectors to effectively deliver CRISPR to various cells and organs and excise HIV-I viral DNA from the cells of human patients, as evidenced by an at least 93% decrease in the viral recovery assay (e.g. pg 280, col. 2); and
iii) Rodriguez et al claims administering a lentiviral vector to a mouse or human subject (claim 1), wherein the lentiviral vector may be administered intravenously (e.g. claim 5).
Patented claims are considered enabled, absent objective evidence to the contrary.
There is no objective evidence in the prior art that intravenous administration of lentivirus vectors to a human subject is not enabled, constitutes undue experimentation, and/or is devoid of predictability, given that the prior art had already successfully reduced to practice intravenous administration of lentivirus vectors to pre-clinical mammalian subjects.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Bella et al do not teach the instantly claimed crRNA SEQ ID NO’s.
Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). See discussions supra.
Applicant argues that Rodriguez et al do not overcome the deficiencies of Ophinni et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Ophinni et al are discussed above and incorporated herein. Applicant does not contest the teachings of Rodriguez et al as applied to the obviousness to modify the in vitro method of editing an HIV-I genome in human cells, as taught by Ophinni et al, to an in vivo method of editing an HIV-I genome in a human subject comprising the step of intravenously administering the lentiviral vector to the human subject with motivation and a reasonable expectation of success because:
i) Ophinni et al taught that the RNA-guided CRISPR/Cas9 targeting the HIV-1 regulatory genes tat and rev may serve as a favorable means to achieve functional cures (e.g. Abstract; pg 8, Conclusion, “CRISPR-bearing lentiviral vectors may be delivered into HIV-1-infected individuals to clear latent viral reservoirs”), for which the ordinary artisan would have reasonably inferred to imply administering the CRISPR/Cas9 editing system to a human subject;
ii) Bella et al successfully demonstrated an in vivo method of editing the HIV-I genome in a mouse subject, the method comprising the step of intravenously administering to said mouse a lentiviral vector encoding a CRISPR/Cas9 system that targets the HIV-I genome (e.g. pg 276, col. 1, para 2, “intravenous administration of LV-CRISPR/Cas9”), whereby the method provides proof-of-principle for the ability of lentivirus vectors to effectively deliver CRISPR to various cells and organs and excise HIV-I viral DNA from the cells of human patients, as evidenced by an at least 93% decrease in the viral recovery assay (e.g. pg 280, col. 2); and
iii) Rodriguez et al claims administering a lentiviral vector to a mouse or human subject (claim 1), wherein the lentiviral vector may be administered intravenously (e.g. claim 5).
Patented claims are considered enabled, absent objective evidence to the contrary.
There is no objective evidence in the prior art that intravenous administration of lentivirus vectors to a human subject is not enabled, constitutes undue experimentation, and/or is devoid of predictability, given that the prior art had already successfully reduced to practice intravenous administration of lentivirus vectors to pre-clinical mammalian subjects.
Conclusion
8. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638
Prosecution Insights