Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
This action is in response to the papers filed February 9, 2026.
Amendments
Applicant's amendments, filed February 9, 2026, are acknowledged. Applicant has cancelled Claims 1-82, 84, 88-90, and 102, amended Claims 83, 85-87, 92, and 101, and added new claims, Claim 103.
Claims 83, 85-87, 91-101, and 103 are pending an under examination.
Priority
This application is a 371 of PCT/US2021/021246 filed on March 5, 2021. Applicant’s claim for the benefit of a prior-filed application provisional applications:
63/125,545 filed on December 15, 2020;
62/986,216 filed on March 6, 2020; and
62/985,392 filed on March 5, 2020
under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on February 9, 2026 that has been considered.
The information disclosure statement filed February 9, 2026 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because 37 CFR 1.98(b) requires that each item of information in an IDS be identified properly. Each publication must be identified by publisher, author (if any), title, relevant pages of the publication, and date and place of publication. The date of publication supplied must include at least the month and year of publication, except that the year of publication (without the month) will be accepted if the applicant points out in the information disclosure statement that the year of publication is sufficiently earlier than the effective U.S. filing date and any foreign priority date so that the particular month of publication is not in issue.
See also MPEP 707.05(e) for electronic documents, including, but not limited to:
(D) reference to the unique Digital Object Identifier (DOI) number, or other unique identification number, if known.
NPL citations have been lined through for being defective of one or more requirements.
The signed and initialed PTO Forms 1449 are mailed with this action.
Specification
1. The prior objection to the disclosure is withdrawn in light of Applicant’s amendment to the specification, which the Examiner finds persuasive.
Claim Objections
2. The prior objection to Claim 92 is withdrawn in light of Applicant’s amendment to the claim, which the Examiner finds persuasive.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
3. The prior rejection of Claims 88-90 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of the claims.
4. The prior rejection of Claim 92 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to the claim, which the Examiner finds persuasive.
5. The prior rejection of Claim 101 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to the claim, which the Examiner finds persuasive.
6. The prior rejections of Claims 83 and 88-102 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, are withdrawn in light of Applicant’s amendment to the claims reciting SEQ ID NO’s: 1-8, which the Examiner finds persuasive.
7. The prior rejections of Claims 101-102 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, are withdrawn in light of Applicant’s cancellation of Claim 102, and amendment to Claim 101, narrowing the scope of the method to treating an HIV-1 infection in a human subject, the method comprising the step of intravenous administration to the human subject with a pharmaceutical composition comprising a lentiviral vector whose genome encodes a Cas9 enzyme and at least two gRNA SEQ ID NO’s, which the Examiner finds persuasive.
8. Claim 101 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 101 recites “the pharmaceutical composition of claim 100…., wherein the first crRNA sequence comprises SEQ ID NO:2 and the second crRNA sequence comprises SEQ ID NO:3”.
Claim 100 recites “A pharmaceutical composition…. according to claim 83”.
Claim 83 recites a first crRNA sequence “selected from the group consisting of SEQ ID NOs:1-8” and “a second crRNA sequence “selected from the group consisting of SEQ ID NOs:1-8”.
It is axiomatic that the phrase “according to” does not have the same meaning as, and is broader in scope than, the preposition “of”.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 101 recites, in reference to Claims 100 and 83, the broad recitation “selected from the group consisting of SEQ ID NOs:1-8”, and the claim also recites “wherein the first crRNA sequence comprises SEQ ID NO:2 and the second crRNA sequence comprises SEQ ID NO:3” which is the narrower statement of the range/limitation.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 101 recites, in reference to Claims 100 and 83, the broad recitation “pharmaceutical composition comprising the CRISPR/Cas system”, and the claim also recites “wherein the first and second nucleic acids are part of a same vector, wherein said vector is a lentiviral vector” which is the narrower statement of the range/limitation.
The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
The Examiner notes that Claim 101 is unnecessarily verbose in that the penultimate ‘wherein’ clause can be more concisely presented as “wherein the first nucleic acid and the second nucleic acid are part of a same lentiviral vector”.
The Examiner also notes that the entire claim can be even more concisely presented as follows:
“A method for treating an HIV-1 infection in a human, the method comprising the step of intravenously administering to said human a pharmaceutical composition comprising a lentiviral vector encoding:
a) a first nucleic acid comprising a crRNA sequence comprising the sequence of SEQ ID NO:2 and a tracrRNA sequence;
b) a second nucleic acid comprising a crRNA sequence comprising the sequence of SEQ ID NO:3 and a tracrRNA sequence; and
c) a third nucleic acid that encodes Cas9.”
9. Claim 101 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claim has been amended to recite “wherein the first nucleic acid or the second nucleic acid further comprises a tracrRNA sequence”.
The breadth of the claim encompasses embodiments whereby:
i) the first crRNA-encoding nucleic acid does not comprise a tracrRNA sequence; or, alternatively,
ii) the second crRNA-encoding nucleic acid does not comprise a tracrRNA sequence.
Those of ordinary skill in the art have long-recognized that the CRISPR/Cas9 gene editing system does not work in the absence of a tracrRNA sequence.
The specification fails to disclose a CRISPR/Cas9 gene editing system that works in the absence of a tracrRNA sequence.
Absent objective evidence to the contrary, it would be remedial for Applicant to claim the invention correctly per the global scientific community, whereby:
i) the first crRNA-encoding nucleic acid further comprises a tracrRNA sequence; and
ii) the second crRNA-encoding nucleic acid further comprises a tracrRNA sequence.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
10. Claim 101 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, while being enabling for:
i) the first crRNA-encoding nucleic acid further comprises a tracrRNA sequence; and
ii) the second crRNA-encoding nucleic acid further comprises a tracrRNA sequence,
does not reasonably provide enablement for:
i) the first crRNA-encoding nucleic acid does not comprise a tracrRNA sequence; or, alternatively,
ii) the second crRNA-encoding nucleic acid does not comprise a tracrRNA sequence.
Those of ordinary skill in the art have long-recognized that the CRISPR/Cas9 gene editing system does not work in the absence of a tracrRNA sequence.
The specification fails to disclose a CRISPR/Cas9 gene editing system that works in the absence of a tracrRNA sequence.
Absent objective evidence to the contrary, it would be remedial for Applicant to claim the invention correctly per the global scientific community, whereby:
i) the first crRNA-encoding nucleic acid further comprises a tracrRNA sequence; and
ii) the second crRNA-encoding nucleic acid further comprises a tracrRNA sequence.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Claim Rejections - 35 USC § 102
11. The prior rejection of Claim(s) 83-84, 88-93, and 96-99 under 35 U.S.C. 102(a)(1) as being anticipated by Ophinni et al (CRISPR/Cas9 system targeting regulatory genes of HIV-1 inhibits viral replication in infected T-cell cultures. Scientific Reports 8: e7784, 12 pages; doi.org/10.1038/s41598-018-26190-1; available online May 17, 2018), as evidenced by Addgene (lentiCRISPRv2; last accessed August 4, 2025) is withdrawn in light of Applicant’s amendment to the independent claim(s) limiting the scope to SEQ ID NOs: 1-8, a limitation Ophinni et al do not teach.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
12. Claims 83, 85-87, 91-93, and 96-100 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record) and Joung et al (U.S. 2014/0295556).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 83, Ophinni et al is considered relevant prior art for having taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
Ophinni et al taught an in vitro method of treating an HIV-1 infection, the method comprising the step of introducing into target host cells the CRISPR/Cas9 system to edit the HIV-1 tat gene. Ophinni et al taught that multiplexing all six gRNAs further increased editing efficiency of the latent HIV-1 genome in infected host T cells (e.g. Abstract).
Ophini et al taught the TatA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 90% identical to the crRNA sequence of instant SEQ ID NO:1 (upper line), as shown below:
UAGAUCCUAACCUAGAGCCC
TAGATCCTAGACTAGAGCCC
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NO:1 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site.
Joung et al is considered relevant prior art for having disclosed that the CRISPR/Cas9 system, per natural law of cell biology and enzymology, can generate structurally different deletions as large as 200 nucleotides in length around the sgRNA target site, shown below.
PNG
media_image2.png
314
634
media_image2.png
Greyscale
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:1 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that is 90% identical to the crRNA sequence of instant SEQ ID NO:1.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Ophini et al taught the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that is 95% identical to the crRNA sequence of instant SEQ ID NO:7 (upper line), as shown below:
GCUUAGGCAUCUCCUAUGGC
CCTTAGGCATCTCCTATGGC
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NO:7 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:7 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that is 95% identical to the crRNA sequence of instant SEQ ID NO:7.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Ophini et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NO:2 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:2 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NO:2.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Ophini et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NO:3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:3 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that is 60% identical to the crRNA sequence of instant SEQ ID NO:3.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Ophini et al do not teach ipsis verbis that the lentiviral vectors encoding the CRISPR/Cas9 system were formulated with a pharmaceutically acceptable excipient.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 100, Cribbs et al is considered relevant prior art for having taught a lentiviral vector system comprising a pharmaceutically acceptable excipient, e.g. PBS (e.g pg 3, col. 2, Methods, lentivirus production) and an in vitro method of transducing human T cells with said lentivirus system.
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and viral vectors. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentivirus formulary with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, because Cribbs et al taught that formulating the lentivirus in PBS is part of a simplified means of producing and transducing the lentiviral vectors to the artisan’s target host cells, as successfully demonstrated with human T cells.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 85-87, Ophini et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Ophini et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA sequence is substantially the same as the crRNA of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NO:2 and/or SEQ ID NO:3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target sites.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NO:2 and SEQ ID NO:3 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NO:2 and crRNA that is 60% identical to the crRNA sequence of instant SEQ ID NO:3, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
With respect to Claims 91-93, Ophinni et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. pg 9, Methods).
With respect to Claim 96, Ophinni et al taught wherein the first and second gRNA nucleic acids are part of different vectors (e.g. pg 5, para 1).
With respect to Claim 97, Ophinni et al taught wherein the vector(s) is/are lentiviral vectors (e.g. pg 5, para 1).
With respect to Claims 98-99, Ophinni et al taught wherein the first and second gRNAs were cloned into the lentiCRISPRv2 expression vector (e.g. Abstract), whereby Addgene evidences that the lentiCRISPRv2 expression vector comprises a eukaryotic promoter operably linked to a tracr RNA sequence.
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Ophini et al do not teach crRNA SEQ ID NOs: 1-8.
Applicant’s argument(s) has been fully considered, but is not persuasive.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NOs: 1, 2, 3, and 7 is/are substantially the same as the crRNAs of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NOs: 1, 2, 3, and 7 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NOs: 1, 2, 3, and 7 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NOs: 1, 2, 3, and 7, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
13. Claims 91-95 and 97-99 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record), Cribbs et al (available online November 12, 2013; of record), and Joung et al (U.S. 2014/0295556), as applied to Claims 83, 85-87, 91-93, and 96-100 above, and in further view of Kabadi et al (available online October 29, 2014; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Ophinni et al nor Cribbs et al teach wherein the at least first and second gRNAs of the CRISPR/Cas system are encoded by the same vector.
However, prior to the effective filing date of the instantly claimed invention, Kabadi et al is considered relevant prior art for having taught a CRISPR/Cas9 lentiviral expression system, wherein the lentiviral vector encodes multiplex gRNAs, e.g. 4 different sgRNAs targeting the same gene of interest (e.g. pg 5, col. 1, “we assembled a single lentiviral vector expressing four independent IL1RN-targeting sgRNAs”).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentivirus formulary with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, because Cribbs et al taught that formulating the lentivirus in PBS is part of a simplified means of producing and transducing the lentiviral vectors to the artisan’s target host cells, as successfully demonstrated with human T cells.
Kabadi et al successfully demonstrated a reduction to practice using a CRISPR/Cas9 lentiviral expression system, wherein the lentiviral vector encodes multiplex gRNAs, e.g. 4 different sgRNAs targeting the same gene of interest (e.g. pg 5, col. 1, “we assembled a single lentiviral vector expressing four independent IL1RN-targeting sgRNAs”).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 91-93, Ophinni et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. pg 9, Methods).
Kabadi et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. Title; Figure 2).
With respect to Claims 95 and 97, Ophinni et al taught wherein the vector(s) is/are lentiviral vectors (e.g. pg 5, para 1).
Kabadi et al taught wherein the vector(s) is/are lentiviral vectors (e.g. Title; Figure 2).
With respect to Claims 98-99, Ophinni et al taught wherein the first and second gRNAs were cloned into the lentiCRISPRv2 expression vector (e.g. Abstract), whereby Addgene evidences that the lentiCRISPRv2 expression vector comprises a eukaryotic promoter operably linked to a tracr RNA sequence.
Kabadi et al taught wherein the first and second crRNAs were cloned into sgRNAs, recognized by the ordinary artisans to inherently and naturally comprise a tracrRNA sequence, and that the lentivirus expression vector comprises a eukaryotic promoter operably linked to a sgRNAs (e.g. Figure 2).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Kabadi et al do not cure the defect of Ophini et al and Cribb et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Ophini et al and Cribb et al are discussed above and incorporated herein. Applicant does not contest the teachings of Kabadi et al as applied to the obviousness to substitute a first lentivirus formulary, as taught by Ophinni et al, with a second lentivirus formulary, i.e. comprising a pharmaceutically acceptable excipient, to wit, PBS, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
14. Claims 85-87 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record), Cribbs et al (available online November 12, 2013; of record), and Joung et al (U.S. 2014/0295556; of record), as applied to Claims 83, 85-87, 91-93, and 96-100 above, and in further view of Watanabe et al (WO 95/31434; of record), Goudsmit et al (WO 2002/20571; of record), and Chang (WO 2012/159120; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 83, Ophinni et al is considered relevant prior art for having taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
Ophinni et al taught an in vitro method of treating an HIV-1 infection, the method comprising the step of introducing into target host cells the CRISPR/Cas9 system to edit the HIV-1 tat gene. Ophinni et al taught that multiplexing all six gRNAs further increased editing efficiency of the latent HIV-1 genome in infected host T cells (e.g. Abstract).
With respect to Claims 85-87, Ophini et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Ophini et al taught that the RevA gRNA has a crRNA nucleotide sequence (Figure 1B) that is 60% identical to (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3 (upper line), as shown below:
GAAGGAAUCGAAGAAGAAGG
CCCGACAGGCCCGAAGGAATAGA
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NOs: 2 and 3 is/are substantially the same as the crRNAs of Ophini et al, and there is no objective evidence of criticality for instant SEQ ID NOs: 2 and 3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NOs: 2 and 3 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA that substantially overlaps with the crRNA sequence of instant SEQ ID NOs: 2 and 3, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Watanabe et al is considered relevant prior art for having disclosed oligonucleotides that promote the degradation of a target sequence, e.g. antisense oligonucleotides (e.g. pg 1, line26), wherein the oligonucleotide targets the HIV-1 proviral genome (e.g. pg 8, lines 13-14), wherein the oligonucleotide, e.g. SEQ ID NO:36, has a 95% match with instant SEQ ID NO:3, as shown below:
GAAGGAAUCGAAGAAGAAGG
|||||||: |||||||||||
GAAGGAATAGAAGAAGAAGG
Goudsmit et al is considered relevant prior art for having disclosed an oligonucleotide primer to amplify HIV-1 sequences, VPU-1, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Chang is considered relevant prior art for having disclosed an antisense or miRNA oligonucleotide to inhibit HIV-1 replication (e.g. pg 22) SEQ ID NO:5, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2, with a second crRNA nucleotide sequence having a 100% match to instant SEQ ID NO:2, and to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3, with a second crRNA nucleotide sequence having at least a 95% match (1 nt difference) to instant SEQ ID NO:3, in a CRISPR/Cas system to edit an HIV-1 genome with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2, with a second crRNA nucleotide sequence having a 100% match to instant SEQ ID NO:2, and to substitute a first crRNA nucleotide sequence (that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:3, with a second crRNA nucleotide sequence having at least a 95% match (1 nt difference) to instant SEQ ID NO:3, in a CRISPR/Cas system to edit an HIV-1 genome because those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NO’s: 2 and 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NO’s: 2 and 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant crRNA SEQ ID NOs: 2 and 3 is/are substantially the same as the crRNAs of Ophini et al and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat gene site as instant SEQ ID NOs: 2 and 3, respectively, and there is no objective evidence of criticality for instant SEQ ID NOs: 2 and 3 for the ability to edit the HIV-1 tat gene, as opposed to the prior art’s successful reduction to practice editing the same or substantially the same tat gene target site(s), respectively.
Thus, those of ordinary skill in the art would immediately recognize that, per natural law of cell biology and enzymology, the tat gene edits achieved by instant SEQ ID NOs: 2 and 3 would be molecularly indistinguishable from the tat gene edits of Ophini et al’s crRNA and/or crRNAs comprising the previously known antisense or primer oligonucleotide sequences of Watanabe et al, Goudsmit et al, and Chang that target the same HIV-1 tat gene site as instant SEQ ID NOs: 2 and 3, respectively, that substantially overlaps with the crRNA sequence of instant SEQ ID NOs: 2 and 3, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Goudsmit et al is directed to amplification of the HIV vpu gene, which is a different utility and purpose than the instantly claimed invention. Similarly, the oligonucleotide of Chang targets the HIV vpu gene, which is a different utility and purpose than the instantly claimed invention.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner must determine what is "analogous prior art" for the purpose of analyzing the obviousness of the subject matter at issue. **>"Under the correct analysis, any need or problem known in the field of endeavor at the time of the invention and addressed by the patent [or application at issue] can provide a reason for combining the elements in the manner claimed. " KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). Thus a reference in a field different from that of applicant's endeavor may be reasonably pertinent if it is one which, because of the matter with which it deals, logically would have commended itself to an inventor's attention in considering his or her invention as a whole.<
Ophinni et al taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
Ophini et al taught that the TatB gRNA has a crRNA nucleotide sequence (Figure 1B) that substantially overlaps with (syn. “has a sequence according to”) the crRNA sequence of instant SEQ ID NO:2 (upper line), as shown below:
UCUCCUAUGGCAGGAAGAAG
CCTTAGGCATCTCCTATGGCAGG
Goudsmit et al is considered relevant prior art for having disclosed an oligonucleotide primer to amplify HIV-1 sequences, VPU-1, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
Chang is considered relevant prior art for having disclosed an antisense or miRNA oligonucleotide to inhibit HIV-1 replication (e.g. pg 22) SEQ ID NO:5, having 100% match to instant SEQ ID NO:2, as shown below:
UCUCCUAUGGCAGGAAGAAG
:|:||:|:||||||||||||
TCTCCTATGGCAGGAAGAAG
M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. Those of ordinary skill in the art previously recognized the HIV-1 target sequences having 100% and/or 95% complementarity to instant SEQ ID NO’s: 2 and 3, whereby primers, antisense oligonucleotides and/or miRNAs having at least 95% to 100% identity to instant SEQ ID NO’s: 2 and 3 were previously recognized in the art to have specificity for the HIV-1 genome, including being useful to silence expression of the HIV-1 genome.
Oligonucleotide sequences targeting the same HIV-1 genomic site as instant SEQ ID NO:2 were previously known, and thus substituting the crRNA sequence that substantially overlaps with instant SEQ ID NO:2 with a crRNA sequence that is identical to instant SEQ ID NO:2 would have been obvious.
15. Claim 103 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record) in view of Cribbs et al (available online November 12, 2013; of record) and Joung et al (U.S. 2014/0295556; of record), as applied to Claims 83, 85-87, 91-93, and 96-100 above, and in further view of Chen (U.S. 2016/0017366).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claims 91-93, Ophinni et al taught wherein the system comprises a nucleic acid encoding Cas9 (e.g. pg 9, Methods).
Joung et al disclosed wherein the system comprises a nucleic acid encoding Cas9 (e.g. Figure 1, “Cas9”; [0076], “Cas9”).
Neither Ophinni et al nor Joung et al teach/disclose wherein the Cas enzyme is Cas10d. However, prior to the effective filing date of the instantly claimed invention, Chen et al is considered relevant prior art for having disclose methods of editing the artisan’s gene of interest using the CRISPR/Cas system, wherein the Cas enzyme may be Cas9 or Cas10d (e.g. [0017]).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first Cas enzyme, e.g. Cas9, as taught by Ophinni et al and Joung et al, with a second Cas enzyme, to wit, Cas10d, as disclosed by Chen et al, in a CRISPR/Cas method of editing the artisan’s gene of interest, including an HIV-I target gene, i.e. HIV-I tat gene, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first Cas enzyme, e.g. Cas9, with a second Cas enzyme, to wit, Cas10d, in a CRISPR/Cas method of editing the artisan’s gene of interest, including an HIV-I target gene, i.e. HIV-I tat gene, because Chen et al disclosed a finite list of known Cas enzymes, including Cas9 and Cas10d, for use in a CRISPR/Cas method of editing the artisan’s gene of interest.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
16. Claim 101 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Ophinni et al (available online May 17, 2018; of record), Cribbs et al (available online November 12, 2013; of record), Joung et al (U.S. 2014/0295556), and Kabadi et al (available online October 29, 2014; of record), as applied to Claims 83, 85-87 and 91-100 above, and in further view of Bella et al (Removal of HIV DNA by CRISPR from Patient Blood Engrafts in Humanized Mice, Molecular Therapy 12: 275-282, doi.org/10.1016/j.omtn.2018.05.021; available online June 18, 2018) and Rodriguez et al (U.S. Patent 9,421,242).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Ophinni et al taught a CRISPR/Cas9 system to edit the proviral genome of HIV-1 in infected cells, said CRISPR/Cas9 system comprising a first gRNA comprising a crRNA that targets the tat gene and a second gRNA comprising a crRNA that targets the tat gene, wherein the first and second gRNAs target different tat gene sequences (e.g. Figure 1a), as shown below:
PNG
media_image1.png
290
432
media_image1.png
Greyscale
Ophinni et al taught an in vitro method of treating an HIV-1 infection, the method comprising the step of introducing into target host cells the CRISPR/Cas9 system to edit the HIV-1 tat gene. Ophinni et al taught that multiplexing all six gRNAs further increased editing efficiency of the latent HIV-1 genome in infected host T cells (e.g. Abstract).
Kabadi et al taught a CRISPR/Cas9 lentiviral expression system, wherein the lentiviral vector encodes multiplex gRNAs, e.g. 4 different sgRNAs targeting the same gene of interest (e.g. pg 5, col. 1, “we assembled a single lentiviral vector expressing four independent IL1RN-targeting sgRNAs”).
Cribbs et al taught a lentiviral vector system comprising a pharmaceutically acceptable excipient, e.g. PBS (e.g pg 3, col. 2, Methods, lentivirus production) and an in vitro method of transducing human T cells with said lentivirus system.
Neither Ophinni et al, Cribbs et al, Joung et al, nor Kabadi et al teach/disclose wherein the CRISPR/Cas9 editing system is administered intravenously to a human subject.
However, prior to the effective filing date of the instantly claimed invention, Ophinni et al taught that the RNA-guided CRISPR/Cas9 targeting the HIV-1 regulatory genes tat and rev may serve as a favorable means to achieve functional cures (e.g. Abstract; pg 8, Conclusion, “CRISPR-bearing lentiviral vectors may be delivered into HIV-1-infected individuals to clear latent viral reservoirs”), for which the ordinary artisan would have reasonably inferred to imply administering the CRISPR/Cas9 editing system to a human subject.
Bella et al is considered relevant prior art for having successfully demonstrated an in vivo method of editing the HIV-I genome in a mouse subject, the method comprising the step of intravenously administering to said mouse a lentiviral vector encoding a CRISPR/Cas9 system that targets the HIV-I genome (e.g. Abstract; pg 276, col. 1, para 2, “intravenous administration of LV-CRISPR/Cas9”). Bella et al taught that the method provides proof-of-principle for the ability of lentivirus vectors to effectively deliver CRISPR to various cells and organs and excise HIV-I viral DNA from the cells of human patients, as evidenced by an at least 93% decrease in the viral recovery assay (e.g. pg 280, col. 2).
Rodriguez et al is considered relevant prior art for having claimed administering a lentiviral vector to a mouse or human subject (claim 1), wherein the lentiviral vector may be administered intravenously (e.g. claim 5).
Patented claims are considered enabled, absent objective evidence to the contrary.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the in vitro method of editing an HIV-I genome in human cells, as taught by Ophini et al, to an in vivo method of editing an HIV-I genome in a human subject comprising the step of intravenously administering the lentiviral vector to the human subject with motivation and a reasonable expectation of success because:
i) Ophinni et al taught that the RNA-guided CRISPR/Cas9 targeting the HIV-1 regulatory genes tat and rev may serve as a favorable means to achieve functional cures (e.g. Abstract; pg 8, Conclusion, “CRISPR-bearing lentiviral vectors may be delivered into HIV-1-infected individuals to clear latent viral reservoirs”), for which the ordinary artisan would have reasonably inferred to imply administering the CRISPR/Cas9 editing system to a human subject;
ii) Bella et al successfully demonstrated an in vivo method of editing the HIV-I genome in a mouse subject, the method comprising the step of intravenously administering to said mouse a lentiviral vector encoding a CRISPR/Cas9 system that targets the HIV-I genome (e.g. pg 276, col. 1, para 2, “intravenous administration of LV-CRISPR/Cas9”), whereby the method provides proof-of-principle for the ability of lentivirus vectors to effectively deliver CRISPR to various cells and organs and excise HIV-I viral DNA from the cells of human patients, as evidenced by an at least 93% decrease in the viral recovery assay (e.g. pg 280, col. 2); and
iii) Rodriguez et al claims administering a lentiviral vector to a mouse or human subject (claim 1), wherein the lentiviral vector may be administered intravenously (e.g. claim 5).
Patented claims are considered enabled, absent objective evidence to the contrary.
There is no objective evidence in the prior art that intravenous administration of lentivirus vectors to a human subject is not enabled, constitutes undue experimentation, and/or is devoid of predictability, given that the prior art had already successfully reduced to practice intravenous administration of lentivirus vectors to pre-clinical mammalian subjects.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Conclusion
17. No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638