DETAILED ACTION
CONTINUED EXAMINATION UNDER 37 CFR 1.114 AFTER FINAL REJECTION
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant’s submission of RCE and the amendment filed on April 27, 2026 have been entered. The claims pending in this application are claims 1, 2, and 5-24 wherein claims 9-16, 21, and 22 have been withdrawn due to the restriction requirement mailed on July 3, 2025. Claims 1, 2, 5-8, 17-20, 23, and 24 will be examined.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 2, 5-8, 17-20, 23, and 24 are rejected under 35 U.S.C. 103 as being unpatentable over Soh et al., (US 2011/0256637 A1, published on October 20, 2011) in view of Dattagupta (US Patent No. 6,596,490 B2, published on July 22, 2003) and Johnson et al., (US 2016/0040219 A1, published on February 11, 2016).
Regarding claims 1, 2, 5, 7, 8, 17, 19, 20, and 23, since Soh et al., teach that the position of the fluorophore and the position of the quencher of the fluorophore in triple-stem probes are exchangeable (see paragraph [0051] and Figure 1), Soh et al., disclose a composition comprising an array of oligonucleotide probes, wherein, for each allele of an investigated short tandem repeat locus, a dedicated oligonucleotide probe is provided in the array, wherein each of the oligonucleotide probes (eg., a triple-stem probe in Table 2) consists of, from 5’ to 3’ or from 3’ to 5, the following 3 regions: a first flanking region comprising at least two nucleotide (eg., AGGCTGGATTTTTTATTTACCTTTTTTTAGGTAAACGACGGCCAGCCT in 5’ end), which anneals with a region (ie., having an ability to anneal) directly next to a short tandem repeat region of interest and which has a higher melting temperature than a second flanking region (eg., CGTCGTT in 3’ end wherein the melting temperature of AGGCTGGATTTTTT
ATTTACCTTTTTTTAGGTAAACGACGGCCAGCCT in 5’ end of the triple-stem probe in Table 2 is higher than CGTCGTT in 3’ end of the triple-stem probe), a region (eg., TTTTTTTTTTTT) comprising one or more short tandem repeats sequence (eg., 3 “TTTT”), which anneals with a short tandem repeat region (eg., “TTTTTTTTTTTT” has abilities to anneal to three “AAAA”) of interest within a sample and which contains at least one fluorophore (eg., Cal Fluor 610), and the second flanking region comprising at least 2 nucleotides, wherein the second flanking region contains at least one nucleotide and at least one quencher moiety (eg., BHQ-2) capable of efficiently quenching the fluorophore, wherein the fluorophore and the quencher moiety are separated from each other by at least one nucleotide as recited in claim 1 wherein the quencher moiety is attached to the 3’ or 5’ terminus of each of the oligonucleotide probes as recited in claim 2, the quencher is an Iowa Black® FQ quencher as recited in claim 5, the nucleotides of the oligonucleotide probes are nucleic acid analogues as recited in claims 7, 19, and 23, each of the oligonucleotide probes is immobilized on a support as recited in claims 8 and 20, and the fluorophore is a fluorescein derivate as recited in claims 17 (see paragraphs [0026] to [0028], [0037], [0038], [0050], [0051], and [0103], and Tables 1 and 2).
Soh et al., do not disclose that the second flanking region contains at least one ribonucleotide such that the fluorophore and the quencher moiety of the new triple-stem probes are separated from each other by at least one ribonucleotide and a composition comprises an RNase H2 enzyme capable of digesting the oligonucleotide probe by recognition of an RNA:DNA duplex upon hybridization of the oligonucleotide probe with the sample as recited in claim 1 wherein each of the oligonucleotide probes contains more than one ribonucleotide as recited in claims 6 and 18 and the at least one ribonucleotide is positioned in the second flanking region such that cleavage by the RNase H2 enzyme occurs at the ribonucleotide and thereby separates the fluorophore in the repeat region from the quencher moiety in the second flanking region as recited in claim 24.
Dattagupta teaches that one or more ribonucleotides exist in either 5’ or 3’ stem region of a hairpin probe (see column 12, third paragraph and column 33, second paragraph).
Johnson et al., teach that RNase H2 recognizes and cleaves ribonucleotides in an annealed RNA/DNA hybrid (see Figure 1A and paragraph [0153]).
Therefore, it would have been prima facie obvious to one having ordinary skill in the art at the time the invention was made to have made the composition recited in claims 1, 6, 18, and 24 by synthesizing new triple-stem probes based on replacing more than one deoxynucleotides located on the second flanking region of each of the triple-stem probes taught by Soh et al., with ribonucleotides such that the fluorophore and the quencher moiety of the new triple-stem probes are separated from each other by more than one ribonucleotide and adding an RNase H2 to the composition taught by Soh et al., in view of the prior arts of Soh et al., Dattagupta, and Johnson et al.. One having ordinary skill in the art would have been motivated to do so because Dattagupta teaches that one or more ribonucleotides exist in either 5’ or 3’ stem region of a hairpin probe (see column 12, third paragraph and column 33, second paragraph) and Johnson et al., teach that RNase H2 recognizes and cleaves ribonucleotides in an annealed RNA/DNA hybrid (see Figure 1A and paragraph [0153]). One having ordinary skill in the art at the time the invention was made would have a reasonable expectation of success to make the composition recited in claims 1, 6, 18, and 24 by synthesizing new triple-stem probes based on replacing more than one deoxynucleotides located on the second flanking region (ie., more than one nucleotide from CGTCGTT in 3’ end) of each of the triple-stem probes taught by Soh et al., with ribonucleotides such that the fluorophore and the quencher moiety of the new triple-stem probes are separated from each other by more than one ribonucleotide, and adding an RNase H2 to the composition taught by Soh et al., in view of the prior arts of Soh et al., Dattagupta, and Johnson et al., in order to cleave the ribonucleotide positioned in the second flanking region of an RNA:DNA duplex formed by hybridization of the new triple-stem probes with a short tandem repeat region of interest within a sample using an RNase H2 and separate the fluorophore in the repeat region from the quencher moiety in the second flanking region of the RNA:DNA duplex.
Response to Arguments
I. In page 6, sixth paragraph bridging to page 7, last paragraph of applicant’s remarks, applicant argues that “the Office Action does not identify where Soh teaches that this poly-T sequence functions as a target-binding region for hybridization to a short tandem repeat region in a sample, as required by claim 1. On the contrary, as acknowledged in Soh and reflected in the Office's own citations, Soh distinguishes between: • a ‘target binding sequence’, which hybridizes to the sample (Soh, ¶¶[0012]-[0013]), and • other sequences that participate in intramolecular hybridization to form the triple-stem structure (Soh, ¶¶[0032], and [0037]-[0038]). The poly-T sequence identified by the Office is not disclosed in Soh as the target-binding sequence. Rather, as reflected in Applicant's prior response and since the Office Action does not identify any disclosure in Soh to the contrary, such sequences function as spacer or loop regions supporting intramolecular folding of the probe, not as regions that hybridize to a target strand in a sample (Id.) Accordingly, the Office Action relies on an unsupported reassignment of function, treating a structural element disclosed for intramolecular folding as a target-binding region for hybridization to an STR locus”, “[T]he Office Action does not identify any disclosure in Soh that teaches or suggests this reassignment. Because the rejection does not establish that Soh teaches or suggests a region that: 1. comprises one or more short tandem repeats, 2. anneals with a short tandem repeat region in a sample, and 3. contains a fluorophore as part of that target-binding region, the rejection fails to establish that Soh teaches a critical limitation of claim 1”, and “[A]bsent such a teaching in the base reference, the combination with Dattagupta and Johnson cannot remedy this deficiency”.
The above arguments have been fully considered but they are not persuasive toward the withdrawal of the rejection. Since a region (eg., TTTTTTTTTTTT) of triple-stem probe taught by Soh et al., comprises one or more short tandem repeats sequence (eg., 3 “TTTT”) which can anneal with a short tandem repeat region of interest (eg., “TTTTTTTTTTTT” has abilities to anneal to three “AAAA”) within a sample and Soh et al., teach that the position of the fluorophore and the position of the quencher of the fluorophore in triple-stem probes are exchangeable (see paragraph [0051] and Figure 1), Soh et al., disclose “a region that: 1. comprises one or more short tandem repeats, 2. anneals with a short tandem repeat region in a sample, and 3. contains a fluorophore as part of that target-binding region” as argued by applicant. Furthermore, applicant has no evidence to show that a region (eg., TTTTTTTTTTTT) of triple-stem probe taught by Soh et al., cannot function as a target-binding sequence to anneal a short repeat region of interest within a sample.
II. In page 8, first to fourth paragraph of applicant’s remarks, applicant argues that “[A]mended claim 1 now expressly requires: • ‘a repeat region comprising one or more short tandem repeats,’ and • an array in which ‘for each allele of an investigated short tandem repeat locus, a dedicated oligonucleotide probe is provided.’ The Office Action does not identify where Soh teaches: • a repeat region composed of short tandem repeats used for hybridization to a corresponding STR locus, or • an array configured for allele-by-allele discrimination at an STR locus. Soh is directed to discrimination of perfectly matched versus mismatched sequences (e.g.,
SNP detection), not to distinguishing between alleles of a multi-allelic STR locus (Soh, ¶¶[0003], [0012], and [0017]). The Office Action does not identify any disclosure in Soh that would support the claimed allele-specific STR probe array. Accordingly, the amendment further underscores that the Office's mapping of Soh does not satisfy the claimed limitations”.
The above arguments have been fully considered but they are not persuasive toward the withdrawal of the rejection. Since Soh et al., teach that “in certain embodiments, the triple-stem probes disclosed herein may be immobilized on a substrate, such that the probes form an addressable array of probes. The triple-stem probes that comprise the addressable array may be identical, or in other embodiments, a plurality of different triple-stem probes (i.e., probes with different target binding sequences) may comprise the addressable array”, Soh et al., disclose an array comprising a plurality of identical or different triple-stem probes. Since a region (eg., TTTTTTTTTTTT) of triple-stem probe taught by Soh et al., can form a perfectly matched hybrid and a mismatched hybrid with different short tandem repeats of interest, a region (eg., TTTTTTTTTTTT) of triple-stem probe taught by Soh et al., has an ability to hybridize alleles comprising different short tandem repeats of interest. Furthermore, claims do not require allele-specific STR probe array as argued by applicant. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
III. In page 8, fifth paragraph bridging to page 9, second paragraph of applicant’s remarks, applicant argues that “[E]ven assuming arguendo that Soh could be modified, the Office Action does not provide a teaching or suggestion to modify Soh in a manner that would result in the claimed structure. The Office relies on: • Dattagupta for the presence of ribonucleotides, and
• Johnson for RNase H2 cleavage. (Final Office Action, pp. 4-5). However, the Office does not identify any teaching suggesting: • modifying Soh such that a region originally used for intramolecular folding is instead configured as a target-binding repeat region comprising STRs, or • configuring Soh as an array of allele-specific probes for STR genotyping, or
• placing a ribonucleotide within a specific flanking region such that cleavage separates a fluorophore located in the repeat region from a quencher located in the second flanking region.
The cited references address distinct probe architectures and mechanisms: • Soh: conformational self-quenching/de-quenching probe (Soh, ¶¶[0008], [0051], [0053], and [0057]). • Dattagupta: ribonucleotides in hairpin constructs. • Johnson: RNase H2 cleavage in primer contexts.
While KSR permits flexibility in combining references, it still requires ‘an apparent reason to combine the known elements in the fashion claimed.’ KSR, 550 U.S. at 418. The Office Action does not identify any teaching or suggestion that would lead a person of ordinary skill in the art to combine these teachings in the specific manner required by claim 1”.
The above arguments have been fully considered but they are not persuasive toward the withdrawal of the rejection. Since Dattagupta teaches that one or more ribonucleotides exist in either 5’ or 3’ stem region of a hairpin probe (see column 12, third paragraph and column 33, second paragraph) and Johnson et al., teach that RNase H2 recognizes and cleaves ribonucleotides in an annealed RNA/DNA hybrid (see Figure 1A and paragraph [0153]), one having ordinary skill in the art at the time the invention was made would have a reasonable expectation of success to make the composition recited in claims 1, 6, 18, and 24 by “obvious to try” synthesizing new triple-stem probes based on replacing more than one deoxynucleotides located on the second flanking region (ie., more than one nucleotide from CGTCGTT in 3’ end) of each of the triple-stem probes taught by Soh et al., with ribonucleotides such that the fluorophore and the quencher moiety of the new triple-stem probes are separated from each other by more than one ribonucleotide, and adding an RNase H2 to the composition taught by Soh et al., in view of the prior arts of Soh et al., Dattagupta, and Johnson et al., in order to cleave the ribonucleotide positioned in the second flanking region of an RNA:DNA duplex formed by hybridization of the new triple-stem probes with a short tandem repeat region of interest within a sample using an RNase H2 and separate the fluorophore in the repeat region from the quencher moiety in the second flanking region of the RNA:DNA duplex. Note that MPEP § 2145 (x) clearly states that “[A]n ‘obvious to try’ rationale may support a conclusion that a claim would have been obvious where one skilled in the art is choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success. ‘[A] person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under § 103.’ KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 421, 82 USPQ2d 1385, 1397 (2007)”. Furthermore, applicant has no evidence to show why one having ordinary skill in the art at the time the invention was made would not have a reasonable expectation of success to make the composition recited in claims 1, 6, 18, and 24 by synthesizing new triple-stem probes based on replacing more than one deoxynucleotides located on the second flanking region (ie., more than one nucleotide from CGTCGTT in 3’ end) of each of the triple-stem probes taught by Soh et al., with ribonucleotides such that the fluorophore and the quencher moiety of the new triple-stem probes are separated from each other by more than one ribonucleotide, and adding an RNase H2 to the composition taught by Soh et al., in view of the prior arts of Soh et al., Dattagupta, and Johnson et al..
IV. In page 9, third paragraph bridging to page 10, third paragraph of applicant’s remarks, applicant argues that “[S]oh relies on a self-complementary triple-stem structure in which signal generation occurs through conformational separation of a fluorophore and quencher upon target binding (Soh, ¶¶[0008], [0051], [0053], and [0057]). In contrast, claim 1 requires a probe that generates signal via RNase H2-mediated cleavage at a ribonucleotide within the probe after hybridization to a target. The Office Action proposes modifying Soh by introducing ribonucleotides and RNase H2 to enable cleavage (Final Office Action, pp. 5-6). However, the Office does not explain how or why a person of ordinary skill in the art would: • replace Soh’s conformational signaling mechanism with an enzyme-mediated cleavage mechanism, or • modify the probe architecture such that cleavage occurs in a specific flanking region while the fluorophore resides in a repeat region that hybridizes to an STR locus. Such modifications would fundamentally alter the way Soh’s probe operates. The Office Action does not provide a rationale grounded in the cited references for making such changes. In conclusion, the Office Action does not establish that the cited references, alone or in combination, teach or suggest all elements of claim 1. In particular, the rejection does not demonstrate that Soh teaches or suggests: • a repeat region comprising short tandem repeats that hybridizes to an STR locus, or • the claimed probe architecture and functional arrangement. Accordingly, the rejection of independent claim 1 is respectfully traversed. Dependent claims 2, 5-8, 17-20, and 23 are allowable at least for the same reasons”.
The above arguments have been fully considered but they are not persuasive toward the withdrawal of the rejection. Although applicant argues that “the Office does not explain how or why a person of ordinary skill in the art would: • replace Soh’s conformational signaling mechanism with an enzyme-mediated cleavage mechanism, or • modify the probe architecture such that cleavage occurs in a specific flanking region while the fluorophore resides in a repeat region that hybridizes to an STR locus. Such modifications would fundamentally alter the way Soh's probe operates”, the rejection is not dependent on “replace Soh’s conformational signaling mechanism with an enzyme-mediated cleavage mechanism” as argued by applicant and is based on that “one having ordinary skill in the art at the time the invention was made would have a reasonable expectation of success to make the composition recited in claims 1, 6, 18, and 24 by synthesizing new triple-stem probes based on replacing more than one deoxynucleotides located on the second flanking region (ie., more than one nucleotide from CGTCGTT in 3’ end) of each of the triple-stem probes taught by Soh et al., with ribonucleotides such that the fluorophore and the quencher moiety of the new triple-stem probes are separated from each other by more than one ribonucleotide, and adding an RNase H2 to the composition taught by Soh et al., in view of the prior arts of Soh et al., Dattagupta, and Johnson et al..” (see above rejection). Furthermore, applicant has no evidence to show why one having ordinary skill in the art at the time the invention was made would not have a reasonable expectation of success to replace more than one deoxynucleotides located on the second flanking region (ie., more than one nucleotide from CGTCGTT in 3’ end) of each of the triple-stem probes taught by Soh et al., with ribonucleotides and why replacing more than one deoxynucleotides located on the second flanking region (ie., more than one nucleotide from CGTCGTT in 3’ end) of each of the triple-stem probes taught by Soh et al., with ribonucleotides “would fundamentally alter the way Soh’s prober operates” such that a repeat region comprising one or more short tandem repeats of each of the triple-stem probes taught by Soh et al., cannot anneal with a short tandem repeat region of interest within a sample.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Frank Lu, Ph. D., whose telephone number is (571)272-0746. The examiner can normally be reached Monday to Friday, 9 AM to 5 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/ interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow, Ph.D., can be reached at 571-272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/FRANK W LU/
Primary Examiner, Art Unit 1683
September 29, 2026
