DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
2. This action is in response to the papers filed February 26, 2026. Applicant’s remarks and amendments have been fully and carefully considered but are not found to be sufficient to put the application in condition for allowance. Any new grounds of rejection presented in this Office Action are necessitated by Applicant's amendments. Any rejections or objections not reiterated herein have been withdrawn. This action is made FINAL.
It is noted that in response to the Election of Species Requirement, Applicant’s elected without traverse (i) SEQ ID NOs: 20-33 and (ii) SEQ ID NOs: 1-10 in the reply filed on October 16, 2025. However Applicants have amended the claims such that they now require SEQ ID NOs: 1-9, 11, 13 and 20-33. Accordingly SEQ ID NOs: 11 and 13 have been rejoined with the elected SEQ ID NOs:.
Claims 1-9 are currently pending.
Claims 3-4 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected subject matter (nonelected species), there being no allowable generic or linking claim. Election was made without traverse in the reply filed on October 16, 2025.
Claim Rejections - 35 USC § 101
3. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 2, 5, and 6-9 are rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exception without significantly more. The claims recite a judicial exception that is not integrated into a practical application. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception. The claim analysis is set forth below.
Step 1: The claims are directed to the statutory category of a process.
Step 2A, prong one: Evaluate Whether the Claim Recites a Judicial Exception
The instant claims recite abstract ideas.
Claim 1 recites the following limitations:
-performing sequence analysis and data analysis to compute, for each biomarker, a normalized read count using CoffNC ABS (TPR-(1-FPR));
- classifying the IVF process as successful
-classifying the embryo as high quality
- selecting the embryo classified as high-quality under
-deferring embryo transfer and initiating clinical follow-up scheduling
Claim 6 recites the following limitations:
-selecting an embryo for transfer in an IVF procedure
- compute normalized read counts
-classifying the embryo as high-quality
Under the broadest reasonable interpretation, performing sequence analysis and data analysis to compute normalized reads counts, falls within the mathematical concepts grouping of abstract ideas. Computation is the action of performing a mathematical calculation.
The “classifying” and “selecting” steps broadly encompasses evaluations that are practically performed in the human mind. For example one could classify the IVF process or embryo quality by thinking about the read counts.
The “deferring embryo transfer and initiating clinical follow-up scheduling” step also broadly encompasses a mental activity. For example this could be done by verbally telling the patient that embryo transfer will not happen and by asking them to schedule a future appointment.
Claim 8 recites that the classifications are produced by a classifier selected from logistic regression with L2 regularization, Random Forest, SVM with rbf kernel, or stochastic gradient descent logistic regression. These classifiers are clearly mathematical concepts which are abstract ideas.
Claim 9 states that the NGS analysis pipeline of step (b) comprises processing reads generated on an Illumina platform with adapter/quality trimming, alignment to a miRNA/isomiR reference including SEQ ID NOs: 1-11 and 20-33, per-biomarker read tally, and CoffNC ABS normalization, followed by exporting normalized read counts for the trained classifier of claim 8. Generating read counts is synonymous with counting reads, which is also a mathematical operation and an abstract idea.
The instant claims recite laws of nature.
The claims recite a correlation between SEQ ID NOs: 1-9, 11, and 13 and the successfulness of IVF. Additionally the claims recite a correlation between SEQ ID NOs: 20-33 and embryo quality. These types of correlations are a consequence of natural processes, similar to the naturally occurring correlation found to be a law of nature by the Supreme Court in Mayo.
Step 2A, prong two: Evaluate Whether the Judicial Exception Is Integrated Into a Practical Application
The claims do NOT recite additional steps or elements that integrate the recited judicial exceptions into a practical application of the exception(s). For example, the claims do not practically apply the judicial exception by including one or more additional elements that the courts have stated integrate the exception into a practical application:
An additional element reflects an improvement in the functioning of a computer, or an improvement to other technology or technical field;
An additional element that applies or uses a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition;
An additional element implements a judicial exception with, or uses a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim;
An additional element effects a transformation or reduction of a particular article to a different state or thing; and
An additional element applies or uses the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological
environment, such that the claim as a whole is more than a drafting effort designed to monopolize the exception.
Claim 1 recites “(i) selecting the embryo classified as high-quality under step (d) and performing embryo transfer within the patient's clinically determined window of implantation when (c) indicates successful IVF classification and (d) classifies the embryo as high-quality; or (ii) deferring embryo transfer and initiating clinical follow-up scheduling when (c) indicates unsuccessful IVF classification or (d) classifies the embryo as low-quality”. It is noted that a claim limitation can integrate a judicial exception by applying or using the judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition. Here the treatment is “performing embryo transfer”. However this step is conditional and only occurs when (c) indicates successful IVF classification and (d) classifies the embryo as high-quality. The claim broadly encompasses situations where (c) indicates unsuccessful IVF classification or (d) classifies the embryo as low-quality and “performing embryo transfer” does not occur. Since “performing embryo transfer” is not a required step, claim 1 does not recite any steps or elements that integrate the judicial exception so as to practically apply the judicial exception.
Claim 6 recites “(c) classifying the embryo as high-quality when normalized read counts for each biomarker in the panel are> 1 and as low-quality when normalized read counts are < 1;(d) transferring to the patient the embryo classified as high-quality”. It is noted that a claim limitation can integrate a judicial exception by applying or using the judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition. Here the treatment is “performing embryo transfer”. However this step is conditional and only occurs when the embryo is high-quality. The claim broadly encompasses situations where the embryo is low-quality and “performing embryo transfer” does not occur. Since “performing embryo transfer” is not a required step, claim 6 does not recite any steps or elements that integrate the judicial exception so as to practically apply the judicial exception.
In addition to the judicial exceptions, the claims require taking a biological sample, isolating miRNA and/or iso-miRNA, and sequencing. These steps do NOT integrate the judicial exception into a practical application because they merely add insignificant extra-solution activity (data gathering) to the judicial exception.
Step 2B: Evaluate Whether the Claim Provides an Inventive Concept
In addition to the judicial exceptions, the claims require taking a biological sample, isolating miRNA and/or iso-miRNA, and sequencing. These steps do not amount to significantly more because they simply append well understood, routine, and conventional activities previously known in the art, specified at a high level of generality, to the judicial exceptions.
The steps are recited at a high level of generality. Obtaining a sample and isolating nucleic acids from the sample for analysis is well understood, routine, and conventional activity for those in the field of diagnostics. The step of performing sequencing merely instructs a scientist to use any sequencing technique. When recited at this high level of generality, there is no meaningful limitation that distinguishes this step from well understood, routine, and conventional activities engaged in by scientists prior to applicants invention and at the time the application was filed.
The prior art also demonstrates the well understood, routine, conventional nature of additional elements because it teaches that the additional elements are well known or commercially available.
For example Timofeeva (International Journal of Molecular Sciences 2019, 20, 2912) discloses analysis of sncRNA in spent culture media on day 4 after fertilization by next generation sequencing (abstract). Timofeeva teaches that spent blastocyte culture media was obtained on day 4 and RNA was isolated using the miRNeasy Serum/Plasma kit. Then the RNA was sequenced using the NextSeq 500 platform (pages 18-20).
Additionally Ge (Molecular Medicine Reports 12: 3323-3330 2015) discloses analysis of miRNA in maternal plasma samples by next generation sequencing (abstract). Ge teaches obtaining plasma, isolating miRNA using the miVana miRNA isolation kit, and sequencing the miRNA (page 3324).
Further it is noted that the courts have recognized the following laboratory techniques as well-understood, routine, conventional activity in the life science arts when they are claimed in a merely generic manner (e.g., at a high level of generality) or as insignificant extra-solution activity.
Determining the level of a biomarker in blood by any means, Mayo, 566 U.S. at 79, 101 USPQ2d at 1968; Cleveland Clinic Foundation v. True Health Diagnostics, LLC, 859 F.3d 1352, 1362, 123 USPQ2d 1081, 1088 (Fed. Cir. 2017);
Using polymerase chain reaction to amplify and detect DNA, Genetic Techs. v. Merial LLC, 818 F.3d 1369, 1376, 118 USPQ2d 1541, 1546 (Fed. Cir. 2016); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d 1371, 1377, 115 USPQ2d 1152, 1157 (Fed. Cir. 2015);
Detecting DNA or enzymes in a sample, Sequenom, 788 F.3d at 1377-78, 115 USPQ2d at 1157); Cleveland Clinic Foundation 859 F.3d at 1362, 123 USPQ2d at 1088 (Fed. Cir. 2017);
Immunizing a patient against a disease, Classen Immunotherapies, Inc. v. Biogen IDEC, 659 F.3d 1057, 1063, 100 USPQ2d 1492, 1497 (Fed. Cir. 2011);
Analyzing DNA to provide sequence information or detect allelic variants, Genetic Techs., 818 F.3d at 1377; 118 USPQ2d at 1546;
Freezing and thawing cells, Rapid Litig. Mgmt. 827 F.3d at 1051, 119 USPQ2d at 1375;
Amplifying and sequencing nucleic acid sequences, University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 764, 113 USPQ2d 1241, 1247 (Fed. Cir. 2014)
For the reasons set forth above the claims are not directed to patent eligible subject matter.
Response To Arguments
4. In the response the Applicants traversed the rejection under 35 USC 101. Regarding
Step 2A, Prong One, Applicant asserts that as amended, the claims now integrate such relationship into a practical application and therefore are not directed to a judicial exception.
The amendments have been fully considered. Under Step 2A, prong one we determine whether the claims recites a judicial exception. As set forth above the claims encompass abstract ideas, including mental process steps and mathematical concepts. Additionally the set forth a law of nature. Thus the claims recite numerous judicial exceptions.
Regarding Step 2A, Prong Two the Applicants argue that as amended, the claims now expressly require specific clinical actions that improve IVF outcomes by controlling embryo selection and transfer timing based on the computed classifications. Applicant asserts that this is a concrete application that changes what clinicians do (transfer vs deferral), rather than merely providing diagnostic information. Amended claim 1 therefore applies the measured iso-miRNA information to affect a particular clinical intervention in the IVF process.
The amendments have been fully considered. It is noted that a claim limitation can integrate a judicial exception by applying or using the judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition. Here the treatment is “performing embryo transfer”. However this step is conditional and only occurs when certain conditions are met. The claim broadly encompasses situations where those conditions are not met and “performing embryo transfer” does not occur. Since “performing embryo transfer” is not a required step, the claims do not recite any steps or elements that integrate the judicial exception so as to practically apply the judicial exception.
Applicants argue that as amended claim 1 now states: (a) defined sample types, (b) defined collection times (embryo transfer day; day 4-6 culture), (c) predefined biomarker panels by SEQ ID NO, (d) a defined normalization metric (CoffNC ABS), (e) explicit threshold rules, and (f) a 24-hour completion requirement. These limitations collectively recite a particular, practical protocol rather than a generalized attempt to monopolize a correlation.
This argument has been fully considered but is not persuasive because preemption is not a standalone test for eligibility. While a preemptive claim may be ineligible, the absence of complete preemption does not demonstrate that a claim is eligible.
The Applicants argue that the amended claims require laboratory and computational operations, including sample acquisition, nucleic acid isolation, sequencing, and calculation of normalized read counts-that go beyond any mental evaluation of reported results.
This amendments have been fully considered. The claims still encompass mental activities. For example the “classifying” and “selecting” steps broadly encompasses evaluations that are practically performed in the human mind. For example one could classify the IVF process or embryo quality by thinking about the read counts. Additionally “deferring embryo transfer and initiating clinical follow-up scheduling” step also broadly encompasses a mental activity. For example this could be done by verbally telling the patient that embryo transfer will not happen and by asking them to schedule a future appointment.
Further the Applicants argue that the claims recite limitations that do more than append routine data gathering to any alleged exception because the computed classifications control whether embryo transfer is performed or deferred within 24 hours of sample collection.
This argument has been fully considered but is not persuasive. The computer classification are judicial exceptions and cannot be relied upon to show that the claims recite more than a judicial exception. Further deferring embryo transfer is also a judicial exception. The rejections are maintained.
Claim Rejections - 35 USC § 112(b)
5. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 2, 5-9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 2, 5, 8-9 are rejected over the recitation of “the embryo transfer day” in claim 1 step (a). There is insufficient antecedent basis for this limitation in the claim.
Claim 2 is rejected over the recitation of “the predefined plasma iso-miRNA biomarker panel”. There is insufficient antecedent basis for this limitation in the claim because while the claims previously recite “a plasma panel” they do not recite “a predefined plasma iso-miRNA biomarker panel”.
Claim 5 is rejected over the recitation of “the enumerated plasma biomarkers”. There is insufficient antecedent basis for this limitation in the claim.
Regarding Claims 6-7 it is not clear how the recited preamble is intended to breathe life and meaning into the claim. The preamble of the claim recites a method of selecting an embryo for transfer in an IVF procedure, yet the method only requires steps of obtaining, isolating, classifying, and transferring. Thus it is not clear if applicant intends to cover only a method of obtaining, isolating, classifying, and transferring OR if the method is intended to somehow require more to accomplish the goal set forth in the preamble. If it is the later, then it appears that the claims are incomplete, as they fail to provide any active steps that clearly accomplish the goal set forth by the preamble of the claims.
Claims 6 and 7 are rejected over the recitation of the phrase “obtaining from a patient, on day 4-6 of embryo culture, a spent blastocyst culture medium sample from an embryo”. This recitation is non-sensical because a culture medium sample cannot be obtained from a patient. Rather it would be obtained from culture dish.
Claim 9 is rejected over the recitation of “the NGS analysis pipeline”. There is insufficient antecedent basis for this limitation in the claim because while the claims previously recite “performing sequencing analysis” they do not recite “a NGS analysis pipeline”. Further it is noted that NGS is a specific type of sequencing and the recitation of sequencing in claim 1 broadly encompasses any type of sequencing-it is not limited to NGS methods.
Claim Rejections - 35 USC § 112(d)
6. The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 2 and 5 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 2 recites that a biomarker panel comprises SEQ ID NOs: 1-9 and 11. However claim 1 already recites a biomarker panel with these SEQ ID NOs. Therefore claim 2 fails to further limit the method of Claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim 5 recites that normalized read counts> 1 across the enumerated plasma biomarkers indicate a successful IVF classification and normalized read counts> 5 specifically for iso-hsa-let-7b-5p having sequence TGAGGTAGTATGTTGTGTGG (SEQ ID NO: 13) indicate a successful IVF classification, and embryo transfer is performed or deferred under step (e) based on said classification.. However claim 1 already recites these limitations and as a result claim 5 fails to further limit the method of claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
7. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA HANEY whose telephone number is (571)272-8668. The examiner can normally be reached Monday-Friday, 8:15am-4:45pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached at 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA HANEY/Primary Examiner, Art Unit 1682