Prosecution Insights
Last updated: July 17, 2026
Application No. 17/908,458

GENE VECTOR CONTROL BY CARDIOMYOCYTE-EXPRESSED MICRORNAS

Non-Final OA §103
Filed
Aug 31, 2022
Priority
Mar 02, 2020 — provisional 62/984,183 +1 more
Examiner
GU, QINHUA
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Tenaya Therapeutics Inc.
OA Round
2 (Non-Final)
76%
Grant Probability
Favorable
2-3
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 76% — above average
76%
Career Allowance Rate
55 granted / 72 resolved
+16.4% vs TC avg
Strong +30% interview lift
Without
With
+30.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
33 currently pending
Career history
115
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
75.3%
+35.3% vs TC avg
§102
3.0%
-37.0% vs TC avg
§112
8.5%
-31.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 72 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Applicant’s submission filed 12/05/2025 has been received and entered. Claims 1-3 and 22-25 have been amended. Claims 18-21 and 29 have been cancelled. Claims 47 and 50-52 remain withdrawn as being directed to non-elected invention. Accordingly, claims 1-17 and 22-28 are pending and under current examination. This is a second non-final office action. The Examiner has reconsidered the pending claims. Status of Prior Rejection/Response to Arguments The objection to Abstract is withdrawn: The objection to the abstract of the disclosure have been withdrawn due to applicant’s amendment the abstract and submitted as a single paragraph on a separate sheet as required. The objection to claim 19 is withdrawn: The cancellation of claim 19 renders the objection thereto moot. The objection is withdrawn. The rejection to claims 1-12, 14-20, 23, 25 and 27-28 under 35 U.S.C. 103 is withdrawn: The cancellation of claim 18-20 renders the rejection and objection thereto moot. Regarding claims 1-12, 14-17, 23, 25 and 27-28, Applicant’s amendment to claim 1 incorporates two specific genes MYOCD and ASCL1 in the vector. The prior arts Geisler et al., Malizia et al., Yoshida et al., Wang et al. and Chen et al. do not teach or suggest the vector comprising MYOCD and ASCL1 gene and a microRNA binding site for a microRNA, therefore the amendment overcomes the obviousness rejection, the rejection is withdrawn. The objection to claims 13, 21, 22, 24 and 26 (Allowable Subject Matter) is withdrawn: In the Office action mailed 09/05/2025, the Examiner indicated that claims 13, 21, 22, 24 and 26 are directed to allowable subject matter. However, an updated search discovered a prior art Olson et al. (WO 2019/036086 A1) reads on the limitation of claim 21. The indication of the allowable subject matter is withdrawn. Applicant’s current amendment to independent claim 1 incorporates the limitation of previous claim 21, since Olson et al. (WO 2019/036086 A1) reads on said limitation, the claims 1-17 and 22-28 are re-considered, new grounds of rejection are set forth below. New Grounds of Rejection Election/Restrictions & Rejoinder The new cited prior art Olson et al. (WO 2019/036086 A1) teaches the use of reprogramming factors including AKTI, GATA4, TBX5, MEF2C, HAND2 and either ZNF28l or ASCL1 to reprogram adult non- cardiomyocytes, such as cardiac fibroblasts into cardiomyocytes, both in vitro and in vivo (Abstract). Olson et al. teach a method of reprograming a cardiac fibroblast comprising contacting said cardiac fibroblast with myocardin (p81, claim 5). Olson et al. also teach a method preventing or delaying development of cardiac hypertrophy or heart failure in a subject having suffered a myocardial infarct (MI) comprising providing to said subject AKTl, GATA4, TBX5, MEF2C, HAND2 and ASCL1 (p90, claim 101) and myocardin (MYOCD, p90, claim 108). Since Olson et al. teach the limitation of instant claims 47, 50 and 51, the restriction requirement set forth on 04/30/2025 is partially withdrawn, and Group II, claims 47, 50 and 51 have been rejoined and fully examined for patentability under 37 CFR 1.104. In view of the withdrawal of the restriction requirement, applicant(s) are advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application. Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-9, 14-17, 27-28, 47, 50 and 51 are newly rejected under 35 U.S.C. 103 as being unpatentable over Geisler et al. (WO World J Exp Med, 2016 May 20; 6(2): 37-54) in view of Malizia et al. (Wiley Interdiscip Rev Syst Biol Med. 2011 ; 3(2): 183–190) and Olson et al. (WO 2019/036086 A1, published 02/21/2019, cited in IDS), as evidenced by of Kakimoto et al. (International Journal of Cardiology 211 (2016) 43–48). Geisler et al. review microRNA-dependent posttranscriptional suppression of transgene expression, highlights new developments in this field and gives an overview of applications of microRNA-regulated viral vectors for cardiac, suicide gene cancer and hematopoietic stem cell therapy, as well as for treatment of neurological and eye diseases (see Abstract). Regarding claim 1, Geisler et al. teach endogenously expressed microRNAs can also be used to specifically modulate the expression of an exogenously applied nucleic acid as a therapeutic cDNA. Therefore artificial microRNA target sites, referred to as miR-TS in this review, serve as targets for a specific microRNA, resulting in post-transcriptional silencing of the transcript. In contrast to transcriptional targeting using tissue-specific promoters that positively regulate transgene expression, expression is negatively controlled by tissue-specifically expressed microRNAs. It was shown that insertion of miR-TS completely complementary to the microRNA in an arrangement of multiple tandem repeats of miR-TS results in strong repression of transgene expression in cells with corresponding microRNA expression (p39, left column). Herein the microRNA target sites (miR-TS) read on “a microRNA binding site for a microRNA” in instant claim. Figure 1 shows principle of microRNA-mediated suppression of transgene expression and viral replication (see p47). A vector DNA/viral DNA is transcribed in the nucleus (for lentiviral vectors integrated into host DNA). The transcript/viral RNA containing artificial miR-TS (red boxes) is transported into the cytoplasm. If corresponding microRNA is expressed (figure 1A), it binds to miR-TS and the target RNA is endonucleolytically cleaved and degraded. If certain microRNAs are not expressed (figure 1B), the RNA is translated into protein. Herein the vector comprises transgene/mRNA and microRNA target/binding sites for a microRNA are operatively linked for translation to protein (see e.g., figure 1B). This teaching reads on “a vector, comprising a polynucleotide comprising a polynucleotide sequence encoding (transgenes) and a microRNA binding site for a microRNA, wherein the microRNA binding site is operatively linked to the polynucleotide sequence encoding the (transgenes)” in the instant claim. Geisler et al. further teach application of microRNA-regulated vectors for gene therapy (p42, Table 1), specific miRNAs are used for target cell/tissue for therapy and de-targeted cell/tissue to reduced off‑target expression. As discussed above, the principle is when the transgene/mRNA containing artificial miR-TS is transfected to a cell, if corresponding microRNA is expressed in the cell, it binds to miR-TS and the transgene/target RNA is endonucleolytically cleaved and degraded. If certain microRNAs are not expressed in the cell, the transgene/mRNA can be translated into protein (see figure 1, p47). Therefore the miRNAs should have no/lower expression in the target cells and have higher expression in the cells which are not targeted. For instance, Geisler et al. teach constructing AAV9 vectors with miR-TS completely complementary to hepatocyte specific miR-122 and muscle-specific miR-1 in order to repress reporter gene expression in liver, heart and the skeletal muscle (p46, left column). Geisler et al. also teach microRNA-mediated regulation of transgene expression can help to improve direct cell conversion as shown for conversion of human fibroblasts into functional neurons (human induced neurons) by a self-regulating vector. Insertion of miR-TS for the neuron specific miR-124 linked to the neural reprogramming genes Ascl1, Brn2 and Myt1L of an integration deficient LV facilitated a down-regulation of conversion gene expression once the cell has reached a stable neuronal fate, thereby allowing for a more complete functional maturation of the cells in culture (see p47, right column). Geisler et al. do not specifically teach: 1) the “transgenes” which the microRNA binding site is operatively linked to are myocardin (MYOCD) and achaete- scute family bHLH transcription factor 1 (ASCL1); and 2) “wherein the microRNA is expressed at a higher level in cardiomyocytes or cardiomyocyte progenitors compared to cardiac fibroblasts”. However, following the principle of Geisler et al.’s teaching, the deficiency is cured by the disclosure of Olson et al. and Malizia et al.. Olson et al. teach the use of reprogramming factors including AKTI, GATA4, TBX5, MEF2C, HAND2 and either ZNF28l or ASCLI to reprogram adult non- cardiomyocytes, such as cardiac fibroblasts into cardiomyocytes, both in vitro and in vivo (Abstract). Malizia et al. review miRNAs in cardiomyocyte development. Many miRNAs are expressed in a tissue/organ-specific manner and are associated with an increasing number of cell proliferation, differentiation and tissue development events (see Abstract). Regarding the limitation 1) the “transgenes” which the microRNA binding site is operatively linked to are myocardin (MYOCD) and achaete- scute family bHLH transcription factor 1 (ASCL1), Olson et al. teach ASCL1 enhances cardiac reprogramming of adult fibroblasts (p60, L12). Olson et al. teach Myocardin is a protein that in humans is encoded by the MYOCD gene. Myocardin is a smooth muscle and cardiac muscle-specific transcriptional coactivator of serum response factor. When expressed ectopically in nonmuscle cells, myocardin can induce smooth muscle differentiation by its association with serum response factor (p19, L10-13). Olson et al. also teach a method of reprograming a cardiac fibroblast comprising contacting said cardiac fibroblast with myocardin (p81, claim 5). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgene and artificial miR-TS, and have transgenes MYCOD and ASCL1 in the vector as taught by Olson et al.. The skilled artisan would have been motivated to have transgenes MYCOD and ASCL1 in the vector since Olson et al. teach both ASCL1 and MYOCD enhance reprograming a cardiac fibroblast (see i.e., p60, L12 and p86, claims 61 and 65), operatively link these genes to the binding site of a microRNA which is lack or less expressed in cardiac fibroblast will lead to the expression of the vectors in cardiac fibroblasts, therefore enhance the reprogramming of the cardiac fibroblasts. There would be a reasonable expectation of success of having transgenes MYCOD and ASCL1 in the vector since adding two genes in a vector is a routine operation in the art. Regarding 2) “wherein the microRNA is expressed at a higher level in cardiomyocytes or cardiomyocyte progenitors compared to cardiac fibroblasts”, Malizia et al. teach miR-1, miR-133, miR-206 and miR-208 have been found to be muscle-specific, and thus have been called myomiRs (see Abstract). Malizia et al. teach among these miRs, miR-208 is specifically expressed in cardiomyocytes (p2, parag 1). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgene and artificial miR-TS, and use cardiomyocyte specific miRNAs such as miR-208 for the microRNA-mediated suppression of transgene expression in cardiomyocyte, as taught by Malizia et al. The only difference between instant claim and Geisler et al.’s microRNA-regulated vectors is instant claim requires the microRNA is expressed at a higher level in cardiomyocytes or cardiomyocyte progenitors compared to cardiac fibroblast. Given that Malizia et al. teach myomiRs such as miR-208 is specifically expressed in cardiomyocytes (p2, parag 1), one of ordinary skill in the art would have substituted miRs in microRNA-regulated vectors (e.g., the vectors in Table 1, see p42), and use myomiRs such as miR-208 in order to suppress the transgene expression in cardiomyocytes, when they need to specifically express transgenes in the cardiac fibroblast (e.g., specifically expressing reprogramming genes in cardiac fibroblasts to reprogram these cardiac fibroblasts, which is similar to Geisler et al.’s example stated above, regarding the conversion of human fibroblasts into functional neurons by mir-124 linked neural reprogramming genes). This simple substitution of one known element (myomiRs such as miR-208 for microRNA-regulated vectors) for another known element (miRs in Table 1 of Geisler et al.’s microRNA-regulated vectors) is likely to be obvious when predictable results are achieved. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 — 97 (2007) (see MPEP § 2143, B.). Regarding claims 2, following the discussion above, Malizia et al. teach miR-208 is specifically expressed in cardiomyocytes (p2, parag 1). Following the principle discussed in Geisler et al.’s teaching, the specific expression of miR-208 in cardiomyocytes indicates that the microRNA binding site promotes specific repression of expression of the one or more transgenes in a cardiomyocyte compared to a cardiac fibroblast. Regarding claims 3 and 4, as discussed above, Malizia et al. teach miR-208 is specifically expressed in cardiomyocytes (p2, parag 1), which means miR-208 is necessarily expressed at a lower level in cardiac fibroblasts compared to a level of expression of miR-208 in cardiomyocytes, as recited in instant claims. Regarding claims 5 and 6, following the discussion above, Malizia et al. teach miR-1, miR-133, miR-206 and miR-208 have been found to be muscle-specific (see Abstract), since the cardiac fibroblasts are not muscle cells, this teaching indicates the microRNAs (miR-1, miR-133, miR-206 and miR-208) are expressed at a higher level in cardiomyocytes compared to cardiac fibroblasts. Regarding claims 7 and 8, following the discussion above, Malizia et al. teach miR-208 specifically expressed in cardiomyocytes (p2, parag 1), the miR-208 family is constituted of two transcripts, miR-208a and miR-208b (p3, parag 3). Therefore the miR-208a and miR-208b both specifically express in cardiomyocytes. According to the principle of Geisler et al.’s microRNA-regulated vectors, miR-208a and miR-208b both can be used for the microRNA-mediated suppression of transgene expression in cardiomyocyte. Regarding claim 9, Malizia et al. teach miR-208a and miR-208b but not specifically point out miR-208b-3p, which is a specific strand of miR-208b, however, miR-208b-3p is also specifically expressed in cardiomyocyte, as evidenced by Kakimoto et al. that miR-208b-3p is distinctly expressed in left ventricular free wall (LV) (see p45, left column). Therefore this teaching indicates that miR-208b-3p is specifically expressed in cardiomyocyte, and can be used as the miRNA for the microRNA-mediated suppression of transgene expression in cardiomyocyte. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgene and artificial miR-TS, and use cardiomyocyte specific miRNAs such as miR-1, miR-133 and miR-208 (including miR-208a, miR-208b, and specifically miR-208b-3p) for the microRNA-mediated suppression of transgene expression in cardiomyocyte, as taught by Malizia et al.. The only difference between instant claim and Geisler et al.’s microRNA-regulated vectors is instant claim requires the microRNA is expressed at a higher level in cardiomyocytes or cardiomyocyte progenitors compared to cardiac fibroblast, wherein the miRNAs can be miR-1, miR-133 or miR-208 (including miR-208a, miR-208b, and specifically miR-208b-3p). Given that Malizia et al. teach miR-1, miR-133, miR-206 and miR-208 have been found to be muscle-specific, and thus have been called myomiRs, and the cardiac fibroblasts are not muscle cells, one of ordinary skill in the art would have substituted miRs in microRNA-regulated vectors (e.g., the vectors in Table 1, see p42), and use myomiRs such as miR-1, miR-133, miR-206 and miR-208 (including miR-208a, miR-208b, and specifically miR-208b-3p) in order to suppress the transgene expression in cardiomyocyte, when they need to specifically express transgenes in the cardiac fibroblast (e.g., specifically expressing reprogramming genes in cardiac fibroblasts to reprogram these cardiac fibroblasts). This simple substitution of one known element (myomiRs such as miR-1, miR-133 and miR-208 (including miR-208a, miR-208b, and specifically miR-208b-3p) in microRNA-regulated vectors) for another known element (miRs in Table 1 of Geisler et al.’s microRNA-regulated vectors) is likely to be obvious when predictable results are achieved. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 — 97 (2007) (see MPEP § 2143, B.). Regarding claims 14-17, following the discussion above, Geisler et al. teach to control exogenous transgene expression, tandem repeats of artificial microRNA target sites are usually incorporated into the 3’ UTR of the transgene expression cassette (p37, right column). Geisler et al. teach the number of miR-TS repeats affects microRNA-mediated suppression of transgene expression. In general an increased number of miR-TS enhances microRNA-dependent transgene repression. But repression efficacy does not linearly correlate with an increasing number of miR‑TS, and above a certain number of miR-TS, only a relatively modest increase of repression of transgene expression is observed (p40, right column). Geisler et al. also teach 3-4 identical repeats of miR‑TS are sufficient for efficient transgene repression. An increase to 6 or even 12 copies is possible, but may only have a marginal effect on repression efficacy (p41, left column). This teaching reads on “the polynucleotide comprises at least two microRNA binding sites for the microRNA” in claim 14, “the polynucleotide comprises at least four microRNA binding sites for the microRNA” in claim 15, “the polynucleotide comprises at most six microRNA binding sites for the microRNA” in claim 16, as well as “the polynucleotide comprises four microRNA binding sites for the microRNA” in claim 17. Regarding claims 27 and 28, following the discussion above, Geisler et al. teach application of microRNA-regulated vectors for gene therapy (p42, Table 1), the vector can be AAV, lentiviral vectors or adenoviral vectors. This teaching reads on the viral vector in claim 27 and the AAV vector in claim 28. Regarding claims 47, 50 and 51, following the discussion of claim 1, Geisler et al. teach microRNA-mediated suppression of transgene expression and viral replication (figure 1) and vector-based microRNA targeting strategies (figure 2). Malizia et al. teach tissue specific (i.e., cardiomyocyte specific) expression of microRNAs. Olson et al. teach MYCOD and ASCL1 are reprogramming factors to reprogram cardiac fibroblasts to cardiomyocytes (see Abstract, p19, L10-13 and p81, claim 5). Olson et al. teach a method of reprogramming a cardiac fibroblast comprising contacting said cardiac fibroblast with myocardin (MYOCD, p81, claim 5) and ASCL1 (p86, claim 61). Olson et al. also teach a method preventing or delaying development of cardiac hypertrophy or heart failure in a subject having suffered a myocardial infarct (MI) comprising providing to said subject AKTl, GATA4, TBX5, MEF2C, HAND2 and ASCLl (p90, claim 101) and myocardin (MYOCD, p90, claim 108). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgenes and artificial miR-TS, have transgenes MYCOD and ASCL1 in the vector as taught by Olson et al. and cardiomyocyte specific miRNAs such as miR-208 for the microRNA-mediated suppression of transgene expression in cardiomyocyte, as taught by Malizia et al.. The skilled artisan would have been motivated to have transgenes MYCOD and ASCL1 and cardiomyocyte specific miRNAs in the vector since Olson et al. teach both ASCL1 and MYOCD enhance reprograming a cardiac fibroblast into a cardiomyocyte (see i.e., p60, L12 and p86, claims 61 and 65), operatively link these genes to the binding site of a microRNA which is specifically expressed in cardiomyocytes and lack or less expressed in cardiac fibroblast will lead to the expression of the vectors in cardiac fibroblasts, therefore enhance the reprogramming of the cardiac fibroblasts to cardiomyocytes which is benefit for treating diseases such as heart failure. There would be a reasonable expectation of success of reprogramming a cardiac fibroblast into a cardiomyocyte by the vectors comprising two genes MYCOD and ASCL1 and cardiomyocyte specific miRNAs since Olson et al. teach the sequence of ASCL1 and MYCOD (see p19, L5-6 and 14-15) and Malizia et al. teach cardiomyocyte specific miRNAs such as miR-208 (p2, parag 1). Claims 1-10, 12, 14-17, 27-28, 47, 50 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over Geisler et al. (WO World J Exp Med, 2016 May 20; 6(2): 37-54) in view of Malizia et al. (Wiley Interdiscip Rev Syst Biol Med. 2011 ; 3(2): 183–190) and Olson et al. (WO 2019/036086 A1, published 02/21/2019, cited in IDS), evidenced by of Kakimoto et al. (International Journal of Cardiology 211 (2016) 43–48), as applied to claims 1-9, 14-17, 27-28, 47, 50 and 51 above, and further in view of Yoshida et al. (US 2017/0369846 A1, published in 2017). The teaching of Geisler et al., Malizia et al. and Olson et al. is set forth above. Regarding claims 10 and 12, Geisler et al., Malizia et al. and Olson et al. do not teach the miRNA binding site. However, such was disclosed in the prior art of Yoshida et al.. Yoshida et al. teach a novel method for sorting cardiomyocytes, as well as provide a method for producing high-purity cardiomyocytes and a kit used therefore (see Abstract). Regarding claims 10 and 12, Yoshida et al. teach a method for sorting cardiomyocytes , comprising a step of introducing miRNA-responsive mRNA into a cell group , wherein the miRNA - responsive mRNA consists of a sequence comprising the following (i) and (ii): (i) a nucleic acid specifically recognized by miRNA specifically expressed in cardiomyocytes , and ( ii ) a nucleic acid corresponding to the coding region of a gene , wherein translation of ( ii ) the nucleic acid corresponding to the coding region of a gene into protein is regulated by the nucleic acid sequence in (i) above (parag 14-18). Yoshida et al. teach the miRNA-responsive mRNA consisting of a sequence comprising the above described (i) and (ii) is preferably mRNA comprising a nucleic acid corresponding to the coding region of a gene operably linked to a sequence specifically recognized by miRNA specifically expressed in cardiomyocytes ( hereinafter referred to as a “ miRNA target sequence ”) (parag 0097). Yoshida et al. teach hsa-miR-208b target sequence (SEQ ID NO:66), which is 100% identical to SEQ ID NO:135 in instant claims (see p10, Table 2), which reads on the instant claims 10 and 12. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgene and artificial miR-TS, and use miR-208b target sequence (SEQ ID NO:66) as the microRNA binding site for the microRNA-mediated suppression of transgene expression in cardiomyocyte, as taught by Yoshida et al.. The only difference between instant claim and Geisler et al.’s microRNA-regulated vectors is instant claim uses miR-208b target sequence as the microRNA binding site for the microRNA-mediated suppression of transgene expression in cardiomyocyte. Given that Malizia et al. teach miR-208b is specifically expressed in cardiomyocytes (p2, parag 1), Yoshida et al. teach hsa-miR-208b target sequence (SEQ ID NO:66), and the cardiac fibroblasts are not muscle cells, one of ordinary skill in the art would have substituted miRs in microRNA-regulated vectors (e.g., the vectors in Table 1 Geisler et al., see p42) for myomiRs such as miR-208, and use miR-208b target sequence as the microRNA binding site in the microRNA-regulated vector, in order to suppress the transgene expression in cardiomyocyte, when they need to specifically express transgenes in the cardiac fibroblast (e.g., specifically expressing reprogramming genes in cardiac fibroblasts to reprogram these cardiac fibroblasts). This simple substitution of one known element (miR-208b target sequence) for another known element (target sequence of miRs in Table 1 of Geisler et al.’s microRNA-regulated vectors) is likely to be obvious when predictable results are achieved. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 — 97 (2007) (see MPEP § 2143, B.). Claims 1-9, 11, 14-17, 27-28, 47, 50 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over Geisler et al. (WO World J Exp Med, 2016 May 20; 6(2): 37-54) in view of Malizia et al. (Wiley Interdiscip Rev Syst Biol Med. 2011 ; 3(2): 183–190) and Olson et al. (WO 2019/036086 A1, published 02/21/2019, cited in IDS), evidenced by of Kakimoto et al. (International Journal of Cardiology 211 (2016) 43–48), as applied to claims 1-9, 14-17, 27-28, 47, 50 and 51 above, and further in view of Wang et al. (US 2010/0292297 A1, published in 2010). The teaching of Geisler et al., Malizia et al. and Olson et al. is set forth above. Regarding claim 11, Geisler et al., Malizia et al. and Olson et al. do not teach the microRNA binding site is AAAATATATGTAATCGTCTTAA (SEQ ID NO: 136). However, such is prima facie obvious in view of Wang et al.. Wang et al. teach methods and compositions for modulating gene expression in myocytes (Abstract). Regarding claim 11, Wang et al. teach predicted miR 208 target site within the 3' UTR of human (SEQ ID NO:38) and mouse (SEQ ID NO:39), the sequence of SEQ ID NO:38 and 39 are showed in p37-38 (herein SEQ ID NO:38 and 39 have same nucleotide sequence), wherein the 3-24 nucleotides of SEQ ID NO:38 or SEQ ID NO:39 is 100% identical to SEQ ID NO: 136 in instant claim, indicates the miRNA binding site of miR-208 comprising SEQ ID NO:136, that is, the SEQ ID NO:136 itself, which has the sequence of AAAATATATGTAATCGTCTTAA, is binding to the miR 208, therefore is the binding site of miR 208. PNG media_image1.png 161 853 media_image1.png Greyscale It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgene and artificial miR-TS, and use miR-208b target sequence (SEQ ID NO:38 or SEQ ID NO:39) as the microRNA binding site for the microRNA-mediated suppression of transgene expression in cardiomyocyte, as taught by Wang et al.. The only difference between instant claim and Geisler et al.’s microRNA-regulated vectors is instant claim uses miR-208b target sequence as the microRNA binding site for the microRNA-mediated suppression of transgene expression in cardiomyocyte. Given that Malizia et al. teach miR-208b is specifically expressed in cardiomyocytes (p2, parag 1), Wang et al. teach predicted miR 208 target site, and the cardiac fibroblasts are not muscle cells, one of ordinary skill in the art would have substituted miRs in microRNA-regulated vectors (e.g., the vectors in Table 1 of Geisler et al., see p42) for myomiRs such as miR-208, and use miR-208b target sequence as the microRNA binding site in the microRNA-regulated vector, in order to suppress the transgene expression in cardiomyocyte. This simple substitution of one known element (miR-208b target sequence) for another known element (target sequence of miRs in Table 1 of Geisler et al.’s microRNA-regulated vectors) is likely to be obvious when predictable results are achieved. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 — 97 (2007) (see MPEP § 2143, B.). Claims 1-9, 14-17, 22, 27-28, 47, 50 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over Geisler et al. (WO World J Exp Med, 2016 May 20; 6(2): 37-54) in view of Malizia et al. (Wiley Interdiscip Rev Syst Biol Med. 2011 ; 3(2): 183–190) and Olson et al. (WO 2019/036086 A1, published 02/21/2019, cited in IDS), evidenced by of Kakimoto et al. (International Journal of Cardiology 211 (2016) 43–48), as applied to claims 1-9, 14-17, 27-28, 47, 50 and 51 above, and further in view of Trichas et al. (BMC Biol. 2008 Sep 15;6:40). The teaching of Geisler et al., Malizia et al. and Olson et al. is set forth above. Regarding claim 22, Geisler et al., Malizia et al. and Olson et al. do not teach the polynucleotide sequence encodes a MYOCD-2A-ASCL1 protein. However, the use of 2A peptide in the vector to link two transgenes is disclosed by Trichas et al. at the time of instant invention. Trichas et al. teach transgenic mouse lines that express a 2A-containing construct essentially ubiquitously throughout development and adulthood (p3, left column). Regarding claim 22, Trichas et al. teach the 2A peptide was demonstrated to efficiently mediate the co-translational cleavage of artificial polypeptides by inserting it between the coding sequences of two reporter genes. Subsequently, it has been shown to function in cells from a wide variety of eukaryotes, ranging from yeast to plants to insects to mammals (p2, right column). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al., Malizia et al. and Olson et al.’s microRNA-regulated vectors comprise transgenes ASCL1 and MYOCD as well as artificial miR-TS, and have transgenes MYCOD and ASCL1 linked by 2A peptide in the vector, as taught by Trichas et al.. The skilled artisan would have been motivated to have transgenes MYCOD and ASCL1 linked by 2A peptide in the vector since Trichas et al. teach 2A peptide can efficiently mediate the co-translational cleavage of artificial polypeptides by inserting it between the coding sequences of two genes (see p2, right column). There would be a reasonable expectation of success of having transgenes MYCOD and ASCL1 linked by 2A peptide in the vector since Trichas et al. teach the sequence of 2A peptide (i.e., p4, figure 1). Claims 1-9, 14-17, 23-24, 27-28, 47, 50 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over Geisler et al. (WO World J Exp Med, 2016 May 20; 6(2): 37-54) in view of Malizia et al. (Wiley Interdiscip Rev Syst Biol Med. 2011 ; 3(2): 183–190) and Olson et al. (WO 2019/036086 A1, published 02/21/2019, cited in IDS), evidenced by of Kakimoto et al. (International Journal of Cardiology 211 (2016) 43–48), as applied to claims 1-9, 14-17, 27-28, 47, 50 and 51 above, and further in view of Wang et al. (Cell, 2001, Vol. 105, 851–862), evidenced by Peruta et al. (Hum Gene Ther. 2015 Feb;26(2):94-103). The teaching of Geisler et al., Malizia et al. and Olson et al. is set forth above. Regarding claim 23, Geisler et al., Malizia et al. and Olson et al. do not teach the MYOCD comprises an internal deletion. However, this was disclosed by Wang et al. at the time of instant invention. Wang et al. teach the finding of a novel and highly potent transcription factor, named myocardin (MYOCD), that is expressed in cardiac and smooth muscle cells (Abstract). Regarding claim 23, Wang et al. teach to further define the mechanism for myocardin-dependent transcription, they analyzed the transcriptional activity of a series of amino- and carboxy-terminal deletion mutants (see figure 5A). Deletion of the first 66 residues (mutant NΔ66) did not impair transcriptional activity of myocardin with either the SM22 or ANF promoters (p854, right column). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify modify Geisler et al., Malizia et al. and Olson et al.’s microRNA-regulated vectors comprise transgenes ASCL1 and MYOCD as well as artificial miR-TS, and have an internal deletion for MYOCD as taught by Wang et al.. The skilled artisan would have been motivated to use the internal deletion to decrease the size of myocardin (myocardin has a big size with 807 amino acids, see p852, left column), since a reduced size of transgene is beneficial for making , e.g., a AAV vector (which has a size limit), and facilitates the transduction of the vector. There would be a reasonable expectation of success of having internal deletion of MYOCD since Wang et al. teach the position of amino acids for internal deletion which does not affect its transcriptional activity (see p854, right column as well as figure 5). Regarding claim 24, following the discussion above, Geisler et al. teach Adeno-associated virus vector-based microRNA targeting strategies to improve cardiac - specific gene therapy (p44, figure 2), which using a vector transgene and the microRNA binding site and a polyadenylation sequence. Geisler et al. also refers a study teaching improved tumor specificity of systemically applied AAV8 vectors expressing HSV‑tk linked with miR-122TS in combination with a liver-specific promoter in a syngeneic metastatic murine hepatocellular carcinoma (HCC) model (see p45, left column). Which is evidenced by Peruta et al.. Peruta et al. teach a vector comprising from 5’-3’ order with a HLP promoter, transgene, the microRNA binding site and a polyadenylation sequence (see p95, figure 1). Claims 1-9, 14-17, 23-25, 27-28, 47, 50 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over Geisler et al. (WO World J Exp Med, 2016 May 20; 6(2): 37-54) in view of Malizia et al. (Wiley Interdiscip Rev Syst Biol Med. 2011 ; 3(2): 183–190) and Olson et al. (WO 2019/036086 A1, published 02/21/2019, cited in IDS), evidenced by of Kakimoto et al. (International Journal of Cardiology 211 (2016) 43–48), and further in view of Wang et al. (Cell, 2001, Vol. 105, 851–862),evidenced by Peruta et al. (Hum Gene Ther. 2015 Feb;26(2):94-103), as applied to 1-9, 14-17, 23-24, 27-28, 47, 50 and 51 above, and further in view of Chen et al. (Stem Cell Research & Therapy, 2017, 8:118). The teaching of Geisler et al., Malizia et al., Olson et al. and Wang et al. is set forth above. Regarding claim 25, following the discussion above, Geisler et al. do not teach the polynucleotide further comprises a sequence encoding miR-133. However, such was disclosed in the prior art of Chen et al. at the time of instant invention. Chen et al. summarize and compare the major progress in directed cardiac reprogramming including transcription factors and miRNAs, especially the small molecules (Abstract). Regarding claim 25, Chen et al. teach the functional mechanisms of transcription factors and microRNAs in the cardiac development and direct reprogramming (p3, Table 1). miR-133 is the transcription factor for direct reprogramming. This teaching reads on the polynucleotide comprises a sequence encoding miR-133, as recited in instant claim. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Geisler et al.’s microRNA-regulated vectors, which comprises transgene and artificial miR-TS, and use transcription factors such as a combination of GATA4, MEF2C, and TBX5, or miR-133 as transgene(s) for selectively expressing in cardiac fibroblasts but not cardiomyocytes, to promote direct reprogramming of fibroblasts into cardiomyocytes, as taught by Chen et al.. The skilled artisan would have been motivated to use the transcription factors such as a combination of GATA4, MEF2C, and TBX5, or miR-133 to efficiently promote the reprograming of cardiac fibroblasts into cardiomyocytes, while not expressing these transcription factors in cardiomyocytes to avoid the reprogramming of existing cardiomyocytes, therefore obtain plenty of cardiomyocytes as needed. There would be a reasonable expectation of success of using these transcriptional factors since Chen et al. teach these transcription factors for direct reprogramming fibroblasts into cardiomyocytes, as well as the underlying mechanism (see p3, Table 1). Allowable Subject Matter Claims 13 and 26 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to QINHUA GU whose telephone number is (703)756-1176. The examiner can normally be reached M-F: 9:00 - 5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571)272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Q.G./Examiner, Art Unit 1633 /FEREYDOUN G SAJJADI/Supervisory Patent Examiner, Art Unit 1699
Read full office action

Prosecution Timeline

Aug 31, 2022
Application Filed
Sep 05, 2025
Non-Final Rejection mailed — §103
Dec 05, 2025
Response Filed
Apr 16, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12662660
METHODS FOR AMPLIFYING AND DIFFERENTIATING PANCREATIC CELLS, AND APPLICATION THEREOF
4y 1m to grant Granted Jun 23, 2026
Patent 12605312
PREPARATION METHOD AND APPLICATION OF SINGLE EMULSIFIER AND DOUBLE EMULSION BASED ON DNA TRIANGULAR ORIGAMI TECHNOLOGY
3y 11m to grant Granted Apr 21, 2026
Patent 12600953
COMPOSITIONS AND METHOD FOR ESTABLISHING ORGANOID CULTURES FROM CRYOGENICALLY PRESERVED TISSUE
6y 2m to grant Granted Apr 14, 2026
Patent 12590295
MESENCHYMAL STROMAL CELLS AS A REPROGRAMMING SOURCE FOR IPSC INDUCTION
3y 10m to grant Granted Mar 31, 2026
Patent 12589116
METHOD FOR PRODUCING STEM CELL WITH ENHANCED EFFICACY
3y 9m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

2-3
Expected OA Rounds
76%
Grant Probability
99%
With Interview (+30.1%)
3y 9m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 72 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month