Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on July 08, 2026. Claims 22-25 and 28-42 are pending. Claims 22-25 and 28-37 are currently examined. Claims 38-42 are withdrawn.
Claim Objection
(Previous objection- withdrawn) The base claims 23 and 37 are objected to because of the following informalities: For claim 23, the “has” in the phrase “the nucleic acid comprises has at least 8,000 bases” should be deleted. For claim 37, “the” in the phrase “… the at least one nucleic acid…” should be deleted.
This objection is withdrawn in view of the amendment filed on July 08, 2026.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(Previous rejection- withdrawn) Claims 23-27, 33-34, and 36-37 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
This rejection is withdrawn in view of the amendment filed on July 08, 2026.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
(New Rejection-necessitated by amendment) Claims 22-23, 31-32 and 35-37 are rejected under 35 U.S.C. 103 as being unpatentable over Thao et al. (bioRxiv, this version posted February 21, 2020, hereinafter “Thao”) as evidenced by GenScript (https://www.genscript.com/gsfiles/gene_synthesis_handbook.pdf?page_no=1&position_no=1&sensors=googlesearch), and Thao-Nature ( Nature. 2020 Jun;582(7813):561-565).
Regarding claim 22, Thao teaches using a full functionality of a yeast-based synthetic genomics platform to genetically reconstruct viral subgenomic fragments of diverse RNA viruses, including members of the Coronaviridae, (See Abstract). Here the subgenomic fragments (See Thao, page 8, lines 157-161; Thao-Nature, Extended Data Fig. 1 below) include the Sequence part A encodes for a nucleocapsid protein N, Sequence part B encodes for an envelope protein E, Sequence part C encodes for a membrane protein M and Sequence part D encodes for a glycosylated surface protein S as claimed in the claim 22.
PNG
media_image1.png
796
684
media_image1.png
Greyscale
As for the limitation of “nucleic acid does not comprise ORF6 and/or ORF8 of SARS-CoV-2”, based on the teaching of Thao, Thao’s study and construction do not involve the ORF6 and ORF8. In addition, Thao teaches that the synthetic genomics platform is also used for constructing MERS-COV, HCoV-229E and HCoV-HKU1 (See page 7). There is no ORF6 or ORF8 of SARS-COV-2 in the MERS-COV, HCoV-229E and HCoV-HKU1b because the ORF6 and/or ORF8 are specific to lineage B betacoronaviruses including SARS-COV and SARS-COV-2.
PNG
media_image2.png
530
1037
media_image2.png
Greyscale
As for the “long-chain nucleic acid with at least 4,000 bases”, Thao teaches that they fragmented the genome into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kbp (See page 8), which is shorter and does not meet the limitation of the claim, however, the issue is moot since Thao teaches a 4 kb+ sequence after cloning/assembly, the synthesized RNA virus genome is over 4,000 bases as claimed (See Table 1, page 29 and below).
As for the newly added limitation on the Sequence part D and Sequence part C, Thao does not teach the Sequence part C and Sequence part D with the sequence limitation as claimed, however, the base claim 22 only requires “…at least two of sequence parts A-D in any arrangement…”, therefore, the combination of Sequence part A and Sequence part B will satisfy the claim requirement. Based on the description above, Thao teaches the Sequence part A and Sequence part B.
Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Regarding claims 23 and 31, they require a specific length of the synthesized nucleic acid. Thao teaches synthesizing the RNA virus whole genome by the company, GenScript. In Thao’s study, they fragmented the genome into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kb and synthesized them (See page 8, paragraph 2) and then assembled the synthetic genomics into the TAR vector, where the assembled synthesized-nucleic acid is over 8,000 bases and up to 31.9 kb depending on the virus types (See Table 1 above), which teaches the claim 23. As for the nucleic acid being a maximum size of 200,000 to 1,000,000 bases in claim 31, one of the skilled in the art can assemble the small synthesized nucleic acid fragments into a large fragment such as 200kb or above based on the needs. Also, as a new technique, GenScript now provides GenBrick™ synthesis service for synthesizing 200 kb long DNA sequences at once (https://www.genscript.com/synthetic-biology-gene-synthesis-service.html), which teaches alternative ways to synthesize the nucleic acids with maximum size of 200,000 to 1,000,000 bases based on fragment assembly and/or a direct-synthesis.
Regarding claim 32, Thao teaches that the TAR vector is used to clone the viral cDNA (See page 17 and below).
PNG
media_image3.png
443
673
media_image3.png
Greyscale
Regarding claims 35-36, they require that a kit comprising two or more nucleic acids where the two or more nucleic acids are present in at least one plasmid.
Thao teaches the synthetic DNA constructs comprise the N protein and E protein of coronavirus as claimed, which were delivered as sequence-confirmed plasmids (See page 9). TAR cloning is then performed to rescue the recombinant virus such as rSARS-CoV-2 and rSARS-CoV-2-GFP (See e.g., page 9), which contains nucleic acids encoding S, N, M and E proteins. Although Thao does not specifically teach a kit, the concept of packaging components into a kit is well known and routine in the art. As described above, Thao teaches the nucleic acids and plasmid as claimed. It would have been obvious to one of ordinary skill in the art at the time the invention was made to package components into a kit. One would have been motivated to do this for commercial exploitation of the invention by providing convenience for the end user. Thus, the claimed invention is obvious over Thao’s researches. According to MPEP § 2112.01(III), “Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art.” In re Ngai, 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004)
Regarding claim 37, Thao teaches that they selected two clones for each construct for rescuing recombinant rSARS-CoV-2 and rSARS-CoV-2-GFP. The supernatants transferred to fresh VeroE6 cells contained infectious recombinant viruses for almost all recombinant rSARS-CoV-2 and rSARS-CoV-GFP constructs (See page 9, lines 182-197), which indicates that an infectious viral particle is formed. Because the constructs of rSARS-CoV-2 and rSARS-CoV-2-GFP comprises the structural proteins of Spike (S), Envelope (E), Membrane (M), and Nucleocapsid (N) include the E protein (See Fig. 3 above), it would have been obvious that the virus envelope protein, Envelope (E), package the nucleic acid as claimed for the infectious particles of rSARS-CoV-2 and rSARS-CoV-2-GFP.
(New Rejection-necessitated by amendment) Claim 24 is rejected under 35 U.S.C. 103 as being unpatentable over being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 31-32 and 35-37 above, and further in view of Dong et al. (CN111139241A, publication, May 12, 2020, hereinafter “Dong”).
Please note: SEQ ID NO: 55 is not disclosed in EP20020092.1 with the priority filing data 03/03/2020, as claimed. Therefore, the priority filing data of claim 24 is 05/20/2020 with EP20020240.6).
Claim 24 requires that the nucleic acid comprises an ORF8 sequence defined by the SEQ ID NO: 55 or a sequence having at least 90% sequence identity to SEQ ID NO: 55.
The relevance of Thao is set forth above. The reference is silent on SEQ ID NO: 55 or a sequence having at least 90% sequence identity to SEQ ID NO: 55.
However, Dong teaches a sequence, SEQ ID NO: 221, shows 98.3% identical to the claimed SEQ ID NO: 55, where SEQ ID NO: 221 of Dong is the ORF8 of SARS-COV-2 (See page 3; Table 3, page 20 and below), where the SEQ ID NO: 221 is an artificial sequence.
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Dong to arrive at an invention as claimed. Because SEQ ID NO: 221 is the gene pf ORF8 from a novel SARS-COV-2 that can be inserted in the dual-luciferase reporter plasmid, one of skill in the art would have been motivated to do so to use the known ORF8 sequence of the SEQ ID NO: 221 of Dong to substitute the sequence of the ORF8 of SARS-COV-2 and then synthesize the cDNA fragment (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize such a nucleic acid comprising the at least 90% sequence identity to SEQ ID NO: 55 as
PNG
media_image4.png
870
925
media_image4.png
Greyscale
claimed based on the techniques taught by Thao and Dong.
(New Rejection-necessitated by amendment) Claim 30 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 31-32 and 35-37 above, and further in view of Cheynet-Sauvion et al. (US 2002/0119449 A1, published on Aug. 29, 2002, hereinafter “Cheynet-Sauvion”).
Claim 30 requires that the nucleic acid additionally comprises at least one sequence consisting of SEQ ID NO: 15, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or a ribonucleic acid sequence encoding at least one of SEQ ID NOs: 15, 28, 29, or 30.
The relevance of Thao is set forth above. It is silent on a sequence consisting of SEQ ID NO: 15, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30.
However, Cheynet-Sauvion teaches a process for transcribing RNA using a nucleotide reagent as the promoter. The invention can be applied notably to the detection, synthesis or quantification of RNA (Abstract). Cheynet-Sauvion discloses that the single-stranded DNA transcription system comprises a template strand (a) of 50 bases having the sequence 3'ATTATGCTGAGTGATATCCCAACCGGCGTCACAAGTGAGTACCAATACCG5' and hybridized from positions -17 to + 1 with the non-template promoter strand (b) having the sequence 5'TAATACGACTCACTATAG 3' (blocked at its 3' end) (See [0107]), where the non-template promoter strand sequence is identical to the SEQ ID NO: 28 as claimed (See Table C below).
PNG
media_image5.png
551
1016
media_image5.png
Greyscale
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Cheynet-Sauvion to arrive at an invention as claimed. Cheynet-Sauvion teaches that the presence of the non-template strand influences the efficiency of transcription and the yield of transcription is increased on the single-stranded templates, (See [0138]), thus, one of skill in the art would have been motivated to use the known sequence of Cheynet-Sauvion to substitute the promoter sequence of Thao to synthesize the nucleic acid as claimed (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid sequence based on the sequence disclosed in Cheynet-Sauvion and the synthesis method of Thao.
(New Rejection-necessitated by amendment) Claim 33 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 31-32 and 35-37 above, and further in view of CP035535-BLAST (https://www.ncbi.nlm.nih.gov/nuccore/CP035535) and KF192692-BLAST (https://www.ncbi.nlm.nih.gov/nuccore/KF192692).
Claim 33 requires the vector comprising the sequences defined in SEQ ID NO: 46 and SEQ ID NO: 47.
The relevance of Thao is set forth above. It is silent on a vector sequence comprising SEQ ID NOs: 46-47.
However, CP035535-BLAST teaches a caulobacter ethensis 2.0 (C.ETH-2.0) genome assembled from chemically synthesized oligonucleotides using de novo DNA synthesis (See page 1) that shows comprising an identical sequence to the claimed SEQ ID NO: 46 (See Table D below).
KF192692-BLAST teaches a Yeast shuttle vector pJHU2, complete sequence. The vector sequences comprise an identical sequence to the claimed SEQ ID NO: 47 (See Table E below).
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao, CP035535-BLAST and KF192692-BLAST to arrive at an invention as claimed. Because CP035535 sequence is for chemical synthesis rewriting of a bacterial genome to achieve design flexibility and biological functionality, and KF192692 is a shuttle vector that can be benefit to be replicated and selected in both yeast and bacterial system. Thus, one of skill in the art would have been motivated to use the known sequence of CP035535-BLAST and KF192692-BLAST to substitute the vector sequence of Thao to synthesize the nucleic acid as claimed (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid based on the sequence disclosed in CP035535-BLAST and KF192692-BLAST, and the synthesis method of Thao.
PNG
media_image6.png
457
622
media_image6.png
Greyscale
PNG
media_image7.png
672
687
media_image7.png
Greyscale
Allowable Subject Matter
The SEQ ID NOs: 13 or a sequence having at least 98.5% sequence identity to the sequence comprising SEQ ID NO: 13 are free of art.
The SEQ ID NOs: 49 or a sequence having at least 97.2% sequence identity to the sequence comprising SEQ ID NO: 49 are free of art.
Accordingly, claims 25, 28-29 and 34 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Responses to Applicant’s Remarks
Applicant’s arguments filed on July 08, 2026, have been received and fully considered as follows:
1). Applicant’s amendment regarding the objections is considered. The objection is withdrawn.
2). Applicant’s amendment regarding the rejections under 35 U.S.C. § l 12(b) is considered. The rejection is withdrawn.
3). Applicant’s amendment and argument regarding the rejection under 35 U.S.C. § 103 is not found persuasive.
Although applicant amended the base claim 22 by adding the limitations to Sequence part D and Sequence part C with the SEQ ID NOs: 13 and 49 and their percentage respectively, and theses sequences are free of art, however, the base claim 22 is directed to a fully synthetic, long-chain nucleic acid with at least 4,000 bases, the nucleic acid comprising at least two of sequence parts A-D in any arrangement, where Sequence part A and Sequence part B can be selected for the at least two of sequence combination, which are taught by Thao, to satisfied the base claim 1. Therefore, none of the claims actually require the subject matter that is free of the art.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUIXUE WANG whose telephone number is (571)272-7960. The examiner can normally be reached Monday-Friday 8:00 am-5:00 pm, EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached on (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RUIXUE WANG/Examiner, Art Unit 1672
/THOMAS J. VISONE/ Supervisory Patent Examiner, Art Unit 1672
Prosecution Insights