Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on Nov. 11, 2025. Claims 22-42 are pending. Claims 22-37 are currently examined. Claims 38-42 are withdrawn.
Election/Restrictions
Applicant's election with traverse of Group I (claims 22-37), in the reply filed on Nov. 11, 2025, is acknowledged.
Applicant argues that it should be no undue burden on the Examiner to consider all claims in the single application. Applicant’s argument is not persuasive. Although related, the inventive groups vary substantially that the searches are not coextensive and each distinct Group requires its own search and considerations of other patentability issues as the art relating to one Group would not provide the structural elements required for the other Group. Thus, the search would be an undue burden on the Patent and Trademark Office resources due to the complex nature of the search in terms of computer time needed to perform the search and the subsequent analysis of the search results by the examiner.
For the reasons above, the Restriction is deemed to be proper, and is made FINAL. Accordingly, claims 38-39 and 40-42 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group.
Claim Objection
The base claims 23 and 37 are objected to because of the following informalities:
For claim 23, the “has” in the phrase “the nucleic acid comprises has at least 8,000 bases” should be deleted.
For claim 37, “the” in the phrase “… the at least one nucleic acid…” should be deleted.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 23-27, 33-34, and 36-37 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 24-27 and 33, they recite the term “defined” that render these claims indefinite. It is not clear if the phrase “defined” is represented to “comprise” the SEQ ID NOS or “consist” the SEQ ID NOs. Therefore, one of ordinary skill in the art will not know the metes and bounds of the claims. For purposes of compact prosecution and applying prior art, these claims were interpreted herein to comprise the SEQ ID NOS as claimed.
In addition, claims 24-27 recite a phrase “a sequence as defined in SEQ ID NOs”, which also render the claims indefinite because “a sequence” of nucleic acid can read on any stretch of 2 or more nucleotides. For example, for claim 24, the limitation “an ORF8 sequence defined by SEQ ID NO 55” is not clear since it may read on a region of SEQ ID NO: 55. Therefore, one of ordinary skill in the art will not know the metes and bounds of the claims.
Regarding claims 23 and 36, the phrase "optionally" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(h). The term “optionally” means "not required or mandatory". For example, a composition comprising A, B, C, and optionally D means that component D can or cannot be present (D is not required to be present). In the rejected claims 23 and 36, however, it appears the use of "optionally" is an attempt to define "preferred" embodiments or limitations. For example, claim 8 states “…optionally at least 20,000 bases”. In this instance, the term optionally does not make sense given the definition of optionally (not required or mandatory). Accordingly, one of ordinary skill in the art will not know the metes and bounds of the claim.
Claim 37 recites the limitation “the at least one nucleic acid” in reference to claim 22. There is insufficient antecedent basis for this limitation in the claim.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 22-23, 28-29, 31-32, 35-36 and 37 are rejected under 35 U.S.C. 103 as being unpatentable over Thao et al. (bioRxiv, this version posted February 21, 2020, hereinafter “Thao”) as evidenced by GenScript (https://www.genscript.com/gsfiles/gene_synthesis_handbook.pdf?page_no=1&position_no=1&sensors=googlesearch), and Thao-Nature ( Nature. 2020 Jun;582(7813):561-565).
The base claim 22 is directed to a fully synthetic, long-chain nucleic acid with at least 4,000 bases, the nucleic acid comprising at least two of sequence parts A-D in any arrangement, wherein
Sequence part A encodes for a nucleocapsid protein N of a coronavirus,
Sequence part B encodes for an envelope protein E of a coronavirus,
Sequence part C encodes for a membrane protein M of a coronavirus,
Sequence part D encodes for a glycosylated surface protein S of a coronavirus; or the nucleic acid comprises a ribonucleic acid sequence corresponding to a deoxyribonucleic acid sequence comprising at least two of sequence parts A-D in any arrangement,
wherein the nucleic acid does not comprise ORF6 and/or ORF8 of SARS-CoV-2.
Thao describes the rapid reconstruction of SARS-CoV-2 using a synthetic genomics platform and teaches that the reverse genetics has been an indispensable tool to gain insights into viral pathogenesis and vaccine development. They show the full functionality of a yeast-based synthetic genomics platform to genetically reconstruct diverse RNA viruses, including members of the Coronaviridae. Viral subgenomic fragments are generated using viral isolates, cloned viral DNA, clinical samples or synthetic DNA, and these fragments are then reassembled in one step in Saccharomyces cerevisiae using transformation-associated recombination cloning to maintain the genome as a yeast artificial chromosome. T7 RNA polymerase is then used to generate infectious RNA to rescue viable virus. Using this platform, they are able to engineer and generate chemically synthesized clones such as the SARS-CoV-2 in only a week after receipt of the synthetic DNA fragments (See Abstract). Here the chemically synthesized DNA fragment is provided by GenScript (See page 15, paragraph 1). The technique for chemically synthesized DNA can be found in GenScript’s hand book. The detailed cloning by GenScript can be evidenced by their late publication of Thao-Nature, which teaches that the SARS-CoV-2 synthetic DNA fragments were synthesized and cloned in pUC57 or pUC57mini by GenScript, containing homologous regions to TAR vectors pVC604 and pCC1BAC-His3 (Thao-Nature, page 566, right column, paragraphs 1 and 2; Extended Data Table 3). Thao also teaches that they fragmented the genome of SARS-COV-2 into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kbp (See page 8, paragraph 2).
Accordingly, Thao teaches a fully synthetic long-chain nucleic acid comprising sequences encoding S, M, N and E proteins of coronavirus (See page 26-27) as claimed.
As for the limitation of “nucleic acid does not comprise ORF6 and/or ORF8 of SARS-CoV-2” as claimed, Thao teaches that the synthetic genomics platform is also used for constructing MERS-COV, HCPV-229E and HCoV-HKU1 (See page 7). It is obvious that there is no ORF6 or ORF8 of SARS-COV-2 in the constructs of MERS-COV, HCPV-229E and HCoV-HKU1.
PNG
media_image1.png
530
1037
media_image1.png
Greyscale
As for the “long-chain nucleic acid with at least 4,000 bases”, Thao teaches that they fragmented the genome into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kbp (See page 8), which is shorter and does not meet the limitation of the claim, however, the issue is moot since Thao teaches a 4 kb+ sequence after cloning/assembly, the synthesized RNA virus genome is over 4,000 bases as claimed (See Table 1, page 29 and below).
Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Regarding claims 23 and 31, they require a specific length of the synthesized nucleic acid. Thao teaches synthesizing the RNA virus whole genome by the company, GenScript. In Thao’s study, they fragmented the genome into 12 subgenomic DNA fragments ranging in size between 0.5-3.4 kb and synthesized them (See page 8, paragraph 2) and then assembled the synthetic genomics into the TAR vector, where the assembled synthesized-nucleic acid is over 8,000 bases and up to 31.9 kb depending on the virus types (See Table 1 above), which teaches the claim 23. As for the nucleic acid being a maximum size of 200,000 to 1,000,000 bases in claim 31, one of the skilled in the art can assemble the small synthesized nucleic acid fragments into a large fragment such as 200kb or above based on the needs. Also, as a new technique, GenScript now provides GenBrick™ synthesis service for synthesizing 200 kb long DNA sequences at once (https://www.genscript.com/synthetic-biology-gene-synthesis-service.html), which teaches alternative ways to synthesize the nucleic acids with maximum size of 200,000 to 1,000,000 bases based on fragment assembly and/or a direct-synthesis.
Regarding claims 28 and 29, they require the nucleic acid comprises different combinations of the sequence parts A-D. Thao teaches a synthetic genomics platform providing the technical advance to rapidly generate molecular clones of diverse RNA viruses by using viral isolates, cloned DNA, synthetic DNA, and even clinical samples as starting material (See page 8, paragraph 1). Based on the Fig. 3a, Thao and Thao-
PNG
media_image2.png
567
371
media_image2.png
Greyscale
Nature teach that the reconstructed SARS-COV-2 comprises all the sequence parts A-D that are (A) nucleocapsid protein N, (B) envelope protein E, (C) membrane protein M and (D) glycosylated surface protein S (See Fig. 3, Thao-Nature; page 8, paragraph 2, Thao; Fig. 3 below).
Regarding claim 32, Thao teaches that the TAR vector is used to clone the viral cDNA (See page 17 and below).
PNG
media_image3.png
443
673
media_image3.png
Greyscale
Regarding claims 35-36, they require that a kit comprising two or more nucleic acids where the two or more nucleic acids are present in at least one plasmid.
Thao teaches the synthetic DNA constructs comprise the Sequence part A-D as claimed, which were delivered as sequence-confirmed plasmids (See page 9). TAR cloning is then performed to rescue the recombinant virus such as rSARS-CoV-2 and rSARS-CoV-2-GFP (See e.g., page 9), which contains nucleic acids encoding S, N, M and E proteins. Although Thao does not specifically teach a kit, the concept of packaging components into a kit is well known and routine in the art. As described above, Thao teaches the nucleic acids and plasmid as claimed. It would have been obvious to one of ordinary skill in the art at the time the invention was made to package components into a kit. One would be motivated to do this for commercial exploitation of the invention by providing convenience for the end user. Thus, the claimed invention is obvious over Thao’s researches. According to MPEP § 2112.01(III), “Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. In re Ngai, ** > 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004) < (Claim at issue was a kit requiring instructions and a buffer agent. The Federal Circuit held that the claim was anticipated by a prior art reference that taught a kit that included instructions and a buffer agent, even though the content of the instructions differed.). See also In re Gulack, 703 F.2d 1381, 1385-86, 217 USPQ 401, 404 (Fed. Cir. 1983) ( "Where the printed matter is not functionally related to the substrate, the printed matter will not distinguish the invention from the prior art in terms of patentability….[T]he critical question is whether there exists any new and unobvious functional relationship between the printed matter and the substrate." ).”
Regarding claim 37, Thao teaches that they selected two clones for each construct for rescuing recombinant rSARS-CoV-2 and rSARS-CoV-2-GFP. The supernatants transferred to fresh VeroE6 cells contained infectious recombinant viruses for almost all recombinant rSARS-CoV-2 and rSARS-CoV-GFP constructs (See page 9, lines 182-197), which indicates that an infectious viral particle is formed. Because the constructs of rSARS-CoV-2 and rSARS-CoV-2-GFP comprises the structural proteins of Spike (S), Envelope (E), Membrane (M), and Nucleocapsid (N) include the E protein (See Fig. 3 above), it would be obvious that the virus envelope protein, Envelope (E), package the nucleic acid as claimed for the infectious particles of rSARS-CoV-2 and rSARS-CoV-2-GFP.
Claim 24 is rejected under 35 U.S.C. 103 as being unpatentable over being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 28-29, 31-32, 35-36and 37 above, and further in view of Dong et al. (CN111139241A, publication, May 12, 2020, hereinafter “Dong”).
Please note: SEQ ID NO: 55 is not disclosed in EP20020092.1 with the priority filing data 03/03/2020, as claimed. Therefore, the priority filing data regarding SEQ ID NO:55 in claim 24 is 05/20/2020 with EP20020240.6).
Claim 24 requires that the nucleic acid comprises an ORF8 sequence defined by the SEQ ID NO: 55 or a sequence having at least 90% sequence identity to SEQ ID NO: 55.
The relevance of Thao is set forth above. The reference is silent on SEQ ID NO: 55 or a sequence having at least 90% sequence identity to SEQ ID NO: 55.
Although there is no prior art for SEQ ID NO: 55, Dong teaches a sequence, SEQ ID NO: 221, shows 98.3% identical to the claimed SEQ ID NO: 55, where SEQ ID NO: 221 of Dong.
is the ORF8 of SARS-COV-2 (See page 3; Table 3, page 20 and below), where the SEQ ID NO: 221 is an artificial sequence.
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Dong to arrive at an invention as claimed. One of skill in the art would have been motivated to do so to use the known ORF8 sequence of the SEQ ID NO: 221 of Dong to substitute the sequence of the ORF8 of SARS-COV-2 and then synthesize the cDNA fragment (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize such a nucleic acid comprising the at least 90% sequence identity to SEQ ID NO: 55 as
PNG
media_image4.png
870
925
media_image4.png
Greyscale
claimed based on the techniques taught by Thao and Dong.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 28-29, 31-32, 35-36 and 37 above, and further in view of Coley et al. (J Virol. 2005 Mar;79(5):3097-106, hereinafter “Coley” ).
Claim 25 requires a sequence as defined in SEQ ID NO: 9 or a sequence having at least 97.2% sequence identity to the sequence as defined in SEQ ID NO: 9; or b) a sequence as defined in SEQ ID NO: 11 or a sequence having at least 90% sequence identity to the sequence as defined in SEQ ID NO: 11.
The relevance of Thao is set forth above. It is silent on a sequence as defined in SEQ ID NO: 9 or SEQ ID NO: 11 or a sequence having at least at least 97.2% sequence identity to the sequence as defined in SEQ ID NO: 9 or 90% sequence identity to the sequence as defined in SEQ ID NO: 11.
Coley describes the recombinant mouse hepatitis virus (MHV) strain A59 from cloned, full-length cDNA replicates to high titers in vitro and is fully pathogenic in vivo (See Abstract), and teaches a nucleotide sequence accession number AY700211 that matches with the claimed SEQ ID NO: 11 at 99% (See Table B below), where the nucleic acid region of 28969...29655 of AY700211 encode the M protein of Sequence part C as claimed.
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Coley to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known M sequence of Coley to substitute the sequence of the M for the constructs in Thao, such as applying in the constructs of MHV-GFP, rSARS-CoV-2, rSARS-CoV-2-GFP and MERS-CoV (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid sequence based on the GenBank number of Coley and the synthesis’s method of Thao.
PNG
media_image5.png
884
662
media_image5.png
Greyscale
Claim 30 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 28-29, 31-32, 35-36 and 37 above, and further in view of Cheynet-Sauvion et al. (US 2002/0119449 A1, published on Aug. 29, 2002, hereinafter “Cheynet-Sauvion”).
Claim 30 requires that the nucleic acid additionally comprises at least one sequence consisting of SEQ ID NO: 15, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or a ribonucleic acid sequence encoding at least one of SEQ ID NOs: 15, 28, 29, or 30.
The relevance of Thao is set forth above. It is silent on a sequence consisting of SEQ ID NO: 15, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30.
Cheynet-Sauvion teaches a process for transcribing RNA using a nucleotide reagent as the promoter. The invention can be applied notably to the detection, synthesis or quantification of RNA (Abstract). Cheynet-Sauvion discloses that the single-stranded DNA transcription system comprises a template strand (a) of 50 bases having the sequence 3'ATTATGCTGAGTGATATCCCAACCGGCGTCACAAGTGAGTACCAATACCG5' and hybridized from positions -17 to + 1 with the non-template promoter strand (b) having the sequence 5'TAATACGACTCACTATAG 3' (blocked at its 3' end) (See [0107]), where the non-template promoter strand sequence is identical to the SEQ ID NO: 28 as claimed (See Table C below).
PNG
media_image6.png
551
1016
media_image6.png
Greyscale
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Cheynet-Sauvion to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known sequence of Cheynet-Sauvion to substitute the promoter sequence of Thao to synthesize the nucleic acid as claimed (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid sequence based on the sequence disclosed in Cheynet-Sauvion and the synthesis’s method of Thao.
Claim 33 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 28-29, 31-32, 35-36and 37 above, and further in view of CP035535-BLAST (https://www.ncbi.nlm.nih.gov/nuccore/CP035535) and KF192692-BLAST (https://www.ncbi.nlm.nih.gov/nuccore/KF192692).
Claim 33 require the vector comprises the sequences defined in SEQ ID NO: 46 and SEQ ID NO: 47.
The relevance of Thao is set forth above. It is silent on a vector sequence comprising SEQ ID NOs: 46-47.
CP035535-BLAST teaches a caulobacter ethensis 2.0 (C.ETH-2.0) genome ssembled from chemically synthesized oligonucleotides using de novo DNA synthesis (See page 1) that shows comprising an identical sequence to the claimed SEQ ID NO: 46 (See Table D below).
KF192692-BLAST teaches a Yeast shuttle vector pJHU2, complete sequence. The vector sequences comprise an identical sequence to the claimed SEQ ID NO: 47 (See Table E below).
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao, CP035535-BLAST and KF192692-BLAST to arrive at an invention as claimed. One of skill in the art would have been motivated to use the known sequence of CP035535-BLAST and KF192692-BLAST to substitute the vector sequence of Thao to synthesize the nucleic acid as claimed (See MPEP 2144.06: Substituting equivalents known for the same purpose). There would be a reasonable expectation of success to synthesize the nucleic acid based on the sequence disclosed in CP035535-BLAST and KF192692-BLAST, and the synthesis method of Thao.
PNG
media_image7.png
457
622
media_image7.png
Greyscale
PNG
media_image8.png
672
687
media_image8.png
Greyscale
Claims 34 is rejected under 35 U.S.C. 103 as being unpatentable over Thao as evidenced by GenScript and Thao-Nature as applied to claims 22-23, 28-29, 31-32, 35-36 and 37 above, and further in view of Regla-Nava et al. (J Virol. 2015 Apr;89(7):3870-87, hereinafter “Regla-Nava”).
Claim 34 requires that the vector does not comprise sequence part B, and wherein regulation of sequence part A does not comprise an accessory protein.
The relevance of Thao is set forth above. It is silent on the exclusion of an envelope protein E of a coronavirus (sequence part B).
Regla-Nava describes the severe acute respiratory syndrome coronaviruses with mutations in the E protein are attenuated and promising vaccine candidates, and teaches that a mouse adapted SARS-CoV (SARS-CoV-MA15) lacking the envelope (E) protein (rSARS-CoV-MA15-ΔE) is attenuated in vivo. Their results suggested that the reduction in lung inflammation together with a more robust antiviral T cell response contributed to rSARS-CoV-MA15-E* attenuation. The attenuated viruses completely protected mice against challenge with the lethal parental virus, indicating that these viruses are promising vaccine candidates (Abstract).
It would have been prima facie obvious for one having ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Thao and Regla-Nava to arrive at an invention as claimed. One of skill in the art would have been motivated to do so because Regla-Nava teaches the rSARS-CoV-MA15-E* is stable and increase the half- life compared to the wild-type virus. Moreover, the Δ3 deletion introduced within the E protein maintained the interaction between E and M proteins. SARS-CoV attenuation correlated with limited lung pathology, mediated by decreased proinflammatory cytokine expression, increased anti-inflammatory cytokine levels, and reduced neutrophil accumulation in the lungs (See bridging pages 3884-3885). There would be a reasonable expectation of success to construct such a vector with E protein deletion/modification.
As for the limitation “wherein regulation of sequence part A does not comprise an accessory protein” claimed in claim 34, Thao teaches the GenScript perform the chemical synthesis of the nucleocapsid protein N (Sequence part A) for the viruses such as MHV-GFP, MERS-COV, and discloses that the overlapping cDNA fragments are cloned into the TAR vector under the T7 RNA polymerase promoter (See page 19). There is no evidence in Thao’s study to indicate that the sequence part A is regulated by accessory proteins.
Allowable Subject Matter
The SEQ ID NOs: 13 or a sequence having at least 98.5% sequence identity to the sequence as defined in SEQ ID NO: 13 are free of art.
The SEQ ID NOs: 49 or a sequence having at least 97.2% sequence identity to the sequence as defined in SEQ ID NO: 49 are free of art.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUIXUE WANG whose telephone number is (571)272-7960. The examiner can normally be reached Monday-Friday 8:00 am..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone, can be reached on (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RUIXUE WANG/Examiner, Art Unit 1672
/THOMAS J. VISONE/ Supervisory Patent Examiner, Art Unit 1672