Prosecution Insights
Last updated: July 17, 2026
Application No. 17/911,341

METHODS AND KITS FOR THE DETECTION OF SARS-COV-2

Final Rejection §103§112
Filed
Sep 13, 2022
Priority
Mar 13, 2020 — provisional 62/989,556 +2 more
Examiner
JADHAO, SAMADHAN JAISING
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Translational Genomics Research Institute
OA Round
2 (Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
98%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
26 granted / 50 resolved
-8.0% vs TC avg
Strong +46% interview lift
Without
With
+45.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
35 currently pending
Career history
104
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
61.5%
+21.5% vs TC avg
§102
5.6%
-34.4% vs TC avg
§112
12.2%
-27.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 50 resolved cases

Office Action

§103 §112
DETAILED ACTION Final Rejection Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions 2. Applicant’s election without traverse of Group I claims 1-4,7 and 62 in the reply filed on 11/20/2025 is acknowledged. Election of Species: Applicant elected species, without traverse, for claim 1, SEQ ID NO. 11 and elects, without traverse, for claim 62, SEQ ID NOs. 11 and 12 as the primer pair for SARS-CoV-2 and SEQ ID NOs. 22 and 23 as the primer pair for a common cold virus. Status of Claims (modified) 3. Claims 1-4, 7, 14-17, 20, 24-25, 27, 32, 34, 39, 41, 46, 48 and 62 as amended and filed on 02/26/2026 are pending. 4. Claims 14-17, 20, 24-25, 27, 32, 34, 39, 41, 46 and 48 belongs to non-elected Group II and are withdrawn from consideration. 5. Claims 1-4, 7 and 62 as per amended claim listing on 02/26/2026 are under examination in this office action. Priority 6. The present application is the U.S. National Stage of International Application No.PCT/US2021/022128, filed March 12, 2021, which claims the benefit of US, provisional patent application no. 62/989,556, filed March 13, 2020. Information Disclosure Statement 7. The information disclosure statement (IDS) submitted on 09/13/2022 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Withdrawn Rejection of Claims 8. Withdrawn rejection of claims 1-4, 7 and 62 under 35 U.S.C. 112(a) in view of amendment to the claims filed on 02/26/2026. 9. Withdrawn rejection of claims 1-4, 7 and 62 under 35 U.S.C. 112(b) in view of amendment to the claims filed on 02/26/2026. 10. Withdrawn rejection of claim 1 under 35 U.S.C. 102(a)(1)/(a)(2) in view of amendment to the claim 1 to comprise a reverse primer SEQ ID NO: 12 as filed on 02/26/2026. Claim Rejections - 35 USC § 112 (New) 11. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-4, 7 and 62 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection, see MPEP § 2163.04. The instant amended claims 1-4, 7 and 62 (as compared to claim listing filed on 11/20/2025) and examined on merit in the prior office action (12/18/2025) are directed to comprise “one or more primer sets and probe”. The applicant indicated that support for amended claims is found in the application filed, including the sequence disclosure and Table 1 (including the CoV-TGNO3 primer-probe set comprising SEQ ID NOs: 11, 12, and 13), as well as the passages describing the SARS-CoV-2 rRT-PCR assay and associated primer/probe sets. Applicant has not precisely indicated which paragraph the support is explicitly available for the claimed limitation spelled in the claim language. There is no explicit, implicit or inherent support to the amended claims. "With respect to newly added or amended claims, applicant should show support in the original disclosure for the new or amended claims. See, e.g., Hyatt v. Dudas, 492 F.3d 1365, 1370, n.4, 83 USPQ2d 1373, 1376, n.4 (Fed. Cir. 2007) (citing MPEP § 2163.04 which provides that a "simple statement such as ‘applicant has not pointed out where the new (or amended) claim is supported, nor does there appear to be a written description of the claim limitation claims 1-4, 7 and 62 in the application as filed’ may be sufficient where the claim is a new or amended claim, the support for the limitation is not apparent, and applicant has not pointed out where the limitation is supported."). Because the amended claims 1-4, 7 and 62 limitations are not commensurate with the specification, this is a new matter rejection. Applicant may amend the claims to narrow the claim limitation to overcome the New Matter rejection. Claim Rejections - 35 USC § 112 (New) 12. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 4, and 62 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The amended claim 1 recite limitation (a)-(c), whereas the limitation (c) is not recited what it comprises and therefore is indefinite for lacking clear antecedent basis. See e.g. MPEP 2173.05(e). The amended claim 1 is indefinite since the preamble refers to “one or more primer sets” but the “optionally” limitation introduces “probes”. Does the claim encompass ‘primers’ , probes or both?? The amended claims recite an oligonucleotide of 40 or fewer nucleotides in length, the primer SEQ ID NO: 11, 12 as recited “consisting of” has a definite length. There is a confusion over to which primers the limitation 40 or fewer nucleotides in length corresponds to? The instant claims 1 and 62 recite an optional limitation, “optionally, further comprising one or more probes selected from the group consisting of SEQ ID NO:13, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:20, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:32, and SEQ ID NO:36”. It is not clear whether the probe in the optional limitation is required to practice the invention or not? The instant claim 4 recite an optional limitation “optionally, further comprising one or more additional primer pairs, each additional primer pair comprising:(i) a forward primer comprising (A) a universal tail sequence and (B) a 3' target- hybridizing sequence consisting of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:26, SEQ ID NO:30,or SEQ ID NO:34; and(ii) a reverse primer comprising (A) a universal tail sequence and (B) a 3' target- hybridizing sequence consisting of SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:19, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:31, or SEQ ID NO:35”. It is not clear whether the additional primer pair in the optional limitation is required to practice the invention or not? Claim Interpretation (modified) 13. The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art. The broadest reasonable interpretation of a claim element (also commonly referred to as a claim limitation) is limited by the description in the specification. The instant elected amended claims 1-4, 7 and 62 are interpreted to be directed to composition comprising one or more primer sets and a probe for a nucleic acid based assay for a SARS-CoV-2. The amended claim 62 is directed to a kit comprising one or more primer sets and a probe for a nucleic acid-based assay for a SARS-CoV-2. Claim Rejections - 35 USC § 103 (modified) 14. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 15. Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over Peiris et al 2005 (US20050181357A1, published 08/18/2005), and Li et al 2021 (WO2021168478A1, 08/26/2021, with an earlier priority of 02/18/2020 to US 62/978,274 application) and as evidenced by Danish COVID-19 Consortium 2023 (GenBank Acc No. OY778721.1, SARS CoV-2 genome sequence). Claims 1: Peiris et al 2005 (US20050181357A1) is in the art and teaches high-throughput diagnostic assay for the human virus causing severe acute respiratory syndrome (SARS). The invention relates to a high-throughput reverse transcription-PCR diagnostic test for SARS associated coronavirus (SARS-CoV). The present assay is a rapid, reliable assay which can be used for diagnosis and monitoring the spread of SARS and is based on the nucleotide sequences of the N (nucleocapsid)-gene of the hSARS virus. The present method eliminates false negative results and provides increased sensitivity for the assay. Peiris et al 2005 discloses a nucleic acid sequence in SEQ ID NO: 2471 that has 100% identity with the nucleotide sequence of instant SEQ ID NO: 11 as recited below. The oligonucleotide has a 5’ terminus and a 3’ terminus and the oligonucleotide consist of 18 nucleotides that is less than 40 nucleotides. Qy 1 CGGCAGTCAAGCCTCTTC 18 |||||||||||||||||| Db 537 CGGCAGTCAAGCCTCTTC 554 Peiris et al 2005 discloses a nucleic acid sequence in SEQ ID NO: 2471 that has 100% identity with the nucleotide sequence of instant SEQ ID NO: 20 as recited below. The sequence can be used as a probe as claimed. Qy 1 CGCATTGGCATGGAAGTCACACC 23 ||||||||||||||||||||||| Db 958 CGCATTGGCATGGAAGTCACACC 980 Peiris et al 2005 does not teach the instant claimed reverse primer consisting of SEQ ID NO: 12. Li et al 2021 (WO2021168478A1) is in the art of compositions, assays, methods, diagnostic methods, kits, and diagnostic kits are disclosed for the specific and differential detection of SARS-CoV-2 and/or other viruses from samples and teaches SEQ ID NO: 329 that has 100% nucleotide sequence identity with instant SEQ ID NO: 12 as recited below: Qy 1 TGCTGCCTGGAGTTGAATTTCTT 23 ||||||||||||||||||||||| Db 1 TGCTGCCTGGAGTTGAATTTCTT 23 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Peiris et al 2005 by incorporating additional teachings of Li et al 2021 SEQ ID NO: 329 that has 100% nucleotide sequence identity with instant reverse primer SEQ ID NO: 12 as recited supra to arrive at the composition of claim 1. One of ordinary skills in the art would have been motivated to develop a sensitive nucleic acid detection assay for the detection of SARS-CoV-2 infection in a subject and for commercial success and for molecular epidemiology for emerging strain surveillance. One of the ordinary skills would have been apprised of a reasonable expectation of success to arrive at the invention of claim 1 given the combined prior art teachings as applied and as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention of instant claim 1. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G). 16. Claim 2 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Peiris et al 2005 (US20050181357A1, published 08/18/2005), and Li et al 2021 (WO2021168478A1, 08/26/2021, with an earlier priority of 02/18/2020 to US 62/978,274 application), and as evidenced by Danish COVID-19 Consortium 2023 (GenBank Acc No. OY778721.1, SARS CoV-2 genome sequence), and further in view of Metsky et al 2018 (US20180340215A1, 11/29/2018). The combined teachings of prior arts Peiris et al 2005 (US20050181357A1) and Li et al 2021 (WO2021168478A1) that taught one primer set in claim 1 as recited supra are incorporated here in entirety. The combined teachings however do not teach the added Markush limitation of instant claim 2, further comprising at least one additional primer set selected from the group consisting of e.g. (vi) a forward primer consisting of SEQ ID NO:22, a reverse primer consisting of SEQ ID NO:23. Metsky et al 2018 (US20180340215A1) teaches the added limitation of instant claim 2 by disclosing SEQ ID NO: 203037 that is identical with instant claimed forward primer SEQ ID NO: 22 as recited below. The oligonucleotide or primer of Metsky et al 2018 has one base “C” that corresponds to a degenerate base “Y” (Y = C or T in DNA, and C or U in RNA). Thus, the prior art forward primer comprises two species of sequences including the claimed sequence with 100% sequence identity. Qy 1 GGTTTYCGCCTGGTACGATT 20 |||||:|||||||||||||| Db 20 GGTTTCCGCCTGGTACGATT 39 Metsky et al 2018 (US20180340215A1) teaches instant claimed reverse primer SEQ ID NO: 202638 that is identical with instant claimed SEQ ID NO: 23 as recited below. Qy 1 GGGTCCACGTGATTGAGAAC 20 |||||||||||||||||||| Db 29 GGGTCCACGTGATTGAGAAC 10 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Peiris et al 2005 and Li et al 2021 with additional teachings of Metsky et al 2018 on one additional primer set to arrive at the composition of claim 2. One of ordinary skills in the art would have been motivated to develop a duplex assay for broader and sensitive nucleic acid detection assay for the detection of SARS-CoV-2 infection in a subject and for commercial success and for molecular epidemiology for emerging strain surveillance. One of the ordinary skills would have been apprised of a reasonable expectation of success to arrive at the invention of claim 2 given the combined prior art teachings as applied and as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention of instant claim 2. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G). 17. Claims 3 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Peiris et al 2005 (US20050181357A1, published 08/18/2005), and Li et al 2021 (WO2021168478A1, 08/26/2021, with an earlier priority of 02/18/2020 to US 62/978,274 application), and as evidenced by Danish COVID-19 Consortium 2023 (GenBank Acc No. OY778721.1, SARS CoV-2 genome sequence) and further in view of (US CDC 2020 (NPL 01/24/2020). Claim 3: The one or more primer sets of claim 1, wherein each probe is modified with an internal spacer or a detectably detectable label. Claim 7: The one or more primer sets of claim 3, wherein each probe is labeled at the 5' terminus with a fluorophore and the 3' terminus is complexed to a quencher of fluorescence of said fluorophore. The combined teachings of prior arts Peiris et al 2005 (US20050181357A1) and Li et al 2021 (WO2021168478A1) that rendered obvious claim 1 as recited supra are incorporated here in entirety. Peiris et al 2005 teaches the N-gene may be detected using a labeled nucleic acid probe comprising of the nucleotide sequence of SEQ ID NO:2471, complement thereof, or a portion thereof, and the portion may be 10, 20, 30, 40, 50, 100, 200, 400, 500, 600, 800, 1000, 1200 nucleotides in length. (see, para [0054], [0047] [0168]). Peiris et al 2005 does not show the location of the detectable a fluorophore label and a quencher in the nucleotide probe. US CDC 2020 is in the SARS-CoV-2 real time RT-PCR diagnostic assay and teaches probe labeled with a detectable label FAM at 5’ end and compatible quencher BHQ-1 at the 3’ end and thus renders the instant claims 3 and 7 added limitation obvious. 2019-nCoV_N1-P: 5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’ (see, page 2, table). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Peiris et al 2005 and Li et al 2021 by incorporating additional teachings of US CDC 2020 on detectable fluorophore FAM labeled at 5’ end and quencher at 3’ end of the probe as recited supra to arrive at the invention of instant claims 3 and 7. One of ordinary skills in the art would have been motivated to develop a quantitative and sensitive nucleic acid detection assay for the detection of SARS-CoV-2 infection in a subject and for commercial success and for molecular epidemiology for emerging strain surveillance. One of the ordinary skills would have been apprised of a reasonable expectation of success to arrive at the invention of claims 3 and 7 given the combined prior art teachings as applied and as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention of instant claims 3 and 7. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G). 18. Claim 62 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings Peiris et al 2005 (US20050181357A1, published 08/18/2005) as applied to claim 1 above, and further in view of and Li et al 2021 (WO2021168478A1, 08/26/2021, with an earlier priority of 02/18/2020 to US 62/978,274 application) and as evidenced by Danish COVID-19 Consortium 2023 (GenBank Acc No. OY778721.1, SARS CoV-2 genome sequence). Claims 62: Peiris et al 2005 (US20050181357A1) is in the art and teaches high-throughput diagnostic assay for the human virus causing severe acute respiratory syndrome (SARS). The invention relates to a high-throughput reverse transcription-PCR diagnostic test for SARS associated coronavirus (SARS-CoV). The present assay is a rapid, reliable assay which can be used for diagnosis and monitoring the spread of SARS and is based on the nucleotide sequences of the N (nucleocapsid)-gene of the hSARS virus. The present method eliminates false negative results and provides increased sensitivity for the assay. Kit: In a specific embodiment, the invention provides a diagnostic kit comprising nucleic acid molecules which are suitable for use to detect the N-gene of hSARS. In a specific embodiment, the N-gene comprises nucleic acid sequence of SEQ ID NO: 2471. In a specific embodiment, the invention provides a diagnostic kit comprising nucleic acid molecules which are suitable for use to detect the S-gene of hSARS. For oligonucleotide-based kits, the kit can comprise, for example: (1) an oligonucleotide, e.g., a detectably labeled oligonucleotide, which hybridizes to a nucleic acid sequence encoding a polypeptide of the invention or to a sequence within the N-gene; (2) a pair of primers useful for amplifying a nucleic acid molecule containing the N-gene sequence. The kit can also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent. The kit can also comprise components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit can also contain a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for use (see, para [0009] – [0010], [0070], claims 25-27). Peiris et al 2005 discloses a nucleic acid sequence in SEQ ID NO: 2471 that has 100% identity with the nucleotide sequence of instant SEQ ID NO: 11 as recited below. The oligonucleotide has a 5’ terminus and a 3’ terminus and the oligonucleotide consist of 18 nucleotides that is less than 40 nucleotides. Qy 1 CGGCAGTCAAGCCTCTTC 18 |||||||||||||||||| Db 537 CGGCAGTCAAGCCTCTTC 554 Peiris et al 2005 discloses a nucleic acid sequence in SEQ ID NO: 2471 that has 100% identity with the nucleotide sequence of instant SEQ ID NO: 20 as recited below. The sequence can be used as a probe as claimed. Qy 1 CGCATTGGCATGGAAGTCACACC 23 ||||||||||||||||||||||| Db 958 CGCATTGGCATGGAAGTCACACC 980 Peiris et al 2005 does not teach the instant claimed reverse primer consisting of SEQ ID NO: 12. Li et al 2021 (WO2021168478A1) is in the art of compositions, assays, methods, diagnostic methods, kits, and diagnostic kits are disclosed for the specific and differential detection of SARS-CoV-2 and/or other viruses from samples and teaches SEQ ID NO: 329 that has 100% nucleotide sequence identity with instant SEQ ID NO: 12 as recited below: Qy 1 TGCTGCCTGGAGTTGAATTTCTT 23 ||||||||||||||||||||||| Db 1 TGCTGCCTGGAGTTGAATTTCTT 23 Li et al 2021 (WO2021168478A1) additionally teaches compositions, assays, methods, diagnostic methods, kits, and diagnostic kits are disclosed for the specific and differential detection of SARS-CoV-2 and/or other viruses from samples, including veterinary samples, clinical samples, food samples, forensic sample, environmental samples (e.g., obtained from soil, garbage, sewage, air, water, food processing and manufacturing surfaces, or likewise), or biological sample obtained from a human or non-human animal (See, abstract). Amplification plot of qPCR assay, and the reagents for the qPCR assay being part of a kit for the detection of SARS-CoV-2 (See, para [0014]-[0022]) and more amplification reagents (e.g., primers, probes, buffer, polymerase, nucleotides, and the like). Optionally, a probe sequence is also included in the singleplex reaction volume (See para [0050]), sample preparation reagents (See, para [0044], [0079], [0100], See entire prior art). Peiris et al 2005 (US20050181357A1) is directed to a SARS CoV-2 virus nucleic based diagnostic assay and teaches a kit can also contain a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for use (See, para [0009], [0069]-[0070], [0073], claims 25-27). Therefore, the combined prior art teachings as applied to claim 62 as recited supra teaches and renders obvious all the limitations of instant claim 62 directed to a kit because the combination of applied prior arts teaches SEQ ID NOs: 11 and 12 as the primer set for SARS-CoV-2 and a probe SEQ ID NOs: 20 that would detect a SARS-CoV-2 virus. According to MPEP § 2112.01(III), “Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. In re Ngai, ** > 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004) < (Claim at issue was a kit requiring instructions and a buffer agent. The Federal Circuit held that the claim was anticipated by a prior art reference that taught a kit that included instructions and a buffer agent, even though the content of the instructions differed.). See also In re Gulack, 703 F.2d 1381, 1385-86, 217 USPQ 401, 404 (Fed. Cir. 1983)( "Where the printed matter is not functionally related to the substrate, the printed matter will not distinguish the invention from the prior art in terms of patentability….[T]he critical question is whether there exists any new and unobvious functional relationship between the printed matter and the substrate." ).” It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Peiris et al 2005, and Li et al 2021, as recited supra to arrive at the invention of instant claim 62. One of ordinary skills in the art would have been motivated to develop a sensitive nucleic acid detection assay kit for the detection of SARS-CoV-2 infection in a subject and for convenience of the end users and laboratories with the optimized reagents and protocol for reproducibility and quality assurance of the assay and for commercial success. One of the ordinary skills would have been apprised of a reasonable expectation of success to arrive at the invention of claim 62 given the combined prior art teachings as applied and as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention of instant claim 62. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G). 19. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Peiris et al 2005 (US20050181357A1, published 08/18/2005), and further in view of Li et al 2021 (WO2021168478A1, 08/26/2021, with an earlier priority of 02/18/2020 to US 62/978,274 application), Metsky et al 2018 (US20180340215A1, 11/29/2018), Schupp et al 2016 (US20160326572A1, 11/10/2016) and Williams-Woods et al 2011 (J Virol Methods. 2011 Dec;178(1-2):253-7). Claims 4: Peiris et al 2005 (US20050181357A1) is in the art and teaches high-throughput diagnostic assay for the human virus causing severe acute respiratory syndrome (SARS). The invention relates to a high-throughput reverse transcription-PCR diagnostic test for SARS associated coronavirus (SARS-CoV). The present assay is a rapid, reliable assay which can be used for diagnosis and monitoring the spread of SARS and is based on the nucleotide sequences of the N (nucleocapsid)-gene of the hSARS virus. The present method eliminates false negative results and provides increased sensitivity for the assay. Peiris et al 2005 discloses a nucleic acid sequence in SEQ ID NO: 2471 that has 100% identity with the nucleotide sequence of instant SEQ ID NO: 11 as recited below. The oligonucleotide has a 5’ terminus and a 3’ terminus and the oligonucleotide consist of 18 nucleotides that is less than 40 nucleotides. Qy 1 CGGCAGTCAAGCCTCTTC 18 |||||||||||||||||| Db 537 CGGCAGTCAAGCCTCTTC 554 Peiris et al 2005 do not teach the instant claimed reverse primer consisting of SEQ ID NOs: 12, and additional primer set forward primer SEQ ID NO: 22 and reverse primer SEQ ID NO: 23, and a universal tail sequences at 5’ end. Li et al 2021 (WO2021168478A1) is in the art of compositions, assays, methods, diagnostic methods, kits, and diagnostic kits are disclosed for the specific and differential detection of SARS-CoV-2 and/or other viruses from samples and teaches SEQ ID NO: 329 that has 100% nucleotide sequence identity with instant SEQ ID NOs: 12 as recited below: Qy 1 TGCTGCCTGGAGTTGAATTTCTT 23 ||||||||||||||||||||||| Db 1 TGCTGCCTGGAGTTGAATTTCTT 23 Li et al 2021 (WO2021168478A1) do not teach the instant claimed additional primer set forward primer SEQ ID NO: 22 and reverse primer SEQ ID NO: 23. Metsky et al 2018 (US20180340215A1) teaches the added limitation of instant claim 2 by disclosing SEQ ID NO: 203037 that is identical with instant claimed forward primer SEQ ID NO: 22 as recited below. The oligonucleotide or primer of Metsky et al 2018 has one base “C” that corresponds to a degenerate base “Y” (Y = C or T in DNA, and C or U in RNA). Thus, the prior art forward primer comprises two species of sequences including the claimed sequence with 100% sequence identity. Qy 1 GGTTTYCGCCTGGTACGATT 20 |||||:|||||||||||||| Db 20 GGTTTCCGCCTGGTACGATT 39 Metsky et al 2018 (US20180340215A1) teaches instant claimed reverse primer SEQ ID NO: 202638 that is identical with instant claimed SEQ ID NO: 23 as recited below. Qy 1 GGGTCCACGTGATTGAGAAC 20 |||||||||||||||||||| Db 29 GGGTCCACGTGATTGAGAAC 10 Schupp et al 2016 (US20160326572A1) is in the nucleic acid amplification and sequencing art and teaches oligonucleotide that comprises a universal tail sequence at 5’ end used as a strategy for amplicon sequencing (See, abstract, entire article, figure 1A). Williams-Woods et al 2011 is in virus RT-PCR nucleic acid amplification art and teaches direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers (See, abstract, entire article). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Peiris et al 2005 with additional teachings of Li et al 2021 and Metsky et al 2018 on one additional primer set sequences and teachings of Schupp et al 2016 and Williams-Woods et al 2011 on a universal tail sequence at the 5’ end to arrive at the composition of claim 4. One of ordinary skills in the art would have been motivated to add a universal tail sequence at the 5’ end of the primers to perform subsequent sequencing with universal primer or to increase the stringency of the specificity of the assay by increasing the annealing temperature after initial few amplification cycles of the assay for developing an assay that has a future commercial success view. One of ordinary skills in the art would have been motivated to develop a duplex assay for broader and sensitive nucleic acid detection assay for the detection of SARS-CoV-2 infection in a subject and for commercial success and for molecular epidemiology for emerging strain surveillance. One of the ordinary skills would have been apprised of a reasonable expectation of success to arrive at the invention of claim 4 given the combined prior art teachings as applied and as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention of instant claim 4. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G). Response to Arguments 20. Applicant’s arguments with respect to claims 1-4, 7 and 62 have been considered but are moot because the new ground of rejection rely on additional teachings of the reference applied in the prior rejection of record or matter specifically challenged in the argument. Applicant’s arguments: Rejections under 35 U.S.C. Q 103 The Office rejects: " Claims 1-3 under § 103 as unpatentable over Peiris as applied to claim 1 above, and further in view of Lau, et al., (J of Virology, 2011, 85(21), p. 11325-11337, hereinafter "Lau"), Woo, et al., (J Virology, 2012, 86(7) pages 3995-4008, hereinafter "Woo"), Disclaimer from the Centers for Disease Control and Prevention, (hereinafter "USCDC"), and as evidenced by the Danish Covid- 19 Genome, Consortium 2023 (GenBank Acc. No. OY778721.1, SARS CoV- 2 genome sequence, hereinafter "GenBankOY778721.1"); " Claim 4 under § 103 as unpatentable over Peiris, Lau, Woo, US_CDC, as evidenced by GenBankOY778721.1, and further in view of U.S. Patent Publication No. 2016/0326572 to Schupp, et al. (hereinafter "Schupp") and Williams-Woods, et al., (J Virol Methods. 2011 Dec; 178(1-2):253-7, hereinafter "Williams-Woods"); and " Claim 62 under § 103 as unpatentable over Peiris, as applied to claim 1 above, Lau, Woo, US_CDC, as evidenced by GenBankOY778721.1, and further in view of International Patent Publication No. W02021/168478 to Li, et al, with priority to US provisional 62/978,274 (hereinafter "Li") and U.S. Patent Publication No. 2018/0340215 to Metsky, et al., (hereinafter "Metsky"). (Office Action at pp. 8-18). Applicant respectfully disagrees. Obviousness requires a reason to modify or combine the prior art to reach the claimed invention, and a reasonable expectation of success in doing so, based on evidence, not hindsight. The Office bears the burden to set forth an articulated reasoning with a rational underpinning. See In re Lee, 277 F.3d 1338 (Fed. Cir. 2002); MPEP 2143. Applicant respectfully submits that the documents cited by the Examiner, whether considered alone or in combination with each other, do not teach, suggest, or render obvious at least the features of "a forward primer consisting of SEQ ID NO:11 and a reverse primer consisting of SEQ ID NO:12," as presently recited in independent claims 1, 4, and 62. A. Claims 1-3 As amended, claim 1 is not directed to a broad genus of "variant" primers or degenerate primers; rather, it is directed to a specific primer-probe set defined by exact sequences (SEQ ID NOs: 11/12/13) with defined length. The Office's reliance on Lau, Woo, the CDC publication, and GenBank evidence of mutation relates to degenerate primers and/or variability concepts that are no longer present in the claims. None of the cited art teaches or suggests selecting the particular combination of SEQ ID NOs: 11/12/13 as a primer-probe set, nor does the Office provide a non-hindsight rationale explaining why a skilled artisan would have modified Peiris to arrive at that specific three-component set with a reasonable expectation of success. Accordingly, claims 1-3 are not rendered obvious by the cited combination. As discussed above, Peiris does not teach or suggest at least the features of "a forward primer consisting of SEQ ID NO:11." Thus, Peiris also does not teach or suggest a primer set comprising a forward primer consisting of SEQ ID NO:11 and a reverse primer consisting of SEQ ID NO:12. Specifically, Lau is relied upon for teaching the use of degenerate primers (oligonucleotide with 5 or less mismatched nucleotides in the center or 5'end of the oligonucleotide as compared to the variant strain target sequence) designed using multiple sequence alignment of HCoV-OC43 genome sequences to amplify the cDNA from different strains and thus detect the variant strains. Office Action at 10. In view of the claim amendments, this argument is moot. Woo is relied upon for teaching complete genome sequencing by amplification of RNA to cDNA using degenerate primers designed by multiple sequence alignment of complete genomes of available coronaviruses and the virus strains. Id. at 11. In view of the claim amendments, this argument is also moot. USCDC is relied upon for teaching an oligonucleotide has a detectable label FAM at 5' end, 2019-nCoVN1-P: 5'-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3' and an oligonucleotide 2019-mCoVN3-P: 5'-FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1-3' that has one nucleotide position towards 5' end as a degenerate position "Y" (Y = C or T in DNA and C or U in RNA). Id. at 11. GenBankOY778721.1 is relied upon for providing evidence that SARS CoV-2 genome sequence can be naturally mutated by evolution and as compared to the instant claim. Id. at 11. In view of the claim amendments, this argument is also moot. Schupp is relied upon for teaching an oligonucleotide that comprises a universal tail sequence at 5' end used as a strategy for amplicon sequencing. Id. at 13. Williams-Woods is relied upon for teaching direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers. Id. at 13. B. Claim 4 (Universal Tail Feature) Amended claim 4 recites primers that include a 5' universal tail positioned 5' of a target-hybridizing region (e.g., a region consisting of SEQ ID NO: 11 for the forward primer and SEQ ID NO:12 for the reverse primer). Schupp and Williams-Woods describe tailed primers in sequencing contexts, but the Office has not shown a reason, grounded in the prior art, to modify the Peiris diagnostic primer system to incorporate a 5' universal tail in the particular manner claimed, nor has the Office shown a reasonable expectation that doing so would preserve the claimed assay performance characteristics without undue experimentation. Absent an articulated, evidence-based rationale to arrive at the specific claimed structure, claim 4 is not obvious. C. Claim 62 (Kit Claims) Amended claim 62 is directed to physical kit components (e.g., specific primer pairs selected from expressly recited sequence-defined alternatives), optionally including probes selected from an expressly recited set, together with detection reagents. The Office's combination relies in part on Li and Metsky. Applicant respectfully submits that the cited art does not teach or suggest the claimed kit as a whole, including the claimed selection of specific primer pairs in a single kit configuration for detection of SARS-CoV-2 and/or common-cold coronaviruses, and the Office has not articulated a non-hindsight rationale establishing why a skilled artisan would have combined these teachings to arrive at the claimed kit with a reasonable expectation of success. Further, to the extent the Office discusses "instructions for use" or other printed matter, claim 62 is not directed to printed matter but rather to tangible kit components defined by their sequence-specific oligonucleotides and detection reagents. More specifically, the Office Action alleges that, Peiris et al 2005, Lau et al 2011, Woo et al 2012, and US CDC 2020 teaches the oligonucleotide or a primer of claim 1 including variant of primer of claim 1 as recited supra, but does not teach the additional claimed elected primer species SEQ ID NOs: 12, 22 and 23. Id. at 14. Applicant respectfully disagrees because Peiris does not teach a forward primer consisting of SEQ ID NO:11. Li is relied upon for teaching SEQ ID NO: 329 that has 100% nucleotide sequence identity with instant SEQ ID NO: 12. Id. at 15. As Applicant understands, Li provides a long list of primers and probes encompassed by SEQ ID NO:4-SEQ ID NO:2533. However, Li does not teach a forward primer consisting of SEQ ID NO:l 1, let alone a primer pair consisting of SEQ ID NO:11 and SEQ ID NO:12. Metsky is relied upon for allegedly teaching "SEQ ID NO: 203037 that is identical with instant claimed SEQ ID NO: 22" and "SEQ ID NO: 202638 that is identical with instant claimed SEQ ID NO: 23." Id. at 15. As Applicant understands, Metsky relates to a method for generating a reduced set of hybrid selection probes capable of analyzing viral genomes in a sample and discloses 452,330 sequences. In other words, Metsky relates to solving a set cover problem for reducing the number of candidate probes needed to cover an entire target sequence and one or more variations of the target sequence. The probes of Metsky are about 100 nucleotides in length. SEQ ID NO: 203037 and SEQ ID NO: 202638 are both 75 nucleotides in length (see below; and USPTO Publication Site for Issued and Published Sequences (PSIPS)). SEQ ID NO: 203037 comprises SEQ ID NO: 22. SEQ ID NO: 202638 comprises the reverse complement of SEQ ID NO: 23. Thus, Metsky does not teach primers consisting of SEQ ID NO:22 and SEQ ID NO: 23. SEQ ID NO 203037 As amended Claim 62 is directed to: A kit for the detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or a common cold virus in a biological sample comprising: one or more primer sets of claim 1, wherein the primer set is capable of detecting SARS-CoV-2 or the common cold virus, if present, in the sample by amplification; and detection reagents; and optionally, further comprising a probe selected from the group consisting of SEQ ID NO:13, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:20, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:32, and SEQ ID NO:36. The cited prior art references do not teach or suggest all of the claim limitations because the primer sequences are not taught or disclosed. Further, paragraph [0111] of the application as filed provides that, "[s]hotgun metagenomic data of total RNA extractions from nine (9) nasopharyngeal samples were used as a query to identify any sequence reads that aligned using the Burrows Wheeler Aligner (BWA) to the primers and probes in the SARS-CoV-2 Assay" and "[r]esults showed that as a whole at least CoV-TGNO4, CoV-TGN06, CoV-TGNO3, CoV-TGS02, CoV-TGS03, and CoV-TGNO1 primer and probe sets are specific to SARS-CoV-2." Additionally, paragraph [0112] further provides, "[a]lthough individual primers and probe are not specific, none of the primer-probe sets of assays CoV-TGNO3, CoV-TGS02, or CoV-TGS03 hit the same organism-sequence in the NCBI nucleotide database." CoV-TGNO3 includes SEQ ID NOS: 11, 12, 13 (see, Table 1). These specific pairings of primers have not been previously disclosed. Applicant respectfully submits that selecting primers specific to SARS-CoV-2 without cross reactivity to any other organism found in nasopharyngeal samples and having the indicated limit of detection shown in the examples is not predictable and would require undue experimentation. Even if the cited art disclosed the specific primers (which they do not), there would be no expectation of success in combining a forward primer from one source with a reverse primer from another source. For at least the foregoing reasons, Applicant respectfully submits that the pending claims, as amended, are patentable and in condition for allowance. Applicant respectfully requests withdrawal of the rejections under 35 U.S.C. §§ 112, 102, and 103 and allowance of the application. If the Examiner believes that an interview would expedite resolution of any remaining issues, Applicant welcomes the opportunity to confer at the Examiner's convenience. In Response: In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the prior arts are directed to nucleic acid based diagnostic assays comprising primer and probe composition for or detection/quantification of SARS-CoV-2 viral RNA genome in a sample. The claimed primer and probe nucleotide sequences are recited in the prior art. The obviousness rejection for the claimed primer and probe composition and modification of probe with fluorochrome label (e.g. FAM) at 5’ end and Quencher BHQ-1 at 3’ end is known and routine in the art. Universal tail sequence at the 5’-end of the primers is known in the art for the reasons recited in the office action.is based on combination of the prior art. Optimization of the composition for optimal reaction condition is known in the art. In response to applicant's argument that the examiner has combined an excessive number of references, reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991). Applicant's arguments filed on 02/26/2026 have been fully considered but they are not persuasive, and the rejection of the amended claims is maintained. 21. Relevant Prior Arts: Muradrasoli et al 2009. Broadly targeted multiprobe qPCR for detection of coronaviruses: Coronavirus is common among mallard ducks (Anas platyrhynchos). J Virol Methods. 2009 Aug;159(2):277-87. Escutenaire et al 2007. SYBR Green real-time reverse transcription-polymerase chain reaction assay for the generic detection of different species of coronaviruses. Disclosed are degenerate primers developed for the generic detection of coronaviruses. Arch Virol. 2007 Jan;152(1):41-58. Crooke et al 2005. US20050100885A1. Compositions and methods for the treatment of severe acute respiratory syndrome (SARS) and to detect AARS virus, and to diagnose SARS virus-associated diseases. Tavares et al 2012. US20120021943A1. Multiple genetic disease diagnostic panels by one single test using microarray technology. Conclusion 22. No claim is allowed. 23. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). 24. A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672 /BENNETT M CELSA/Primary Examiner, Art Unit 1600
Read full office action

Prosecution Timeline

Sep 13, 2022
Application Filed
Dec 18, 2025
Non-Final Rejection mailed — §103, §112
Feb 26, 2026
Response Filed
Jun 03, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600750
METHODS FOR INACTIVATING AND STORING RESPIRATORY SYNCYTIAL VIRUS
4y 8m to grant Granted Apr 14, 2026
Patent 12577279
INFLUENZA VIRUS VACCINES AND USES THEREOF
3y 11m to grant Granted Mar 17, 2026
Patent 12516351
NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME
4y 2m to grant Granted Jan 06, 2026
Patent 12516352
NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME
4y 2m to grant Granted Jan 06, 2026
Patent 12496338
CAR for Treatment of HIV Infection
5y 7m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
98%
With Interview (+45.8%)
3y 6m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 50 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month